Characterization of Halophilic Bacteria Capable of Efficiently Biodegrading the High-Molecular-Weight Polycyclic Aromatic Hydrocarbon Pyrene

Abstract

Contamination of the environment by high-molecular-weight polycyclic aromatic hydrocarbons (HMW-PAH) occurs in hypersaline conditions, mainly in produced water derived from petroleum extraction, and biological treatment offers an attractive option to remove these pollutants. This study aimed at isolating and characterizing bacteria that biodegrade HMW-PAH pyrene in a halophilic environment. Two bacteria, 10PY2B and 20PY1A, were isolated by enrichment culture in 10% and 20% NaCl, respectively, in the presence of pyrene as the sole source of carbon. Using 16S rRNA analyses, 10PY2B was identified as Halomonas shengliensis and 20PY1A as Halomonas smyrnensis. These strains had doubling times of less than 24 h when pyrene was used at concentrations <50 ppm, making them as rapidly growing pyrene-biodegrading bacteria as the reference strain Mycobacterium vanbaalenii. 10PY2B and 20PY1A were more active at neutral to alkaline conditions, and at 25°C, efficiently biodegraded aromatic compounds of lower molecular weight than pyrene (sodium salicylate, naphthalene, phenanthrene, and anthracene). Within 18 days, the strains had biodegraded 50% of 50 ppm pyrene, and gas chromatography/mass spectroscopy led to identification of the metabolites 4-phenanthrenecarboxylic acid, 4-(1-hydroxynaphthalen-2-yl)-2-oxo-but-3-enoic acid, and phthalic acid. A possible pathway for pyrene biodegradation has been proposed based on these metabolites.

Introduction

Fossil fuels remain the main energy source that drives the world's industrial activity, and during the extraction of this fossil oil (and natural gas), high quantities of reservoir water, also known as “produced water” (PW), are generated. The volume of this PW increases further as the oil content in wells decreases (Fakhru'l-Razi et al., 2009). About 3 L of PW are generated for every liter of oil or gas produced (Fakhru'l-Razi et al., 2009). Thus, almost a quarter of a billion barrels of PW are generated daily in the world, representing 80 million barrels of oil (Fakhru'l-Razi et al., 2009). Most of the PW is reinjected into the reservoirs to enhance oil recovery, and around 5–10% is released into the environment, representing a staggering volume of almost 100 million liters daily (Fakhru'l-Razi et al., 2009). PW is contaminated with various pollutants, among them polycyclic aromatic hydrocarbons (PAHs), including naphthalene (NAPH), anthracene (ANT), phenanthrene (PHEN), and pyrene (PYR), among others (Fakhru'l-Razi et al., 2009).

High-molecular weight PAHs (HMW-PAHs), including PYR, are insoluble in water, which makes them recalcitrant to degradation (Seo et al., 2009; Nzila, 2013). These HMW-PAHs are associated with toxic effects in the environment, affecting marine flora and human health (Bostrom et al., 2002). In addition, PW is characterized by its high salinity that can reach up to >30% NaCl, which reduces further the solubility of HMW-PAHs (Fakhru'l-Razi et al., 2009).

Because of the high toxicity of HMW-PAHs (Bostrom et al., 2002; Verma et al., 2012), PW treatment is recommended before its release into the environment. Several approaches to remove pollutants from PW have been evaluated, including physical and chemical approaches. Physical approaches include adsorption, dissolved air precipitation, evaporation, electrodialysis, and filtration, while chemical approaches consist of precipitation, oxidation, photocatalysis, and electrochemical methods (Fakhru'l-Razi et al., 2009; dos Santos et al., 2014; Munirasu et al., 2016).

Biodegradation represents an attractive approach to treat PW. It utilizes the ability of microorganisms to grow by using pollutants as their source of carbon, leading to removal of the pollutants. This approach is improved by coupling it with bioaugmentation, which involves the addition of pollutant-biodegrading microorganisms into a microbial community in an effort to improve the efficiency of natural bacterial communities to biodegrade pollutants. Unlike the physical and chemical approaches, biological approaches are cost-effective and environment friendly (Nzila et al., 2016a). As stated earlier, salinity levels in PW are generally high, thus, halophilic microorganisms will be required to remove pollutants in this environment. Several studies have reported on the removal of organic pollutants from PW by biodegradation (Beyer and Palmer, 1979; Martins and Peixoto, 2012; Fathepure, 2014).

The coastline of the Arabian Gulf is heavily involved in oil extraction and transportation, and thus is one of the areas most exposed to oil contamination (Abed et al., 2006). This area (coastline of the Arabian Gulf) is also characterized by high temperatures and high salinity (Abed et al., 2006), thus it is a potential source of PAH biodegrading microorganisms that can be used for cleaning PW.

In this study, using contaminated soil samples from the Arabian Gulf coastline, halophilic bacteria capable of biodegrading PYR have been isolated and characterized. Their optimum growth conditions (based on temperature, pH and salinity) and their ability to biodegrade PAHs of lower molecular weight were investigated. The biochemical pathways of pyrene biodegradation in these bacteria were also studied through the identification of pyrene metabolites.

Materials and Methods

Chemicals

PYR, ANT, PHEN, NAPH, SALC (sodium salicylate), (NH₄)₂SO₄, KH₂PO₄, CaCl₂·7H₂O, MgSO₄·7H₂O, Na₂HPO₄, and FeSO₄·7H₂O were purchased from Sigma-Aldrich (St Louis, MO) [>98% purity]. Chemicals used in the preparation of Luria–Bertani (LB) Broth medium were purchased from Difco (Detroit, MI).

Sample collection, enrichment, and isolation of the bacterial strains

Samples were collected from a contaminated area on the shoreline of the Arabian Gulf in the industrial city of Jubail, Saudi Arabia (27°06′46.53″ N 49°22′24.53″ E). The enrichment culture was initiated with 1.0 g soil samples in 50.0 mL Bushnell Hass (BH) culture medium containing 10%, 20%, or 25% NaCl (wt/v). The composition of BH medium was as follows: (NH₄)₂SO₄ (2.38 g), NaH₂PO₄ (1.36 g), CaCl₂·7H₂O (10.69 g), MgSO₄·7H₂O (0.25 g), Na₂HPO₄ (1.42 g), and FeSO₄·7H₂O (0.28 mg) per liter, 1.0 mL of a mixture of trace elements, and 0.1% (wt/v) of PYR; this medium is referred to as BH-PYR. This medium is selective for halophilic bacteria that utilize PYR as their sole source of carbon.

The cultures were enriched by incubation at 37°C and 120 rpm for 2–3 weeks, followed by transfer to fresh BH-PYR medium (1/10, v/v) for another 2–3 weeks. After repeating the process four to five times, and when the bacterial growth could be ascertained (based on visual turbidity), the resulting bacterial suspensions, which are the PYR-biodegrading consortia, were isolated and cryopreserved in 15% glycerol (300 μL of 50% sterile glycerol in 700 μL of a bacterial suspension) at −80°C.

