Mini Versus Standard Percutaneous Nephrolithotomy: The Impact of Sheath Size on Intrarenal Pelvic Pressure and Infectious Complications in a Porcine Model

Introduction

Percutaneous nephrolithotomy (PCNL) is the standard of care for management of large kidney stones. The complication rate after PCNL is close to 15% and major complications include bleeding, fever, pyelonephritis, systemic inflammatory response syndrome (SIRS), and sepsis. ^1,2 Among these, infectious complications are some of the most severe and may lead to prolonged hospital stay and intensive care unit admissions, resulting in costly care for patients. The incidence of SIRS after PCNL has been reported to up to 28%. ^{3 –6}

Although death after conventional PCNL is rare, occurring in <0.5% of cases, ¹ systemic urosepsis is associated with a high morbidity and mortality rates. ^7,8 Risk factors for infectious complications after PCNL include positive stone culture, positive pelvic urine cultures, and high renal pelvic pressures. ⁷ Although the exact mechanism of infectious complications after PCNL remains unclear, such complications are widely thought to be because of systemic absorption of bacteria or bacterial wall components such as endotoxins from the irrigation fluid. A study by Hinman and Lee-Brown demonstrated that renal pelvic pressures >30 mm Hg promote pyelovenous backflow and recent literature has shown that time spent at renal perfusion pressures of 30 mm Hg or greater was associated with postoperative fever. ^9,10

As an alternative to conventional PCNL, smaller percutaneous access of <20F has been proposed. Employing this technique of “Mini” PCNL, studies have shown comparable efficacy as well as smaller hemoglobin decreases, shorter postoperative hospital stays, and improved postoperative pain control at the expense of longer operative times. ^{11 –14} Although Mini-PCNL has been associated with increased time at elevated renal pelvis pressures, the infectious consequences of using the technique have not been characterized. ⁹

We hypothesized that renal pelvic pressures would be higher in the Mini-PCNL procedure than in a Standard approach and that higher pressures would correlate with infectious indicators. To test these hypotheses, we conducted a study of simulated PCNL surgeries in a porcine model.

Materials and Methods

After gaining approval from Institutional Animal Care and Use Committee, biosafety level II clearance was granted from the Institutional Biosafety Committee. We used a porcine model of farm-bred Yorkshire pigs that ranged in size from 38.6 to 55.5 kg (mean of 45.0 ± 5.0 kg). Pigs were isolated for 3 days before the start of the procedure to assure health for the surgery. Twenty pigs in total were used: 10 for the “Mini” arm and 10 for the “Standard” arm. Mini and Standard surgeries were conducted in alternating order.

Pigs were anesthetized using 20 mg/kg ketamine and 2 mg/kg xylazine for sedation and isoflurane for maintenance. Blood pressures were taken every 15 minutes with a standard arm blood pressure cuff. No prophylactic antibiotics were provided. Cystoscopy and cannulation of the ureteral orifice were performed using a semirigid ureteroscope. A guidewire was advanced to the renal pelvis and a ureteral access sheath (35 cm, 10/12F) was positioned at the ureteropelvic junction under fluoroscopic guidance. Procedures were conducted in the right side in all cases. Uropathogenic Escherichia coli strain ATCC^® 700928™ isolated from a patient with pyelonephritis was used to establish an infected urinary system. A total of 10⁹ uropathogenic E. coli were instilled into the porcine renal pelvis through the inner dilator of the ureteral access sheath. The total volume instilled was 5 mL and this was conducted after drainage of the renal pelvis as to avoid elevating pressures. The inner dilator of the sheath was capped after instillation, resulting in a dwell time of the bacteria in the renal pelvis of 1 hour.

Percutaneous access was then obtained under direct vision using an Olympus P6 flexible ureteroscope through the ureteral access sheath. The surgical method for endoscopic guided access was followed as previously described. ¹⁵ Renal tract dilatation and access were obtained using a 14/16F 20 cm ureteral access sheath (Cook Flexor) for “Mini” procedures and a 30F access sheath (X-Force N30; Bard, Covington, GA) for “Standard” procedures. In both instances, the sheaths were deployed antegrade over an Amplatz Super Stiff™(Boston Scientific, Marlborough, MA) wire under direct vision through the retrograde ureteroscope. No balloon dilatation was used for Mini arm procedures. Sheaths were positioned in the target calix.

