Survival of Listeria monocytogenes in Simulated Gastrointestinal System and Transcriptional Profiling of Stress- and Adhesion-Related Genes

Abstract

Food ingestion is the major route of exposure to the important human pathogen Listeria monocytogenes. An in vitro gastrointestinal model was used to (1) compare the survival rates of L. monocytogenes strains of serotypes 1/2a, 1/2c, and 4b; and (2) examine the transcription of stress- and adhesion-related genes after exposure to the conditions similar to those encountered in the mouth, stomach, and small intestine. None of the L. monocytogenes strains investigated could survive in the gastric juice at pH 2.5 or 3.0. Their survival increased at higher pH (3.5 and 4.0) in the gastric stress. Relative survival of L. monocytogenes serotypes 4b and 1/2a strains were higher than that of serotype 1/2c, suggesting that pathogenicity might be related to the viability in the gastrointestinal tract. The transcription levels of prfA and the general stress-related genes clpC, clpE, and clpP were upregulated after passing through the simulated gastrointestinal tract, whereas that of the adhesion-related gene ami was downregulated. Taken together, this study revealed that L. monocytogenes strains enhanced the expression of stress-related genes and decreased the transcription of adhesion-related gene in order to survive in the diverse microenvironments.

Introduction

L isteria monocytogenes is a gram-positive intracellular bacterium that causes severe infections, such as gastroenteritis, septicaemia, encephalitis, meningitis, and abortion or stillbirths in humans and animals (Vázquez-Boland et al., 2001; Cossart, 2007). Listeriosis remains a concern in Europe with 1554 confirmed cases in 2007, displaying a high mortality rate of 20% (Watson, 2009). In France, the number of listeriosis cases has notably increased from 3.5 human cases per million during the period 2001–2005 to 4.6 in 2006 and 5.6 in 2007 (Goulet et al., 2008).

The ubiquitous presence of Listeria in nature contributes to its occurrence in food-processing environments and food products (Chen et al., 2009). Most of the L. monocytogenes isolates from foods are as virulent as the reference strain 10403S, as shown by mouse LD₅₀ assay and cytopathic plaque forming assay (Jiang et al., 2008). Another report also documented the virulent nature of the majority of L. monocytogenes isolates from different foods and environments in France (Roche et al., 2009). Nonetheless, L. monocytogenes strains display heterogeneous levels of virulence. Many are potentially highly pathogenic, but others are less virulent or even avirulent and produce little harm in the host (Olier et al., 2002; Liu et al., 2003; Jiang et al., 2006). Three serotypes (i.e., 1/2a, 1/2b, and 4b) contribute to the vast majority of human listeriosis (Farber and Losos, 1988; Jacquet et al., 2002; Swaminathan and Gerner-Smidt, 2007).

Almost all human listeriosis cases result from consumption of contaminated food products (Hain et al., 2007). Following such consumption, bacterial survival through the gastrointestinal tract plays a critical role in establishing infections (Sue et al., 2004). Sue et al. investigated σ ^B -dependent gene induction and expression under osmotic and acid stress conditions simulating the intestinal environment. However, there is a paucity of information regarding the viability and transcription of specific genes (stress-related genes) of L. monocytogenes strains after exposure to conditions simulating the mouth, stomach, and intestinal tract. Besides, in the preliminary pH_i determination experiment, L. monocytogenes strains were less adhesive to solid surfaces as compared to the control cells after exposure to the simulated gastrointestinal stress (data not shown). Therefore, adhesion-related genes like inlA and ami were also selected for transcription analysis.

The objectives of this study were (1) to compare the survival rates of L. monocytogenes strains from different serotypes and origins after passage through the simulated gastrointestinal tract and (2) to evaluate the transcription levels of specific virulence genes in different L. monocytogenes strains subjected to the conditions representing the mouth, stomach, and intestinal tract.

Materials and Methods

Bacterial strains and growth conditions

The L. monocytogenes strains used in this work are described in Table 1. Stock cultures were stored at −80°C in brain heart infusion (BHI) broth (Oxoid, Basingstoke, Hampshire, England) supplemented with 15% glycerol and streaked onto BHI agar plates prior to each experiment. For most experiments, listerial cultures were grown in BHI broth at 37°C overnight with shaking (250 rpm), followed by inoculation into 100 mL of BHI broth (1:100) for further growth at 37°C to an OD₆₀₀ of 0.4 (representing the mid-log phase culture). Subsequent passage in 100 mL of BHI was used to generate synchronized log-phase listerial cells before being exposed to the in vitro gastrointestinal system.

Table 1.