To isolate the individual bacterial species that form the consortia, cultures of 1% (wt/v) agar in BH-PYR, at appropriate NaCl concentrations (10% and 20% NaCl for 10PY2B and 20PY1A, respectively) were streaked on agar solid plates, and incubated at 37°C for 7–15 days. Colonies were isolated and streaked again on new plates to ascertain their purity, and these resulting individual colonies were cryopreserved in glycerol (as detailed in the previous paragraph) for further studies.

Scanning electron microscopy analysis

To carry out the scanning electron microscopy (SEM), bacteria were immobilized on small cover slides and fixed in a solution of formaldehyde (2.5%, v/v) for 12 h. Then, they were dehydrated by incubating the samples successively in a series of ethanol–water solutions (ethanol: 30%, 50%, 70%, 80%, 90%, and 95%) and then sputter coated with gold before their observation under the SEM (JEOL JSM-6460LV, Japan), as reported elsewhere (Oyehan and Al-Thukair, 2017).

Species identification (sequencing of bacteria) and phylogenetic analyses

Identification of bacterial species was carried out by 16S rRNA sequencing as previously described (Nzila et al., 2016b). In brief, bacterial colonies were suspended in 0.5 mL of sterile saline solution and centrifuged at 1,500 g for 3 min, and the DNA purified using an InstaGene Matrix Kit (Bio-Rad, Hercules, CA). Template DNA (1.0 μL) was amplified with 27F primer (AGAGTTTGATCMTGGCTCAG) and 1492R primer (TACGGYTACCTTGTTACGACTT), and sequenced using a Big Dye Terminator Cycle Sequencing Kit (Applied Biosystems, Foster City, CA) with the following primers: 518F: CCAGCAGCCGCGGTAATACG and 800R: TACCAGGGTATCTAATCC. Sequencing products were resolved on an automated DNA sequencing system (model 3730XL; Applied BioSystems). Phylogenetic analyses of these strains were carried out using MEGA^® (Version 7, Philadelphia, PA) software.

Assessment of bacterial growth in presence of PYR and various hydrocarbons, effect of pH, and salinity

Bacteria were precultured in LB-rich media, and experiments were initiated with about 10⁶ colony-forming units (cfu)/mL in 50 mL BH medium at the appropriate salinity, and supplemented with hydrocarbons at concentrations of 1.0 g/L or less, as will be explicitly mentioned. Growth was monitored by bacterial counts on solid agar plates and presented as cfu/mL. Concentrations of hydrocarbon in mg/L correspond to those in ppm if hydrocarbons are fully solubilized in the medium. At the tested concentrations, PAHs (in our case, pyrene) are not completely dissolved in the medium; however, for the sake of comparison with previous reports, concentrations in mg/L and ppm are used interchangeably throughout this study. All the experiments were carried out in duplicate, and error bars (in figures) represent standard deviations.

In all experiments, nonpolar substrates (PYR, PHEN, NAPH, and ANT) were dissolved in dimethyl sulfoxide (DMSO), and this DMSO was evaporated before adding the culture medium. SALC was dissolved directly in BH medium. Bacterial growth in the presence of PYR was also assessed at various temperatures (10°C, 25°C, 37°C, and 50°C), pH (3, 5, 7, and 9) and salinities (0%, 5%, 10%, 15%, and 20% of NaCl [wt/v]). A summary of experimental conditions and those that will be discussed in the next sections is presented in Table 1.

Table 1.

Summary of Experimental Conditions

Aim of experiments	Fixed parameters	Variable parameters	Experimental conditions	Tested bacteria
Growth at pH 7 and 37°C	pH 7	Salinity = 10% NaCl	Cond_1	Halomonas shengliensis (10PY2B)
	Temperature = 37°C
	PYR = 50 ppm
	pH 7	Salinity = 20% NaCl	Cond_2	Halomonas smyrnensis (20PY1A)
	Temperature = 37°C
	PYR = 50 ppm
Effect of pyrene concentration	pH 7	PYR concentrations = 1, 5, 50, 100 and 1,000 ppm	Cond_3	H. shengliensis (10PY2B)
	Temperature = 37°C
	Salinity = 10% NaCl
	pH and temperature (same as above)	Same as above	Cond_4	H. smyrnensis (20PY1A)
	Salinity 20% NaCl	Same as above	Cond_4	H. smyrnensis (20PY1A)
Effect of pH	Temperature = 37°C	pH 3, 5, 7 and 9	Cond_5	H. shengliensis (10PY2B)
	Salinity = 10% NaCl	pH 3, 5, 7 and 9	Cond_5	H. shengliensis (10PY2B)
	Temperature = 37°C	Same as above	Cond_6	H. smyrnensis (20PY1A)
	Salinity = 20% NaCl	Same as above	Cond_6	H. smyrnensis (20PY1A)
Effect of temperature	pH 7 and salinity = 10% NaCl	Temperature = 10°C, 25°C, 37°C and 50°C	Cond_7	H. shengliensis (10PY2B)
Effect of temperature	pH 7 and salinity = 20% NaCl	As above	Cond_8	H. smyrnensis (20PY1A)
Effect of salinity	pH = 7	Salinity = 0%, 5%, 10%, 15% and 20% NaCl	Cond_9	H. shengliensis (10PY2B)
	Temperature = 37°C	Salinity = 0%, 5%, 10%, 15% and 20% NaCl	Cond_9	H. shengliensis (10PY2B)
	Same as above	Same as above	Cond_10	H. smyrnensis (20PY1A
Growth with other aromatic substrates	pH 7	Use of aromatic substrates SALC, NAPH, PHEN and ANT	Cond_11	H. shengliensis (10PY2B)
	Temperature = 37°C
	Salinity = 10% NaCl
	pH 7	Same as above	Cond_12	H. smyrnensis (20PY1A)
	Temperature = 37°C
	Salinity = 20% NaCl
Kinetics studies	pH 7	Pyrene at 50 ppm	Cond_13	H. shengliensis (10PY2B)
	Temperature = 37°C
	Salinity = 10% NaCl
	As above except	As above	Cond_14	H. smyrnensis (20PY1A)
	Salinity = 20% NaCl	As above	Cond_14	H. smyrnensis (20PY1A)
Metabolite^* identification	pH 7	Pyrene at 1,000 ppm	Cond_15	H. shengliensis (10PY2B)
	Temperature = 37°C
	Salinity = 10% NaCl
	As above except	As above	Cond_16	H. smyrnensis (20PY1A)
	Salinity = 20% NaCl	As above	Cond_16	H. smyrnensis (20PY1A)

Cultures were initiated with around 10⁶ cfu/mL, except in experiments Cond_ 15 and 16 (^*), where the starting bacterial load was around 10⁹ cfu/mL.