Nephrolithotomy was simulated with endoscope manipulation utilizing either an 8/9.8F semirigid ureteroscope for the Mini arm and 26F nephroscope (Richard Wolf) for the Standard arm for 1 hour with 0.9% saline irrigation by raising the 1 L saline bag to 200 cm above the ground that was 100 cm above the kidney). The endoscope was manipulated with gentle advancements in and out of ∼3 cm with care not to cause urothelial trauma. Endoscope manipulations were similar for pigs. Intrarenal pelvic pressure was continuously monitored using General Electric CardioLab^® using a 5F catheter positioned at the ureteropelvic junction, retrograde through the access sheath. The 5F pressure monitoring catheter was left in place and the retrograde ureteral access sheath was removed. Postoperatively, pigs remained under anesthesia for 1 hour to monitor for signs of hemodynamic instability or fever. Throughout the procedure, blood samples were collected at standardized time points: preprocedure, 60 minutes after bacteria instillation, 60 minutes after the start of the PCNL simulation, and 60 minutes after completion of the procedure.

After sacrifice, random wedge tissue biopsies of peripheral parenchyma were taken from the ipsilateral kidney, at least 1 cm from the puncture site, liver, and spleen. Blood samples were incubated on agar plates with 1 mL of blood at 37°C for 48 hours. The tissue samples were incubated in 0.9% saline at room temperature for 1 hour and then 0.5 mL of solution was plated and incubated for 48 hours on agar plates at 37°C. To guarantee that isolates were the same bacteria as initially instilled, positive colonies were sampled and confirmed with reverse transcriptase polymerase chain reaction using primers from the p-fimbriae gene in uropathogenic E. coli: forward GTGCCTGCAGAAAATGCAGAT and reverse CCCGTTTTCCACTCGAATCA.

Results were analyzed using JMP Pro 12 software (SAS, Cary, NC). Proportions were compared using Pearson Chi squared test and means were compared using either two-sided t-test or Wilcoxon rank sum test. Threshold for statistical significance was set at p < 0.05.

Results

A total of 20 pigs underwent PCNL, 10 in each arm. Intrapelvic pressures were significantly higher in the Mini group than in the Standard group: 18.76 ± 5.82 mm Hg vs 13.56 ± 5.82 mm Hg (p < 0.0001). Pigs undergoing the Mini-PCNL spent a longer amount of time with intrarenal pressures >30 mm Hg: 116.99 seconds (range 98.02–165.53) vs 66.07 seconds (range 33.44–109.08) (p = 0.0452) (Table 1). No pig experienced hemodynamic instability or fever during the procedure or after the completion of PCNL during the 1-hour monitoring period. Compared with the Mini procedure, the Standard procedure used more total saline during the 1 hour of simulation PCNL: 16.1 ± 3.7 L vs 5.3 ± 0.71 L, p < 0.0001.

After incubation of tissue biopsies, all pigs had positive kidney tissue cultures whereas spleen cultures were positive in 100% and 60% of pigs in the Mini and Standard arms, respectively (p = 0.0253): 90% and 30% had positive liver tissue culture in the Mini and Standard arm, respectively (p = 0.0062). After incubation of blood samples on agar plates, 30% of pigs in the Mini arm had a positive blood culture at the 60 minutes PCNL collection compared with none in the Standard arm (p = 0.0603). Preoperative, postinstillation, and procedure completion blood cultures were all negative.

Discussion

The evolution of instrumentation and technique for PCNL demands a critical evaluation of those variables that not only impact efficacy but also could contribute to adverse events. ¹ In this study, we demonstrated that using a sheath and endoscope with smaller diameters was correlated with higher intrarenal pressure than the Standard approach. The literature on renal physiology shows that when intrarenal pressures are high, systemic absorption of renal pelvic contents may occur. This phenomenon allows irrigant, debris, and even bacteria to enter the blood stream through either pyelovenous–lymphatic backflow, pyelotubular backflow, or forniceal rupture. ¹⁶ This is supported by pathologic changes to renal tubule histology that occur when kidneys are subjected to pressures >20 mm Hg for a sustained period of time. ¹⁷ Although difficult to study in humans, higher pelvic pressures have been associated with postoperative fever after PCNL, a finding that suggests high pelvic pressures could be linked to perioperative sepsis. ⁹