Sources, Serotypes, and Lineage Characteristics of All Listeria monocytogenes Strains Analyzed in This Study

Strain	Origin	Serotype	Lineage	Reference or source
EGDe	Rabbit clinical	1/2a	II	Glaser et al. (2001)
LO28	Human isolate	1/2c	II	Vicente et al. (1985)
FSL-J1-110	Human isolate	4b	I	Palumbo et al. (2003)
11137	Cheese isolate	4b	I	Budde and Jakobsen (2000)
O57	Salmon isolate	1/2a	II	Ben Embarek and Huss (1993)

Serogroup identification

A polymerase chain reaction (PCR) method, based on the parallel evolution of virulence genes together with somatic and flagellar antigens, was used to identify L. monocytogenes serotypes as described previously (Zhang et al., 2007). The primers used in this study are listed in Table 2 and synthesized by TAG Copenhagen A/S, Copenhagen, Denmark.

Table 2.

PCR Primer Pairs Used in This Study for Serogrouping and Lineage Identification of L. monocytogenes Test Strains

Primer	Primer sequences (5′-3′)	Product size (bp)	Serogroup	Reference
D1	F: CGATATTTTATCTACTTTGTCA	214	1/2b, 3b, 4b, 4d, 4e, 4a, 4c	Zhang et al. (2007)
	R: TTGCTCCAAAGCAGGGCAT
D2	F: GCGGAGAAAGCTATCGCA	140	1/2a, 1/2c, 3a, 3c	Zhang et al. (2007)
	R: TTGTTCAAACATAGGGCTA
FlaA	F: TTACTAGATCAAACTGCTCC	538	1/2a, 3a	Zhang et al. (2007)
	R: AAGAAAAGCCCCTCGTCC
GLT	F: AAAGTGAGTTCTTACGAGATTT	483	1/2b, 3b	Zhang et al. (2007)
	R: AATTAGGAAATCGACCTTCT
LM4B	F: CAGTTGCAAGCGCTTGGAGT	268	4a, 4c	Zhang et al. (2007)
	R: GTAAGTCTCCGAGGTTGCAA
actA	F: TGAAGAGGTAAATGCTTCGGACTT	549	–	Jiang et al. (2008)
	R: GCATTTCTTGAGTGTTTTCCTGTT

Lineage classification

Lineage classification was carried out according to the method described previously (Jiang et al., 2008). Genomic DNA of L. monocytogenes strains was extracted using the GenElute™ Bacterial Genomic DNA kit (Sigma-Aldrich Co., St. Louis, MO) as directed by the manufacturer. A 549 bp fragment of the virulence gene actA was amplified from L. monocytogenes strains using the primer pairs actA-F/actA-R listed in Table 2. After purification with GFX PCR DNA and gel band purification kit (GE Healthcare, Amersham, Buckinghamshire, UK), the target PCR fragments were directly used for sequencing by DNA Technology A/S (Risskov, Denmark) using the Dideoxy method.

In vitro gastrointestinal system

The in vitro gastrointestinal model simulating digestive processes of the mouth, stomach, and small intestine was used as previously described (Versantvoort et al., 2005) with some modifications. Briefly, 20 mL of L. monocytogenes cells grown to mid-log phase were centrifuged at 3000 rpm for 10 min, resuspended with 6 mL saliva (pH 6.8), and incubated for 5 min. Saliva-treated samples were then taken out for survival test or RNA extraction. For gastric stage, 12 mL of gastric juice at a certain pH was added separately to the tube sets containing L. monocytogenes in saliva, and the mixtures were rotated for 2 h and then collected for further survival determination or RNA extraction. Finally, the intestinal juice at pH 6.5 consisting of 12 mL duodenal juice, 6 mL bile, and 2 mL bicarbonate solution was added to the mixture containing saliva and gastric juice in the remaining tubes and incubated with rotation for another 2 h, which was then taken out for further analysis. All of the juices used in this study were in vitro synthetics containing inorganic solutions and organic solutions as described in detail previously (Oomen et al., 2003). For the initial survival test, four different pH levels (2.5, 3.0, 3.5, and 4.0) of the gastric juice were used, and 100 μL of listerial cells exposed to each stress treatment and the unexposed control cells at t = 0 were plated for subsequent enumeration on BHI agar plates.

For gene transcription analyses, listerial cells after exposure to each stress (saliva, t = 5 min; gastric stage, t = 125 min; and intestinal treatment, t = 245 min) as well as the control cells (t = 0) were harvested at once by low-speed centrifugation at 2000 rpm for 2 min and immediately resuspended in 0.5 mL phosphate-buffered saline (pH 7.0) and 1 mL RNAProtect™ bacteria reagent (Qiagen, Hilden, Germany) to stabilize RNA. The cell pellets were then collected via centrifugation at 5000 rpm for 2 min, frozen immediately in liquid nitrogen, and kept at −80°C until further analysis.

TaqMan^® quantitative real-time (qRT) PCR

RNA isolation for qRT-PCR was conducted using the RNeasy^® Mini Kit (Qiagen), following the guidelines of the kit protocol. The bacterial cells were mechanically disrupted, followed by DNase I digestion to remove genomic DNA contamination. The RNA templates were eluted in RNase-free water. The quality and integrity of RNA samples were assessed by electrophoresis on 1% agarose gel, and the concentration of each RNA sample was determined using GeneQuant II RNA/DNA Calculator (Pharmacia Biotech, Cambridge, England).