ANT, anthracene; NAPH, naphthalene; PHEN, phenanthrene; PYR, pyrene; SALC, sodium salicylate.

To quantify bacterial growth in these various conditions, data from the exponential phases of growth (between the lowest and highest counts) were fitted using the characteristic growth equation Q_t = Q₀e^kt (Q is bacterium cfu/mL at time t, Q₀ is the starting bacterial count in the culture, and k is the growth rate), using Origin software (Version 9.3, Northampton, MA). Thereafter, the doubling time (dt) of bacterial growth was computed as dt = ln(2)/k (in hours), and the lower the dt the higher the bacterial growth.

Quantification and kinetics of residual PYR

The rate of degradation of PYR (k) was assessed by quantifying the remaining PYR in 100 mL bacterial cultures containing 50 ppm PYR after 18 days. Controls consisted of the same culture conditions except bacteria were not added. Every 3 days, a sample from one flask was collected for quantification. After sonication for 30 min, organic compounds were extracted with ethyl acetate (50 mL × 2), and the combined organic layers were dehydrated with calcium chloride and then concentrated to dryness under vacuum. Thereafter, the samples were dissolved in chloroform (500 μL) before injection into a gas chromatography (GC) system for quantification, as will be described in the following section. The concentration of PYR was deduced from a standard curve that was obtained from the GC analysis of the control flasks containing PYR at concentrations of 1, 5, 25, 50, and 100 mg/L in the BH medium (without bacteria). Values of quantified PYR were fitted using the classical exponential equation, Q_t = Q₀e^−kt, of substrate utilization by microorganisms (Lu et al., 2014). Thereafter, the degradation rate, k, was computed.

Detection of PYR metabolites by GC-mass spectrometry

Bacteria were grown for 5 days in 1.0 L of medium containing PYR at 1,000 ppm. Thereafter, the medium was filtered to remove excess PYR before extraction with ethyl acetate (100 mL × 3). The combined organic fractions were dehydrated with calcium chloride and then concentrated to dryness under vacuum. The resulting residue was dissolved in 1.0 mL chloroform and divided into two portions. One part was analyzed by GC-mass spectrometry (GC-MS) without further treatment, and the other part was evaporated to dryness and then subjected to derivatization by adding a trimethylsilyl (TMS) group to the compound. This process, also known as silylation, consisted of mixing the remaining residue with pyridine (40 μL), N,O-bis-trimethylsilyl acetamide (40 μL) and trimethylchlorosilane (20 μL), followed by incubation at 80°C for 10 min under nitrogen. The mixture was then diluted with 1.0 mL chloroform before its analysis by GC-MS.

To identify the pyrene metabolites, the GC-MS analyses were conducted using an Agilent 6890N GC equipped with an HP-1 (30 m, 0.25 mm [i.d.]) column using helium as the carrier gas attached to an Agilent 5975B MS, with the following analytical conditions: initial temperature of 60°C held for 2 min followed by an increase to 240°C at a rate of 10°C/min, a hold time at 240°C for 20 min, an increase to 300°C at 10°C/min, and then a hold time for 30 min. The MS analysis conditions consisted of an inlet temperature of 250°C and a mass range of 15–550 m/z.

Statistical analyses

Statistical analyses were carried out using one-way analysis of variance (ANOVA), t-test and a simple linear regression fitting model, and the strength of linearity was assessed based on the Pearson correlation coefficient. In all tests, p < 0.05 was considered to be the level of significance. The software MINITAB (Version16, Coventry, United Kingdom) was used in these analyses.

Results and Discussion

The enrichment experiment was carried out in culture media containing 10%, 20%, or 25% NaCl. These experiments lasted on average for 2 months and led to the isolation of two consortia, PYR-Cons-10 and PYR-Cons-20, capable of growing in the presence of 10% and 20% NaCl, respectively. No growth was observed in media containing 25% NaCl. The second step in the investigation was to isolate individual bacteria that form these consortia. Thus, consortia were streaked on agar solid plates containing the appropriate NaCl concentration (10% or 20% NaCl) in LB-rich medium, and incubated at 37°C for 3–5 days. Based on the shape and morphology of colonies, one single colony was identified in each consortium: 10PY2B and 20PY1A, from enrichment in media containing 10% and 20% NaCl, respectively. Light and electron microscopy studies showed that 10PY2B was punctiform and convex having a size of 1 × 0.6 μm, while 20PY1A colonies were circular, with no elevation (flat) and an entire margin, and with a size of 1.53 × 0.75 μm. Both strains harbored entire margins, and they were gram-negative.

To identify the bacterial species of these strains, 16S rRNA genes were sequenced (a total of 1,400 nucleotides) and compared with the available sequences in the National Center of Biotechnology Institute (NCBI) using the Basic Local Alignment Search Tool (BLAST) program for homology. By fixing the threshold at 99% homology, 10PY2B was identified as Halomonas shengliensis, GI: 970338913 (NCBI reference), and 20PY1A as Halomonas smyrnensis, GI: 97033891. Using the aforementioned 16S rRNA gene sequences, a phylogenetic tree of these strains was drawn with several Halomonas species, selected from the NCBI database. As shown in Fig. 1, using more than 30 different species of Halomonas, 10PY2B clustered together with H. shengliensis, while 20PY1A clustered with H. smyrnensis (Fig. 1).

FIG. 1.

Phylogenetic tree of strains 10PY2B and 20PY1A.

Growth of the bacteria in presence of 50 ppm PYR, at 37°C and pH 7

The second step in this study was to establish the growth profiles of these strains in the presence of PYR as the sole source of carbon. This analysis was carried out in the presence of 50 ppm PYR at 37°C, pH 7, and at their respective salinities (10% and 20% NaCl) [Table 1, Cond_1&2]. With an initial bacterial count of around 0.5–1 × 10⁶ cfu/mL, cultures grew to a maximum growth of 0.5–0.8 × 10⁹ cfu/mL within just 9 days (Fig. 2). The computation of dt gave values of 30.0 ± 1.5 and 24.2 ± 0.4 h for H. shengliensis 10PY2B and H. smyrnensis 20PY1A, respectively.

FIG. 2.

Growth profile of Halomonas shengliensis 10PY2B () and Halomonas smyrnensis 20PY1A () at temperature 37°C, pH 7.