This study validates concerns that small sheath and endoscope size may be correlated with adverse outcomes after PCNL because of higher intrarenal pressures. End organ seeding of bacteria was greater in the Mini arm than in the Standard arm. Although not statistically significant, only the Mini arm demonstrated that blood cultures were positive for uropathogenic E. coli. We hypothesize that these findings were likely because of larger amount of time spent at pelvic pressures above the backflow threshold of 30 mm Hg. Although the absolute difference in time spent >30 mm Hg was small, spikes in pressure that occurred when the endoscope was manipulated may have been enough to seed bacteria. Since renal pelvic pressure is a modifiable intraoperative risk factor, these data support efforts that decrease pressures during any renal surgery. Furthermore, the Mini arm used less saline irrigation, and the higher use in the Standard arm may have helped flush bacteria out of the kidney.

The definition of “Mini” access for PCNL is not strict but applies to percutaneous access that is significantly narrower in diameter than typical access, which is around 30F. In Standard PCNL, the space between the sheath and rigid endoscope provides a channel for outflow irrigation. In Mini PCNL with percutaneous access, there is less space between sheath (14/16F) and endoscope (8/9.8F) for irrigant to escape, resulting in higher system pressure than Standard PCNL (30F sheath and 24F endoscope). On average, Standard simulated PCNL in this study tripled the amount of irrigation capacity than Mini PCNL simulations. This not only aids in reducing pelvic pressures but it also may improve visibility for the surgeon by clearing stone debris. One claim used to advocate for smaller sheath sizes is that they cause less renal damage. However, when comparing 24F and 34F percutaneous nephrostomy tract dilatations, a study by Clayman and colleagues ¹⁸ did not find increased histologic damage 6 weeks after surgery in kidneys with larger tracts. Similarly, in a survival porcine model of Mini-PCNL, Traxer et al. ¹⁹ did not demonstrate any significant difference in renal volume loss or scarring with Standard tract size (30F) compared with Mini tract size (11F).

This study employed a porcine model of an infected urinary system using one strain of uropathogenic E. coli. The applicability of these results to human patients is limited before human studies are performed. In reality, patients with bacteria in their urinary systems may present for PCNL with a wide array of bacterial colonizations, including a variety of bacterial and/or fungal species, microorganism concentrations, and virulence factors. Similarly, bacterial release from renal calculi during intracorporeal lithotripsy may result in varying absorption kinetics based on intraoperative urothelial trauma, fragments obstructing the ureter during surgery, and pressure gradients generated by the pneumatic component of the lithotrite. Typically, when preoperative urine studies reveal the presence of infection, our institutional policy is to place the patient on antibiotics before the procedure. The risks of SIRS or sepsis when performing PCNL on patients with indeterminate infection status or patients with infected renal stones who have not received preoperative antibiotics are less clear. For these patients, the benefits of Mini-PCNL should be weighed against the potential infectious risks. As such, the generalizability of this study may be restricted to patients with indeterminate urinalysis studies or with infected stones. Before broad treatment recommendations can be made, it will be imperative to conduct randomized trials comparing Mini- and Standard PCNL in humans.

The settings of this study presented a limitation as they differ from lithotripsy in humans, in which with lithotripsy there is sequential fragmentation of stone that could potentially release bacteria throughout the course of the procedure, but in this study, bacteria were possibly washed away. Another limitation was that no lithotripsy with laser or ultrasonic devices was used to standardize the simulations. Although steps were taken to encourage bacterial virulence, only 1 hour of incubation time was allowed after bacterial instillation, thus limiting our infected urinary system model. Ideally, a model of infected stones could be used in future studies along with longer bacterial incubation periods; however, it would be difficult to standardize the colony counts in infected stones and the use of lithotrites could cause variable degrees of urothelial trauma, confounding the ability to reproduce the study design in a controlled manner. Furthermore, use of an intracorporeal lithotrite (ultrasonic, pneumatic, and/or laser) during mock PCNL might increase the ability for bacteria to cross into the bloodstream.

Conclusions

Mini-PCNL is associated with higher average intrapelvic pressures and more time spent >30 mm Hg during surgery. In the setting of an infected collecting system, this can lead to higher rates of bacterial seeding of extrarenal organs and potentially a higher risk of infectious complications.