One microgram of the RNA template from each sample was subsequently subjected to reverse transcription using TaqMan reverse transcription reagent (Applied Biosystems, Foster City, CA). The concentration of synthesized cDNA from each sample was also ascertained using GeneQuant II RNA/DNA Calculator, and 3.75 μg of each cDNA template was used for qRT-PCR assays.

QRT-PCR with primers and probes listed in Table 3 was used to evaluate transcript levels for inlA, ami, clpC, clpE, clpP, and prfA, as well as for the housekeeping genes rpoB and gap selected as reference genes for internal control (Milohanic et al., 2003; Schwab et al., 2005). All probes were synthesized by Applied Biosystems Inc. (Warrington, Cheshire, UK), while primers were synthesized by TAG Copenhagen A/S. qRT-PCR was performed using TaqMan one-step RT-PCR master mix reagent (Applied Biosystems, Warrington, UK) and the 7500 Fast Real-Time PCR System (Applied Biosystems Inc., Foster City, CA). Control reactions without reverse transcriptase were used for each template to quantify genomic DNA contamination. Standard curves for each target gene were included to determine the amplification efficiency. Triplicate qRT-PCR reactions were loaded into MicroAmp optical 96-well reaction plates and run using the following program: 1 cycle at 95°C for 20 sec and 40 cycles at 95°C for 3 sec and 60°C for 30 sec. qRT-PCR was performed in duplicate using two independent RNA isolation from cells collected in two separate in vitro gastrointestinal experiments.

Table 3.

TaqMan Primer and Probe Sequences Used in This Study

Gene	Annotation	F/R/P ^a	Sequence (5′ to 3′) ^b	Reference
clpC	ATPase, stress response	F	GCGGCTGTTCAAGGKCAAG	Olesen et al. (2009)
		R	TTGCCAATTCGCTTTWGTTTCTT
		P	6FAM-AAAGCAGCGTCATTACG-NFQ
clpE	ATP-dependent protease	F	CCGTGTTGGCCTCAAATCA	Olesen et al. (2009)
		R	CACTAGTACCAAACAATTCACGAGCTA
		P	6FAM-AAATCGCCCAATTGG-NFQ
clpP	ATP-dependent Clp protease proteolytic subunit	F	AGCTGGTATGGCCATTTACGA	Olesen et al. (2009)
		R	CCCATGCCGATWGTTTGYACGT
		P	6FAM-ACAATGAATTTCGTTAAAGC-NFQ
prfA	Transcriptional regulator	F	CTATTTGCGGTCAACTTTTAATCCT	Olesen et al. (2009)
		R	CCTAACTCCTGCATTGTTAAATTATCC
		P	6FAM-ATGGCATCAAGATTAC-NFQ
inlA	Internalin A	F	AATGCTCAGGCAGCTACAMTTACA	Olesen et al. (2009)
		R	CGTGTCTGTTACRTTCGTTTTTCC
		P	6FAM-CAGCTCTAGCGGAAAA-NFQ
ami	Autolysin, amidase	F	CGATGAATTTGCTCGTTCTATTAATAAC	Olesen et al. (2009)
		R	TCACTGTGCGCGCTATCAA
		P	6FAM-TGCGTACCTTTTAGATCAATA-NFQ
rpoB	RNA polymerase (beta subunit)	F	CCGCGATGCGAAAACAAT	Olesen et al. (2009)
		R	CCWACAGAGATACGGTTATCRAATGC
		P	6FAM-TTATGACGGACGTTCTGGT-NFQ
gap	Glyceraldehyde-3P-dehydrogenase	F	ACACTGGTGACCAAAATACATTAGATG	This study
		R	CACGTGCACGACGGAAGTC
		P	6FAM-TCCACATCCAAAAGG-NFQ

Direction of primers and probes: F, forward; R, reverse; P, probe.

Symbols K: G or T; M: A or C; R: A or G; W: A or T; Y: C or T; 6FAM: fluorochrome at 5′ end of the probe; NFQ: quencher of 6FAM at 3′ end of the probe.

Relative gene transcription levels (fold changes) were calculated using the efficiency-calibrated model as previously described (Pfaffl, 2001). The fold changes of selected genes (inlA, ami, clpC, clpE, clpP, and prfA) were gauged relative to the transcription levels at t = 0 set to baseline 1.0.

Statistical analysis

The data of both survival rates and relative gene transcription levels were analyzed using general linear models procedure in SAS (SAS, 1999). The individual results were subjected to one-way analysis of variance, with strain (for survival rates) or treatment together with strain (for qRT-PCR study) as the class variable. Significant (p < 0.05) differences were ranked by Duncan's multiple range method. The results are presented as mean ± standard error of mean (S.E.M.).

GenBank accession numbers

The actA sequences for the five L. monocytogenes strains examined in this study have been deposited in GenBank under accession numbers FJ947111 to FJ947115.