Halophilic bacteria of the genus Halomonas have been shown to biodegrade the monoaromatic hydrocarbons phenol, benzoate, salicylate, cinnamic acid, and coumaric acid in the presence of 1.5–30% NaCl (Garcia et al., 2004; García et al., 2005). Dastgheib et al. (2012) showed that a mixed culture of Halomonas and Marinobacter bacteria could biodegrade PAHs, including NAPH, PHEN, ANT, fluoranthene, fluorene, and PYR. However, the contribution of Halomonas bacteria in this biodegradation could not be established since they were mixed with Marinobacter. The bacterium H. shengliensis has been demonstrated to biodegrade crude oil (Wang et al., 2007). Most reported microorganisms that biodegrade PYR in high-salinity conditions belong to the halophilic archaeas, including Haloferax, Halobacterium, Halorubrum, Haloarcula, and Natrialba (Bonfa et al., 2011; Erdoğmuş et al., 2013; Fathepure, 2014), although bacterial strains of genera of Bacillus, Marinobacter, Ochrobactrum, Thalassospira, Oceanicola, and Cycloclasticus have also been described to biodegrade PYR in various conditions of salinity (Wang et al., 2008; Yuan et al., 2009; Arulazhagan and Vasudevan, 2011; Fathepure, 2014; Khemili-Talbi et al., 2015; Zhou et al., 2016). The current study clearly shows that bacteria of the genus Halomonas (H. shengliensis and H. smyrnensis) can efficiently biodegrade PYR at high salinity.

Assessment of different concentrations of pyrene

As mentioned earlier, HMW-PAHs in general and PYR in particular are toxic, and the increase in their concentrations in culture medium is associated with a decrease or inhibition of bacterial growth. Thus, it is important to establish the effect of varying PYR concentrations on the growth of these halophile bacteria. Consequently, growth was measured as a function of PYR concentration (1, 5, 50, 100, and 1,000 ppm) [Table 1, Cond_3&4]. As shown in Fig. 3, at 1 and 5 ppm PYR, the two strains showed rapid growth, reaching a maximum growth within 3 days, and this maximum growth was higher at 1 ppm (0.8 × 10⁸–5 × 10⁸ cfu/mL) than at 5 ppm (0.4 × 10⁸–2 × 10⁸ cfu/mL). In media containing 50 ppm PYR, the maximum counts of the strains rose to almost 5–10 times higher (4 × 10⁸–9 × 10⁸ cfu/mL), however, these values were achieved in 6–9 days (compared with 3 days at 1 ppm). The use of a higher PYR concentration, 100 ppm, was associated with reduced growth, and at 1,000 ppm, none of the tested strains grew (Fig. 3). In line with these observations, the computation of dt values showed that, as PYR concentration increased, dt increased to 5–10, 12–16, 20–30, and 32–38 h at 1, 5, 50, and 100 ppm, respectively (Fig. 4). This is supported by the ANOVA test of the single regression showing a strong relationship between dt values and PYR concentrations (p < 0.05), and within the PYR concentration range of 1–100 ppm, this correlation can be predicted through the equation dt = 0.4614 + 0.0122xC for the strain 10PY2B (R² = 84.3%) (which indicates that 84.3% of the total variation of the dt values are explained by PYR concentrations [C]), while the corresponding equation for 20PY1A is dt = 0.4072 + 0.0109xC for 20PY1A (R² = 56.9%).

FIG. 3.

Growth profiles of Halomonas shengliensis 10PY2B (A) and Halomonas smyrnensis 20PY1A (B) at various pyrene concentrations: 1 (); 5 (); 50 (); 100 (); and 1,000 () ppm.

FIG. 4.

Doubling times of Halomonas shengliensis 10PY2B () and Halomonas smyrnensis 20PY1A () as a function of pyrene concentration.

One of the most rapidly growing PAH-biodegrading microorganisms (including PYR) reported so far had a dt value of around 24 h (Heitkamp et al., 1988; Khan et al., 2002). A careful observation of these data shows that concentrations of PAHs used in these experiments were generally less than 100 ppm. For instance, the nonhalophile Mycobacterium vanbaalenii has been reported to be one of the most rapidly growing PYR-biodegrading microorganisms, since it can reach a maximum growth (as measured by optical density) within 1 day (Heitkamp et al., 1988). However, this high growth rate was achieved using low PYR concentrations of around 0.5 ppm (Heitkamp et al., 1988; Khan et al., 2002). In the current study, with the use of concentrations that are 2–10 times higher (1–5 ppm), maximum growth was achieved within 3 days, corresponding to dt values of less than 24 h. Thus, the efficiency of PYR biodegradation by halophilic microorganisms reported in the current work is similar to that of the nonhalophilic and fast-growing M. vanbaalenii in PYR degradation. Another rapidly growing nonhalophilic strain of Mycobacterium flavescens was reported, and this strain could biodegrade PYR (50 ppm) with a dt of less than 1 day (Dean-Ross and Cerniglia, 1996). In comparison, at 50 ppm, the dt of the two isolated strains in the current study, H. shengliensis 10PY2B and H. smyrnensis 20PY1A, were less than 31 h (Fig. 4). Thus, these two strains, 10PY2B and 20PY1A, are as rapidly growing PYR-biodegrading bacteria as M. vanbaalenii. In addition, these strains can grow in the presence of high salinity. These data also show that PYR concentrations as high as 1,000 ppm inhibit the growths of the isolated halophiles. It is interesting to note that nonhalophilic microorganisms still grow at 1,000 ppm of PAHs in general and PYR in particular (Habe et al., 2004; Nzila et al., 2016b). However, to the best of our knowledge, no study on the use of 1,000 ppm of PAHs in biodegradation using a halophile has been reported so far (Martins and Peixoto, 2012; Fathepure, 2014). In these studies, PYR was used at 0.5–200 ppm in general, thus indicating that the halophilic bacteria may be more susceptible to PYR than nonhalophilic bacteria.

Variation of pH and temperature

To establish the best conditions for bacterial growth, the ability of H. shengliensis 10PY2B and H. smyrnensis 20PY1A to utilize PYR was assessed at pH 3, 5, 7, and 9 (Table 1, Cond_5&6). The two strains grew at pH 7 and 9 with maximum growth falling in the range 10⁸–10⁹ cfu/mL, which was attained within 6–9 days. However, in acidic media of pH 3 and 5, no growth was observed. The computation of dt showed values of around 20 to 30 h at pH 7 and 9 (Table 2). Interestingly, a trend toward a decrease in dt at pH 9 was observed for the two strains (Table 2); however, the ANOVA test showed that these dt differences (at pH 9 vs. pH 7) were not significant in both strains (p > 0.09).

Table 2.