Results

Serotyping using PCR and lineages analysis based on partial actA sequence

Using the PCR method probing virulence genes as well as somatic and flagellar antigens, the five test strains of L. monocytogenes belonged to three serotypes, that is, 1/2a, 1/2c, and 4b (Table 1). Lineage classification on the basis of partial actA sequence indicated that the five strains fell into lineages I and II (Table 1), which is consistent with the aforementioned serogroup result and previous reports (Ragon et al., 2008; Roldgaard et al., 2009).

Survival of L. monocytogenes strains in the in vitro gastrointestinal tract

Table 4 shows that most L. monocytogenes strains survived well after saliva treatment (>90%) except the salmon isolate strain O57 (1/2a, lineage I), which had a significantly lower survival rate of 64.42% (p < 0.05). All the test strains were highly sensitive to the gastric juice at pH 2.5 and 3.0. In gastric juice at pH 3.5 survival was low for four strains while strain O57 exhibited increased survival (80%) (p < 0.05) (Table 4). Higher survival of the strains was also seen in the gastric phase at pH 4.0 with survival rates between 35.32% and 85.92%. Bacteria in the gastric phases at or below pH 3.5 showed no apparent regrowth in their subsequent encounter with the intestinal fluid at pH 6.5. Strains EGDe, LO28, 11137, and FSL-J1-110 survived less well in the gastric juice pH 4.0 and intestinal fluid pH 6.5 combination, compared to their relative survival in gastric juice at pH 4.0. O57 showed increased survival in the intestinal fluid at pH 6.5 with upper gastric treatment at pH 4.0 (139.73% vs. 77.31%) (p < 0.05). In general, L. monocytogenes strain O57 was found to be the most resistant toward the passage through the gastrointestinal system, while strain LO28 appeared to be the most sensitive (Table 4).

Table 4.

Survival of L. monocytogenes Test Strains Subjected to Sequential Treatments in Simulated Gastrointestinal Fluids: Saliva at pH 6.8, Gastric Juices at Different pH, and Then in Intestinal Fluid at pH 6.5

	Survival rate (%) ^a
Treatment	EGDe	LO28	11137	FSL-J1-110	O57
Saliva, pH 6.8	97.27 ± 1.67^f	96.20 ± 3.13^f	93.86 ± 4.53^f	90.58 ± 4.61^f	64.42 ± 2.26^g
Gastric 2.5	0.0018 ± 0.0006^f,g	0.0026 ± 0.0007^f	0.00029 ± 0.00008^g,h	0.00002 ± 0.00002^h	0.0012 ± 0.0007^f,g,h
Gastric 3.0	0.05 ± 0.01^g	0.02 ± 0.01^g	< 10⁻⁵ ^g	0.01 ± 0.01^g	7.35 ± 0.86^f
Gastric 3.5	2.49 ± 0.35^h	0.22 ± 0.02ⁱ	11.79 ± 0.75^g	0.04 ± 0.00ⁱ	80.00 ± 1.21^f
Gastric 4.0	75.05 ± 4.02^f	35.32 ± 3.42^g	85.92 ± 8.15^f	73.96 ± 3.16^f	77.31 ± 4.53^f
In (Ga 2.5),^b pH 6.5	0.0010 ± 0.0003^g	< 10⁻⁵ ^g	0.0028 ± 0.0010^g	0.0220 ± 0.0103^f	0.0041 ± 0.0001^g
In (Ga 3.0),^c pH 6.5	0.05 ± 0.01^g	0.01 ± 0.00^g	< 10⁻⁵ ^g	0.13 ± 0.00^g	1.09 ± 0.11^f
In (Ga 3.5),^d pH 6.5	0.53 ± 0.02^g	0.11 ± 0.01^g	0.30 ± 0.08^g	0.27 ± 0.02^g	76.80 ± 5.26^f
In (Ga 4.0),^e pH 6.5	50.81 ± 2.50^g	0.66 ± 0.07^h	11.19 ± 0.64^h	1.18 ± 0.03^h	139.73 ± 8.01^f

Data is expressed as mean ± S.E.M.

b–e

Survival rates in intestinal fluid at pH 6.5 of the listerial cells stressed in the gastric juice at pH 2.5, 3.0, 3.5, and 4.0, respectively.

f–i

Different superscript letters within a row indicate significant (p < 0.05) differences among different strains.

Descriptive analysis of gene transcription in L. monocytogenes strains exposed to the in vitro gastrointestinal process

From the above survival tests, two strains (O57 and 11137) showing relatively higher degrees of survival under conditions mimicking the gastrointestinal model at pH 3.5 and 4.0 as well as the reference strain EGDe were chosen for further study on the transcription of selected genes. Strain LO28 was excluded because of its lower viability resulting in insufficient total RNA template. The relative transcription levels of the six selected genes (inlA, ami, clpC, clpE, clpP, and prfA) in the three investigated L. monocytogenes strains are illustrated in Table 5, while those of the nonstressed, exponential phase control cells at t = 0 were set to baseline 1.0. Under most conditions, transcription of the regulatory gene prfA and of the stress-related genes clpP, clpC, and clpE was upregulated, with clpE having the most significant elevation with fold change of 1315.94 in gastric juice pH 4.0 in strain EGDe (Table 5). The two exceptions were the transcripts of prfA in strain 11137 after exposure to the intestinal fluid with upper gastric juice pH 4.0 (0.92) and of clpP in strain EGDe after exposure to the gastric stress at pH 3.5 (0.93). Besides, compared to the untreated controls, mRNA transcript levels for prfA, clpP, clpC, and clpE increased as a result of saliva stress and increased further as a result of gastric fluid treatment at pH 4.0, followed by varied levels of decline in the subsequent encounter with the intestinal fluid. In addition, there were statistical differences in genes clpP and clpC between the treatments for strains O57 and EGDe (p < 0.05), while no statistical differences were found in the remaining four genes among the three investigated strains.

Table 5.

Relative Changes in Transcription Levels for Genes Related to Adhesion and Stress Response in L. monocytogenes Strains 11137, O57, and EGDe After Exposure to the In Vitro Gastrointestinal System (Mean ± S.E.M, n = 2)

		Treatment
Gene	Strain	Control	Saliva	Gastric 3.5	Gastric 4.0	Intestine (Ga pH 3.5) ^f	Intestine (Ga pH 4.0) ^g
prfA	11137	1.00	3.24 ± 1.49	2.91 ± 0.46	45.85 ± 40.70	3.09 ± 0.48	0.92 ± 0.25
	O57	1.00	3.42 ± 1.39	3.46 ± 0.94	20.28 ± 13.48	3.47 ± 2.45	2.53 ± 0.62
	EGDe	1.00^c	2.09 ± 0.36^b,c	1.77 ± 0.33^b,c	5.68 ± 0.87^a	ND	3.29 ± 0.39^b
	All strains^h	1.00^b	2.91 ± 0.59^b	2.71 ± 0.42^b	23.93 ± 13.33^a	3.28 ± 1.03^b	2.24 ± 0.48^b
clpP	11137^d	1.00^b	6.67 ± 1.27^b	2.42 ± 0.83^b	62.88 ± 20.92^a	5.45 ± 1.11^b	1.99 ± 0.42^b
	O57^d	1.00^c	6.37 ± 0.06^b	1.76 ± 0.14^c	70.60 ± 0.95^a	6.22 ± 0.13^b	5.65 ± 0.04^b
	EGDe^e	1.00^c	2.31 ± 0.00^a	0.93 ± 0.06^c	2.17 ± 0.02^a	ND	1.98 ± 0.09^b
	All strains^h	1.00^b	5.12 ± 0.95^b	1.70 ± 0.35^b	45.22 ± 14.72^a	5.83 ± 0.51^b	3.20 ± 0.78^b
clpC	11137^d,e	1.00	1.54 ± 0.58	6.59 ± 5.87	10.79 ± 4.07	4.65 ± 2.05	1.20 ± 0.16
	O57^d	1.00	3.51 ± 0.41	3.80 ± 1.95	22.40 ± 0.34	2.23 ± 0.54	3.39 ± 0.39
	EGDe^e	1.00^c	2.91 ± 0.22^b,c	1.81 ± 0.05^b,c	3.32 ± 0.06^b	ND	5.71 ± 1.27^a
	All strains^h	1.00^b	2.65 ± 0.42^b	4.06 ± 1.82^b	12.17 ± 3.67^a	3.44 ± 1.11^b	3.43 ± 0.89^b
clpE	11137	1.00^b	14.81 ± 10.12^b	135.87 ± 115.68^b	674.67 ± 178.23^a	92.31 ± 10.51^b	44.58 ± 17.31^b
	O57	1.00	15.56 ± 9.64	9.14 ± 4.49	793.08 ± 667.82	168.87 ± 157.04	79.99 ± 46.81
	EGDe	1.00	22.29 ± 0.11	11.51 ± 0.11	1315.94 ± 1221.64	ND	179.68 ± 103.54
	All strains^h	1.00^a	17.55 ± 3.91^a	52.17 ± 39.93^a	927.90 ± 383.23^b	130.59 ± 67.95^a	101.41 ± 39.18^a
inlA	11137	1.00	1.06 ± 0.07	0.07 ± 0.03	0.05 ± 0.01	0.07 ± 0.03	2.11 ± 2.02
	O57	ND	ND	ND	ND	ND	ND
	EGDe	1.00	4.16 ± 2.61	1.68 ± 0.39	1.01 ± 0.44	ND	0.45 ± 0.23
	All strains^h	1.00	2.61 ± 1.39	0.88 ± 0.49	0.53 ± 0.33	0.07 ± 0.03	1.28 ± 0.96
ami	11137	1.00^b,c	0.21 ± 0.10^c	0.07 ± 0.01^c	1.52 ± 0.48^b	0.75 ± 0.12^b,c	3.18 ± 0.57^a
	O57	1.00	0.37 ± 0.11	0.39 ± 0.01	1.93 ± 1.35	0.81 ± 0.40	1.19 ± 0.79
	EGDe	1.00	0.43 ± 0.10	1.04 ± 0.77	0.35 ± 0.20	ND	1.04 ± 0.07
	All strains^h	1.00^a,b	0.33 ± 0.06^b	0.50 ± 0.27^b	1.26 ± 0.48^a,b	0.78 ± 0.17^b	1.80 ± 0.50^a