Doubling Time (in Hours) of Strains as a Function of pH, Temperature, and Salinity

		Doubling time (h) (±standard deviation)
	Conditions	H. shengliensis (10PY2B)	H. smyrnensis (20PY1A)
pH	7	30.0 ± 1.5	24.2 ± 0.4
pH	9	27.3 ± 16.6	19.6 ± 1.6
Temperature, °C	10	25.2 ± 1.7	31.1 ± 1.5
	25	23.3 ± 1.6	20.4 ± 7.1
	37	30.0 ± 1.5	24.2 ± 0.4
	50	—	—
Salinity (NaCl), %	5	37.7 ± 6.4	28.0 ± 0.7^*
	10	30.0 ± 1.5	14.5 ± 0.2^**
	15	31.1 ± 4.3	20.9 ± 5.9^**
	20	—	24.2 ± 0.4^**

ANOVA analysis of salinity at 5% (^*) versus the grouped doubling time at salinity 10%, 15%, and 20% (^**) was statistically significant (p < 0.05) (for H. smyrnensis).

Most of the studies on biodegradation of pollutants, including PAHs, have been carried out at neutral pH values (Margesin and Schinner, 2001), and in an interesting review, Sorokin et al. (2012) reported the biodegradation of one-ring-containing aromatic compounds such as phenol, benzene, and salicylate, among others in alkaline media (pH 8–10) by haloalkaliphilic bacteria of the genera of Arthrobacter, Bacillus, Rodococcus, Marinobacter, and Halomonas, among others (Sorokin et al., 2012). Bacteria of the genera Rhodococcus, Alcaligenes, Acinetobacter, Dietzia, and Pseudomonas are reported to biodegrade the PAHs PHEN, ANT, fluorene and fluoranthene at pH 8–10; PYR biodegradation by Rhodococcus, and Mycobacterium at pH 9 was also reported (Sorokin et al., 2012). A recent study showed that the halophilic Thalassospira sp. strain can utilize PYR at alkaline pH (Zhou et al., 2016). However, careful observation of these data shows that most experiments were carried out at a moderate level of salinity (<5% NaCl). In the current study, PYR biodegradation was carried out at high salinity (10% and 20% NaCl), a clear indication that the isolated strains, H. shengliensis (10PY2B) and H. smyrnensis (20PY1A), have the potential to be used in biodegradation in conditions of hypersalinity and alkalinity.

The effect of temperature on the growth of the two bacterial strains was also evaluated at 10°C, 25°C, 37°C, and 50°C (Table 1, Cond_7&8). The two strains exhibited similar growth profiles at 10°C, 25°C, and 37°C, with maximum counts between 0.5 and 0.8 × 10⁸ cfu/mL, which was achieved within 6–9 days. Interestingly, the computation of dt showed that the two strains grew better at 25°C, with dt values <24 h, while these values increased to 24–30 h at 10°C and 37°C (Table 2). However, the ANOVA test did not indicate a significant difference between these dt values (p > 0.05). None of the strains grew at 50°C, indicating that these bacteria are not thermophiles. The biodegradation of PYR and other PAHs by thermophilic bacteria (temperature range of 55–70°C) has been reported, and they belong to various genera, including Geobacillus, Bacillus, and Thermus (Feitkenhauer and Markl, 2003; Feitkenhauer et al., 2003; Viamajala et al., 2007; Zeinali et al., 2008a, 2008b). It is interesting to note that the dt values of the two strains described in the current study were similar at 10°C and 37°C, an indication that these bacteria are psychrotolerant, indicating a wide temperature range at which they are active in biodegrading PYR.

Salinity

Strains 10PY2B (H. shengliensis) and 20PY1A (H. smyrnensis) were isolated in the presence of 10% and 20% NaCl, respectively. However, it is important to investigate the ability of these strains to utilize PYR in various conditions of salinity. Thus, the growth profiles of the two strains were assessed at 0%, 5%, 10%, 15%, and 20% NaCl (Table 1, Cond_9&10). In the absence of salinity, none of the tested strains grew. At 10% and 15% NaCl, H. shengliensis had dt values of 30.0 ± 1.5 and 31.1 ± 4.3 h, respectively, and the dt rose to 37.7 ± 6.4 h at 20% (Table 2). However, these differences were not statistically significant (p > 0.05). This strain, 10PY2B, did not grow at 20% NaCl.

In relationship to H. smyrnensis (which was isolated at 20% NaCl), the highest growth was observed at 5% NaCl, with a dt of 28.0 ± 0.7 h and the lowest dt was found at 10% NaCl (14.5 ± 0.2 h). Values pertaining to 15% and 20% NaCl were 20.9 ± 5.9 and 24.4 ± 0.4 h, respectively (Table 2). Pairwise comparison between the different salinities using Tukey's test showed no significant difference (p > 0.05). However, when the dt values at 5% NaCl were compared with the grouped dt values at 10%, 15%, and 20% NaCl, a significant difference was observed (p < 0.05), indicating that the growth of H. smyrnensis is significantly reduced at 5% salinity. Thus, salinity ranges of 5–15% and 10–20% are appropriate for H. shengliensis and H. smyrnensis, respectively.

A recent and interesting review on biodegradation of petroleum products showed that most of the halophilic microorganisms biodegrade PAHs (including PYR) in a salinity range of 1–15%, and generally, no biodegradation is observed in the absence of salinity (Fathepure, 2014). These observations are in line with the results reported in this work. The same review showed that microorganisms that were active in biodegrading PAHs at high salinity (20%) generally do not do so at low salinity. The exception was reported with Actinopolyspora sp., which could biodegrade the three-ring-containing PAH fluorene within a range of 5–20% NaCl (Al-Mueini et al., 2007), which is the salinity range of strain H. smyrnensis reported in the current study.

Utilization of other aromatic substrates

In the natural environment, aromatic petroleum products are found as mixtures of mono- and PAHs. It is common that a microorganism that can biodegrade a given PAH is usually also capable of utilizing a PAH of lower molecular weight (Nzila, 2013). Thus, the ability of the two isolated strains to biodegrade aromatic compounds of lower molecular weight was investigated, and these included the one-ring SALC, the two-ringed NAPH, and the three-ringed PHEN and ANT (Table 1, Cond_11&12). The data showed that dt values of the two tested strains increased as the number of rings increased; the ranges of dt were 9–16 h for SALC, 14–17 h for NAPH, and around 22–23 h for both PHEN and ANT (Fig. 5). In comparison, the use of PYR was associated with a higher dt range of 24–30 h. Statistical analysis based on the ANOVA test for simple regression showed a strong linear correlation between dt values and the substrate's number of aromatic rings in 10PY2B only. This linear correlation is based on the following equation: dt = −0.1253 + 0.3924xN (p = 0.001, R² = 77.1%) [N stands for the number of rings]. Overall, these strains can biodegrade not only PYR but also monocyclic aromatic hydrocarbons and PAHs of lower molecular weights, as has been reported with many other bacterial strains (Cao et al., 2009; Seo et al., 2009; Nzila, 2013).

FIG. 5.

Doubling times of Halomonas shengliensis 10PY2B () and Halomonas smyrnensis 20PY1A () in presence of various substrates. ANTH, anthracene; NAPH, naphthalene; PHEN, phenanthrene; PYR, pyrene; SALC, sodium salicylate.