a–c

Different superscript letters within a row indicate significant (p < 0.05) differences among different treatments.

d,e

Different superscript letters within one specific gene indicate significant (p < 0.05) differences among different strains.

Transcription levels in intestinal fluid at pH 6.5 of the listerial cells stressed in the gastric juice at pH 3.5.

Transcription levels in intestinal fluid at pH 6.5 of the listerial cells stressed in the gastric juice at pH 4.0.

The values are means of all strains within one gene.

ND, not determined.

However, in gene inlA, lower transcripts were found in strain 11137 as compared to the nonstressed control cells, excluding similar transcripts both in saliva stress and in gastric juice pH 4.0 and intestinal fluid pH 6.5 combination with fold changes 1.06 and 2.11, respectively. Whilst in strain EGDe, similar or slightly increased fold changes were displayed except in gastric juice pH 4.0 and intestinal fluid pH 6.5 combination with fold change 0.45, as compared to the nonstressed control cells. No statistical difference was gauged after each treatment in the strains 11137 and EGDe.

Alternatively, decreased fold changes were implicated in the transcription levels of ami in the treatments with saliva, gastric juice at pH 3.5, and then the intestinal fluid among the three strains EGDe, 11137, and O57, excluding a similar transcript in strain EGDe after gastric stress at pH 3.5 as compared to the nonstressed control cells (Table 5). When L. monocytogenes passed through the simulated intestinal stage with upper gastric juice at pH 4.0, the transcription levels of ami were slightly increased with strain 11137 displaying statistical difference with fold change 3.18 (p < 0.05), excluding strain O57 with slight decline as compared to the transcript in gastric juice at pH 4.0 (1.93 vs. 1.19).

Discussion

Ingestion of food contaminated with L. monocytogenes is the primary route of transmission of this pathogen to humans (Dussurget, 2008). An empty human stomach could be highly acidic, with documented pH measurements as low as 0.8 during peak HCl secretion and as high as 4.0 with swallowed food (Despopoulos and Silbernagl, 2003). However, in the small intestine, bacteria encounter a mildly acidic niche (pH 4.5–6.5) (Sue et al., 2004). Therefore, the ability to survive and proliferate to high numbers in acidic environments is absolutely critical to the successful transition of this pathogen from the external environment to the host (Ryan et al., 2009).

In the initial viability assay, none of the test strains of L. monocytogens survived well in the gastric juice at pH 2.5 or 3.0 (Table 4), which is consistent with another study showing no survival of L. monocytogenes after 1 h of treatment at pH 3.0 in the defined minimal medium (Phan-Thanh, 1998). These results might present some clues as to the low incidence of listeriosis though L. monocytogenes is overpresented in food products, because most L. monocytogenes strains could not survive well in the environment with lower pH (less than 3.0). Besides, their survival increased at higher pH (3.5 and 4.0) in the gastric juice. L. monocytogenes strains of serotypes 4b (11137, FSL-J1-110) and 1/2a (EGDe, O57) exhibited statistically higher viability than the serotype 1/2c strain (LO28) in the gastric stage at pH 4.0 (p < 0.05) (Table 4), suggesting that pathogenicity might be related to the survival rate in the gastrointestinal tract.

Adaptive gene expression permits intracellular pathogens like L. monocytogenes to successfully persist and disseminate during their encounter with the host defenses in the diverse microenvironments (Chatterjee et al., 2006). During exposure to conditions that could be encountered in the gastrointestinal tract, upregulation of prfA encoding positive regulatory factor A was seen. Transcriptomic analysis identified a total of 73 genes regulated directly or indirectly by PrfA (Dussurget, 2008), including the important virulence genes hly, actA, plcB, mpl, and prfA itself. Our study also agreed with the findings by Chatterjee et al. (2006) and Joseph et al. (2006) that expression of prfA is increased when L. monocytogenes encounters diverse environments.