Assessment of kinetics of PYR degradation

The rate of PYR degradation was also assessed for the two strains, by quantifying the amount of PYR remaining in the culture, every 3 days, using GC (Table 1, Cond_13&14). First, the residual values of PYR for each strain were compared between the control and experimental group using a t-test, and the results showed a significant difference between the mean percentage of the remaining PYR (control vs. experimental group) of 96.69% versus 66.40%, p = 0.007, 95% CI (11.80–48.73) for 10PY2B, and 96.00% versus 69.90%, p = 0.004, 95% CI (11.91–40.32) for 20PY1A. This is a clear indication that the decrease in the residual concentration of PYR is a result of the biodegradation process.

As Fig. 6 shows, starting with a concentration of 50 ppm, the amount of PYR decreased by 25–40% within 6–9 days in the two strains tested, and this period corresponds to the maximum bacterial count (Fig. 6). Incubation for 18 days resulted in biodegradation of 50% or more of PYR, while in the control, the remaining PYR was more than 90%. Further analysis of Pearson's correlation coefficients showed values of −0.972, p = 0.0009 and −0.90, p = 0.006 for 10PY2B and 20PY1A, respectively, indicating a significant decrease in residual PYR over time. To quantify this decrease, the degradation rates, k, were computed and showed values of −0.046 day⁻¹ (R² = 0.96) and −0.03 day⁻¹ (R² = 0.87) for H. shengliensis (10PY2B) and H. smyrnensis (20PY1A), respectively. Studies on the biodegradation of PYR in saline conditions have shown similar results. For instance, using medium containing 200 ppm PYR and 5% salinity, halophilic Thalassospira sp. biodegraded around 40% of PYR within 25 days (Zhou et al., 2016). Similar results have been reported for nonhalophilic bacteria such as Caulobacter sp. (Al-Thukair and Malik, 2016), Ochrobactrum intermedium (Oyehan and Al-Thukair, 2017), Mycobacterium sp. (Vila et al., 2001; Habe et al., 2004; Wang et al., 2012), Pseudomonas sp. (Ma et al., 2013), Leclercia adecarboxylata (Sarma et al., 2010), Diaphorobacter sp., Pseudoxanthomonas sp. (Klankeo et al., 2009), and Ochrobactrum sp. (Arulazhagan and Vasudevan, 2011).

FIG. 6.

Quantification of residual pyrene () in cultures of Halomonas shengliensis 10PY2B (A) and Halomonas smyrnensis 20PY1A (B). The line represents the fitted exponential graph. The controls, consisting of culture without bacteria () and the bacterial counts () are also represented.

Identification of pyrene metabolites

GC-MS analysis of H. shengliensis (Table 1, Cond_15) showed a metabolite having a retention time of 22.62 min, a molecular ion (M⁺) at m/z 328, and fragment ions at 313 (M⁺-CH₃), 297 (M⁺-OCH₃), 145 (COCOOTMS)⁺, 117 (COOTMS)⁺, and 73 (TMS)⁺. This metabolite was identified as the TMS derivative of 4-(1-methoxynaphthalen-2-yl)-2-oxo-but-3-enoic acid (II-Me) and was previously reported in PYR degradation using Thalassospira sp. strain TSL5-1 (Zhou et al., 2016). Another peak that appeared at 41.24 min had an M⁺ at m/z 386 and fragment ions at m/z 371 (M⁺-CH₃), 313 (M⁺-TMS), 297 (M⁺-OTMS), 147 [(CH₃)₃Si₂]H, 145 (COCOOTMS)⁺, 117 (COOTMS)⁺, and 73 (TMS)⁺. These fragments are consistent with the diTMS derivative of 4-(1-hydroxynaphthalen-2-yl)-2-oxo-but-3-enoic acid (II). A metabolite with a retention time of 13.20 min that had M⁺ at m/z 294 and fragmentation ions at m/z 221 (M⁺-TMS), 205 (M⁺-OTMS), 177 (M⁺-COOTMS), 147, 117 (COOTMS)⁺, and 73 (TMS)⁺ was identified as the TMS derivative of 4-phenanthrenecarboxylic acid (I). Most of these fragments (m/z 221, 205, 177, and 59) were previously observed for the methyl ester of 4-phenanthrenecarboxylic acid (Habe et al., 2004; Zhou et al., 2016), which is expected to produce similar fragments to the TMS derivative of the corresponding acid. These two identified metabolites support the view that oxidation and then cleavage of PYR take place at C4 and C5, as shown in Fig. 7.

FIG. 7.

Proposed metabolic pathway for pyrene biodegradation using Halomonas shengliensis and Halomonas smyrnensis. I: 4-phenanthrenecarboxylic acid, II: 4-(1-hydroxynaphthalen-2-yl)-2-oxo-but-3-enoic acid. II-Me: 4-(1-methoxynaphthalen-2-yl)-2-oxo-but-3-enoic acid, III: 1-hydroxyl-2-naphthoic acid, IV: 2-carboxycinnamic acid, and V: phthalic acid. Metabolites I, II, and V were detected by GC-MS analysis. Double arrows indicate that there are intermediate compounds before the next one.

Another metabolite was observed at retention time 20.03 min that had a base peak at m/z 149 and other fragment ions at m/z 121, 104, 93, 76, 57, and 41, and these fragments are consistent with a phthalic acid ester. The fragment at m/z 149 is a characteristic peak for phthalate esters (Wang et al., 2017). The GC-MS analyses of the PYR metabolites using H. smyrnensis (Table 1, Cond_16) indicated the presence of the three metabolites identified for H. shengliensis. Based on the identified PYR metabolites in H. shengliensis and H. smyrnensis, a tentative metabolic pathway was proposed as shown in Fig. 7. Similar PYR metabolic pathways that include metabolites I–V in Fig. 7 have previously been reported. For example, metabolites I and V in degradation using M. vanbaalenii PYR1 (Kim et al., 2005), Mycobacterium sp. strain KMS (Liang et al., 2006), and Bacillus megaterium YB3 (Meena et al., 2016), metabolites I, III, and V in degradation using Pseudomonas stutzeri CECT 930 (Moscoso et al., 2015), and metabolites I–V in PYR degradation using Thalassospira sp. strain TSL5-1 (Zhou et al., 2016). More studies should be conducted to identify more metabolites so as to define a more detailed PYR biodegradation pathway in these strains.