ClpP, clpC, and clpE, which are members of the CtsR-regulated class III stress genes (Chatterjee et al., 2006), were induced throughout the in vitro gastrointestinal passage (Table 5). Notably, clpE was the most upregulated gene in our data set with the highest fold change of 1315.94 after exposure to the gastric juice pH 4.0 in strain EGDe. Consistent with the current study, clpP, clpC, and clpE were also induced in the phagolysosome of infected P388D1 macrophage cells, with clpE displaying the highest increased transcription level (Chatterjee et al., 2006). Albeit their study was carried out in the phagolysosome, both these models impose stress on L. monocytogenes. Interestingly, in Salmonella entrica serovar Typhimurium, activation of clpP has been validated to be required for growth and survival within macrophages of BALB/c mice (Yamamoto et al., 2001). In addition, clpC and clpP were claimed to be necessary for Porphyromonas gingivalis to enter into host epithelial cells (Capestany et al., 2008). Overall, these results implicate that the Clp protease controls several processes that are important for bacterial survival in unfavorable environments.

Albeit inlA is supposed to be a key determinant in the pathogenesis of human listeriosis (Lecuit et al., 2001, 2004; Lecuit, 2005; Dussurget, 2008; Bonazzi et al., 2009), its transcription levels were not significantly increased during exposure to the conditions representing those encountered in the gastrointestinal tract. In some cases, the transcripts of inlA were even downregulated (Table 5). Lecuit et al. (2007) illustrated that the intestinal gene expression response in transgenic mice expressing the human E-cadherin receptor was similar after infection with ΔinlA mutant and the wild-type strain via GeneChip analysis. Strikingly, the ΔinlA strain could reach the Peyer's patches via M-cells in an inlA-independent way, indicating another significant route for dissemination of L. monocytogenes across the intestinal barrier (Lecuit et al., 2007). The majority of the clinical strains exhibited lower inlA expression levels and subsequently a lower invasion capacity into Caco-2 cells than the nonclinical strains, suggesting that a lower degree of cell invasion would be used by L. monocytogenes strains in vivo as an immune evasion strategy, to prevent the nonspecific immune response from clearing the infection in an early phase (Werbrouck et al., 2006).

Ami is involved in adhesion to host cells and might contribute to colonization of host tissues (Milohanic et al., 2001; Dussurget, 2008). In the current study, the transcription levels of ami declined after passage through the stomach chamber at pH 3.5 and the subsequent intestinal stage. This is consistent with the reduced adherence of L. monocytogenes strains to solid surfaces after exposure to the simulated gastrointestinal system (data not shown). A previous report also showed that ami was present but not expressed in L. monocytogenes serovar 4b strains that cause a majority of sporadic cases of listeriosis (Jacquet et al., 2002). Collectively, these might indicate that ami does not play a critical role in L. monocytogenes during its early infection.

In conclusion, this study for the first time utilizes the in vitro gastrointestinal system to reinforce that pathogenicity of L. monocytogenes might be related to their survival ability in the gastrointestinal tract. It is also suggested that the partial arsenal is used by L. monocytogenes to survive in unfavorable environments by enhancing the expression of stress-related genes, especially clpE, and decreasing the transcription of adhesion-related genes like ami.

Footnotes

Acknowledgments

The research performed has been part of the project FOOD-CT-2005-007081 (PathogenCombat) supported by the European Commission through the Sixth Framework Programme for Research and Development. We thank Youling Gao for statistical analyses and Jianshun Chen for helpful discussions.

Disclosure Statement

No competing financial interests exist.

The first two authors contributed equally to this work.

References

Ben Embarek

, Huss

. Heat resistance of Listeria monocytogenes in vacuum packaged pasteurized fish fillets. Int J Food Microbiol, 1993; 20:85–95.

Bonazzi

, Lecuit

, Cossart

. Listeria monocytogenes internalin and E-cadherin: from structure to pathogenesis. Cell Microbiol, 2009(in press).

Budde

, Jakobsen

. Real-time measurements of the interaction between single cells of Listeria monocytogenes and nisin on a solid surface. Appl Environ Microbiol, 2000; 66:3586–3591.

Capestany

, Tribble

, Maeda

, Demuth

, Lamont

. Role of the clp system in stress tolerance, biofilm formation, and intracellular invasion in Porphyromonas gingivalis. J Bacteriol, 2008; 190:1436–1446.

Chatterjee

, Hossain

, Otten

, Kuenne

, Kuchmina

, Machata

, Domann

, Chakraborty

, Hain

. Intracellular gene expression profile of Listeria monocytogenes. Infect Immun, 2006; 74:1323–1338.

Chen

, Zhang

, Mei

, Jiang

, Fang

. Prevalence of Listeria in Chinese food products from 13 provinces between 2000 and 2007 and virulence characterization of Listeria monocytogenes isolates. Foodborne Pathog Dis, 2009; 6:7–14.

Cossart

. Listeriology (1926–2007): the rise of a model pathogen. Microbes Infect, 2007; 9:1143–1146.

Despopoulos

, Silbernagl

. Color Atlas of Physiology, 5^th edition, completely revised and expanded. New York: Thieme, 2003.

Dussurget

. New insights into determinants of Listeria monocytogenes virulence. Int Rev Cell Mol Biol, 2008; 270:1–38.

10.