Conclusion

Biodegradation to remove PAHs in general and the HMW-PAH PYR in particular in a high-salinity environment requires the use of halophilic bacteria. The current work describes the isolation and characterization of two fast-growing halophilic bacteria, H. shengliensis and H. smyrnensis that can efficiently biodegrade PYR in high-salinity conditions (10–20% NaCl). These two strains had dt values <24 h in the presence of 1–50 ppm PYR, values which are in the range of M. vanbaalenii, a fast-growing PYR-biodegrading bacteria. Their optimum growth conditions were found to be at 25°C and at alkaline or neutral pH values. These strains can also efficiently biodegrade PAHs of lower molecular weight than PYR, thus, they can be used in bioremediation of PAHs of four rings or less, which are found in environments contaminated with petroleum products, including PW. The next step is to evaluate the ability of these bacteria to remove PAH in a high-salinity environment in pilot scale studies, which will lead to the use of these bacteria in in situ bioremediation.

Footnotes

Acknowledgments

The authors acknowledge the support provided by King Abdulaziz City for Science and Technology (KACST) through the Science and Technology Unit at King Fahd University of Petroleum and Minerals (KFUPM), for funding this work through Project No. 13-ENV1628-04, as part of the National Science, Technology, and Innovation Plan. The authors are grateful to KFUPM for personal support.

Author Disclosure Statement

No competing financial interests exist.

References

Abed

R.M.

, Al-Thukair

, and de Beer

(2006). Bacterial diversity of a cyanobacterial mat degrading petroleum compounds at elevated salinities and temperatures. FEMS Microbiol. Ecol., 57, 290.

Al-Mueini

, Al-Dalali

, Al-Amri

I.S.

, and Patzelt

(2007). Hydrocarbon degradation at high salinity by a novel extremely halophilic actinomycete. Environ. Chem., 4, 5.

Al-Thukair

A.A.

, and Malik

(2016). Pyrene metabolism by the novel bacterial strains Burkholderia fungorum (T3A13001) and Caulobacter sp (T2A12002) isolated from an oil-polluted site in the Arabian Gulf. Int. Biodeter. Biodegrad., 110, 32.

Arulazhagan

, and Vasudevan

(2011). Biodegradation of polycyclic aromatic hydrocarbons by a halotolerant bacterial strain Ochrobactrum sp. VA1. Mar. Pollut. Bull., 62, 388.

Beyer

A.H.

, and Palmer

(1979). Biological oxidation of dissolved compounds in oilfield-produced water by a pilot aerated lagoon. J. Petrol. Technol., 31, 241.

Bonfa

M.R.

, Grossman

M.J.

, Mellado

, and Durant

L.R.

(2011). Biodegradation of aromatic hydrocarbons by Haloarchaea and their use for the reduction of the chemical oxygen demand of hypersaline petroleum produced water. Chemosphere, 84, 1671.

Bostrom

C.E.

, Gerde

, Hanberg

, Jernström

, Johansson

, Kyrklund

, Rannug

, Törnqvist

, Victorin

, and Westerholm

(2002). Cancer risk assessment, indicators, and guidelines for polycyclic aromatic hydrocarbons in the ambient air. Environ. Health Perspect. 110 Suppl 3, 451.

Cao

, Nagarajan

, and Loh

K.C.

(2009). Biodegradation of aromatic compounds: Current status and opportunities for biomolecular approaches. Appl. Microbiol. Biotechnol., 85, 207.

Dastgheib

S.M.

, Amoozegar

M.A.

, Khajeh

, Shavandi

, and Ventosa

(2012). Biodegradation of polycyclic aromatic hydrocarbons by a halophilic microbial consortium. Appl. Microbiol. Biotechnol., 95, 789.

10.

Dean-Ross

, and Cerniglia

C.E.

(1996). Degradation of pyrene by Mycobacterium flavescens. Appl. Microbiol. Biotechnol., 46, 307.

11.

dos Santos

E.V.

, Bezerra Rocha

J.H.

, de Araújo

D.M.

, de Moura

D.C.

, and Martínez-Huitle

C.A.

(2014). Decontamination of produced water containing petroleum hydrocarbons by electrochemical methods: A minireview. Environ. Sci. Pollut. Res. Int., 21, 8432.

12.

Erdoğmuş

S.F.

, Mutlu

, Korcan

S.E.

, and Konuk

(2013). Aromatic hydrocarbon degradation by halophilic archaea isolated from Çamaltı Saltern, Turkey. Water Air Soil Pollut. 224, 1.

13.

Fakhru'l-Razi

, Pendashteh

, Abdullah

L.C.

, Radiah

, and Abidin

Z.Z.

(2009). Review of technologies for oil and gas produced water treatment. J. Hazard. Mater., 170, 530.

14.

Fathepure

B.Z.

(2014). Recent studies in microbial degradation of petroleum hydrocarbons in hypersaline environments. Front. Microbiol., 5, 173.

15.

Feitkenhauer

, and Markl

(2003). Biodegradation of aliphatic and aromatic hydrocarbons at high temperatures. Water Sci. Technol., 47, 123.

16.

Feitkenhauer

, Muller

, and Markl

(2003). Degradation of polycyclic aromatic hydrocarbons and long chain alkanes at 60–70 degrees C by Thermus and Bacillus spp [corrected]. Biodegradation, 14, 367.

17.

Garcia

M.T.

, Mellado

, Ostos

J.C.

, and Ventosa

(2004). Halomonas organivorans sp. nov., a moderate halophile able to degrade aromatic compounds. Int. J. Syst. Evol. Microbiol., 54, 1723.

18.

García

M.T.

, Ventosa

, and Mellado

(2005). Catabolic versatility of aromatic compound-degrading halophilic bacteria. FEMS Microbiol. Ecol., 54, 97.

19.

Habe

, Kanemitsu

, Nomura

, Takemura

, Iwata

, Nojiri

, Yamane

, and Omori

(2004). Isolation and characterization of an alkaliphilic bacterium utilizing pyrene as a carbon source. J. Biosci. Bioeng., 98, 306.

20.

Heitkamp

M.A.

, Franklin

, and Cerniglia

C.E.

(1988). Microbial metabolism of polycyclic aromatic hydrocarbons: Isolation and characterization of a pyrene-degrading bacterium. Appl. Environ. Microbiol., 54, 2549.

21.

Khan

A.A.

, Kim

S.J.

, Paine

D.D.

, and Cerniglia

C.E.

(2002). Classification of a polycyclic aromatic hydrocarbon-metabolizing bacterium, Mycobacterium sp. strain PYR-1, as Mycobacterium vanbaalenii sp. nov. Int. J. Syst. Evol. Microbiol., 52, 1997.

22.

Khemili-Talbi

, Kebbouche-Gana

, Akmoussi-Toumi

, Angar

, and Gana

M.L.

(2015). Isolation of an extremely halophilic arhaeon Natrialba sp. C21 able to degrade aromatic compounds and to produce stable biosurfactant at high salinity. Extremophiles., 19, 1109.

23.

Kim

Y.H.

, Freeman

J.P.

, Moody

J.D.

, Engesser

K.H.

, and Cerniglia

C.E.

(2005). Effects of pH on the degradation of phenanthrene and pyrene by Mycobacterium vanbaalenii PYR-1. Appl. Microbiol. Biotechnol., 67, 275.

24.

Klankeo

, Nopcharoenkul

, and Pinyakong

(2009). Two novel pyrene-degrading Diaphorobacter sp. and Pseudoxanthomonas sp. isolated from soil. J. Biosci. Bioeng., 108, 488.

25.

Liang

, Gardner

D.R.

, Miller

C.D.

, Chen

, Anderson

A.J.

, Weimer

B.C.

, and Sims

R.C.

(2006). Study of biochemical pathways and enzymes involved in pyrene degradation by Mycobacterium sp. strain KMS. Appl. Environ. Microbiol., 72, 7821.

26.

, Guo

, Zhang

, Lu

, and Dang

(2014). Biodegradation of single pyrene and mixtures of pyrene by a fusant bacterial strain F14. Int. Biodeter. Biodegrad., 87, 75.

27.

, Xu

, and Jia

(2013). Characterization of pyrene degradation by Pseudomonas sp. strain Jpyr-1 isolated from active sewage sludge. Bioresour. Technol., 140, 15.

28.

Margesin

, and Schinner

(2001). Biodegradation and bioremediation of hydrocarbons in extreme environments. Appl. Microbiol. Biotechnol., 56, 650.

29.

Martins

L.F.

, and Peixoto

R.S.

(2012). Biodegradation of petroleum hydrocarbons in hypersaline environments. Braz. J. Microbiol., 43, 865.

30.

Meena

S.S.

, Sharma

R.S.

, Gupta

, Karmakar

, and Aggarwal

K.K.

(2016). Isolation and identification of Bacillus megaterium YB3 from an effluent contaminated site efficiently degrades pyrene. J. Basic Microbiol., 56, 369.

31.

Moscoso

, Deive

F.J.

, Longo

M.A.

, and Sanromán

M.A.

(2015). Insights into polyaromatic hydrocarbon biodegradation by Pseudomonas stutzeri CECT 930: Operation at bioreactor scale and metabolic pathways. Int. J. Environ. Sci. Technol., 12, 1243.

32.

Munirasu

, Haija

M.A.

, and Banat

(2016). Use of membrane technology for oil field and refinery produced water treatment—A review. Proc. Safety Environ. Protect., 100, 183.

33.

Nzila

(2013). Update on the cometabolism of organic pollutants by bacteria. Environ. Pollut., 178, 474.

34.

Nzila

, Razzak

, and Zhu

(2016a). Bioaugmentation: An emerging strategy of industrial wastewater treatment for reuse and discharge. Int. J. Environ. Res. Public Health, 13, 846.

35.

Nzila

, Al-Thukair

A.A.

, Sankaran

, Basheer

, and Musa

M.M.

(2016b). Isolation and characterization of naphthalene biodegrading Methylobacterium radiotolerans bacterium from the eastern coastline of the Kingdom of Saudi Arabia. Arch. Environ. Prot., 42, 25.

36.

Oyehan

T.A.

, and Al-Thukair

A.A.

(2017). Isolation and characterization of PAH-degrading bacteria from the Eastern Province, Saudi Arabia. Mar. Pollut. Bull., 115, 39.

37.

Sarma

P.M.

, Duraja

, Deshpande

, and Lal

(2010). Degradation of pyrene by an enteric bacterium, Leclercia adecarboxylata PS4040. Biodegradation, 21, 59.

38.

Seo

J.S.

, Keum

Y.S.

, and Li

Q.X.

(2009). Bacterial degradation of aromatic compounds. Int. J. Environ. Res. Public Health, 6, 278.

39.

Sorokin

D.Y.

, Janssen

A.J.H.

, and Muyzer

(2012). Biodegradation potential of halo(alkali)philic prokaryotes. Crit. Rev. Environ. Sci. Technol., 42, 811.

40.

Verma

, Pink

, Rettenmeier

A.W.

, and Schmitz-Spanke

(2012). Review on proteomic analyses of benzo[a]pyrene toxicity. Proteomics, 12, 1731.

41.

Viamajala

, Peyton

B.M.

, Richards

L.A.

, and Petersen

J.N.

(2007). Solubilization, solution equilibria, and biodegradation of PAH's under thermophilic conditions. Chemosphere, 66, 1094.

42.

Vila

, Lopez

, Sabate

, Minguillón

, Solanas

A.M.

, and Grifoll

(2001). Identification of a novel metabolite in the degradation of pyrene by Mycobacterium sp. strain AP1: Actions of the isolate on two- and three-ring polycyclic aromatic hydrocarbons. Appl. Environ. Microbiol., 67, 5497.

43.

Wang

, Lai

, Cui

, Tan

, and Shao

(2008). A pyrene-degrading consortium from deep-sea sediment of the West Pacific and its key member Cycloclasticus sp. P1. Environ. Microbiol., 10, 1948.

44.

Wang

, Liu

, Tang

, Hou

, and Qin

(2017). Simultaneous determination of 15 phthalate esters in commercial beverages using dispersive liquid-liquid microextraction coupled to gas chromatography-mass spectrometry. Anal. Methods, 9, 1912.

45.

Wang

, Li

, Liu

, Li

, Kong

, Ren

, Wu

, and Tu

(2012). Degradation of pyrene by immobilized microorganisms in saline-alkaline soil. J. Environ. Sci. (China), 24, 1662.

46.

Wang

Y.N.

, Cai

, Chi

C.Q.

, Lu

A.H.

, Lin

X.G.

, Jiang

Z.F.

, and Wu

X.L.

(2007). Halomonas shengliensis sp. nov., a moderately halophilic, denitrifying, crude-oil-utilizing bacterium. Int. J. Syst. Evol. Microbiol., 57, 1222.

47.

Yuan

, Lai

, Wang

, Sun

, Liu

, Du

, Li

, Gu

, Zheng

, and Shao

(2009). Oceanicola pacificus sp. nov., isolated from a deep-sea pyrene-degrading consortium. Int. J. Syst. Evol. Microbiol., 59, 1158.

48.

Zeinali

, Vossoughi

, and Ardestani

S.K.

(2008a). Degradation of phenanthrene and anthracene by Nocardia otitidiscaviarum strain TSH1, a moderately thermophilic bacterium. J. Appl. Microbiol., 105, 398.

49.

Zeinali

, Vossoughi

, and Ardestani

S.K.

(2008b). Naphthalene metabolism in Nocardia otitidiscaviarum strain TSH1, a moderately thermophilic microorganism. Chemosphere, 72, 905.

50.

Zhou

, Wang

, Huang

, and Fang

(2016). Characterization of pyrene degradation by halophilic Thalassospira sp. strain TSL5-1 isolated from the coastal soil of Yellow Sea, China. Int. Biodeter. Biodegrad., 107, 62.