Farber

, Losos

. Listeria monocytogenes: a foodborne pathogen. CMAJ, 1988; 138:413–418.

11.

Glaser

, Frangeul

, Buchrieser

, Rusniok

, Amend

, Baquero

, Berche

, Bloecker

, Brandt

, Chakraborty

, Charbit

, Chetouani

, Couvé

, de Daruvar

, Dehoux

, Domann

, Domínguez-Bernal

, Duchaud

, Durant

, Dussurget

, Entian

, Fsihi

, García-del Portillo

, Garrido

, Gautier

, Goebel

, Gómez-López

, Hain

, Hauf

, Jackson

, Jones

, Kaerst

, Kreft

, Kuhn

, Kunst

, Kurapkat

, Madueno

, Maitournam

, Vicente

, Ng

, Nedjari

, Nordsiek

, Novella

, de Pablos

, Pérez-Diaz

, Purcell

, Remmel

, Rose

, Schlueter

, Simoes

, Tierrez

, Vázquez-Boland

, Voss

, Wehland

, Cossart

. Comparative genomics of Listeria species. Science, 2001; 294:849–852.

12.

Goulet

, Hedberg

, Le Monnier

, de Valk

. Increasing incidence of listeriosis in France and other European countries. Emerg Infect Dis, 2008; 14:734–740.

13.

Hain

, Chatterjee

, Ghai

, Kuenne

, Billion

, Steinweg

, Domann

, Kärst

, Jänsch

, Wehland

, Eisenreich

, Bacher

, Joseph

, Schär

, Kreft

, Klumpp

, Loessner

, Dorscht

, Neuhaus

, Fuchs

, Scherer

, Doumith

, Jacquet

, Martin

, Cossart

, Rusniock

, Glaser

, Buchrieser

, Goebel

, Chakraborty

. Pathogenomics of Listeria spp. Int J Med Microbiol, 2007; 297:541–557.

14.

Jacquet

, Gouin

, Jeannel

, Cossart

, Rocourt

. Expression of actA, ami, inlB, and listeriolysin O in Listeria monocytogenes of human and food origin. Appl Environ Microbiol, 2002; 68:616–622.

15.

Jiang

, Chen

, Xu

, Zhang

, Wang

, Zhao

, Vongxay

, Fang

. Virulence characterization and genotypic analyses of Listeria monocytogenes isolates from food and processing environments in eastern China. Int J Food Microbiol, 2008; 121:53–59.

16.

Jiang

, Xu

, Chen

, Shuai

, Fang

. Virulence phenotyping and molecular characterization of a low-pathogenicity isolate of Listeria monocytogenes from cow's milk. Acta Biochim Biophys Sin (Shanghai), 2006; 38:262–270.

17.

Joseph

, Przybilla

, Stühler

, Schauer

, Slaghuis

, Fuchs

, Goebel

. Identification of Listeria monocytogenes genes contributing to intracellular replication by expression profiling and mutant screening. J Bacteriol, 2006; 188:556–568.

18.

Lecuit

. Understanding how Listeria monocytogenes targets and crosses host barriers. Clin Microbiol Infect, 2005; 11:430–436.

19.

Lecuit

, Nelson

, Smith

, Khun

, Huerre

, Vacher-Lavenu

, Gordon

, Cossart

. Targeting and crossing of the human maternofetal barrier by Listeria monocytogenes: role of internalin interaction with trophoblast E-cadherin. Proc Natl Acad Sci USA, 2004; 101:6152–6157.

20.

Lecuit

, Sonnenburg

, Cossart

, Gordon

. Functional genomic studies of the intestinal response to a foodborne enteropathogen in a humanized gnotobiotic mouse model. J Biol Chem, 2007; 282:15065–15072.

21.

Lecuit

, Vandormael-Pournin

, Lefort

, Huerre

, Gounon

, Dupuy

, Babinet

, Cossart

. A transgenic model for listeriosis: role of internalin in crossing the intestinal barrier. Science, 2001; 292:1722–1725.

22.

Liu

, Ainsworth

, Austin

, Lawrence

. Characterization of virulent and avirulent Listeria monocytogenes strains by PCR amplification of putative transcriptional regulator and internalin genes. J Med Microbiol, 2003; 52:1065–1070.

23.

Milohanic

, Glaser

, Coppée

, Frangeul

, Vega

, Vázquez-Boland

, Kunst

, Cossart

, Buchrieser

. Transcriptome analysis of Listeria monocytogenes identifies three groups of genes differently regulated by PrfA. Mol Microbiol, 2003; 47:1613–1625.

24.

Milohanic

, Jonquières

, Cossart

, Berche

, Gaillard

. The autolysin ami contributes to the adhesion of Listeria monocytogenes to eukaryotic cells via its cell wall anchor. Mol Microbiol, 2001; 39:1212–1224.

25.

Olesen

, Vogensen

, Jespersen

. Gene transcription and virulence potential of Listeria monocytogenes strains after exposure to acidic and NaCl stress. Foodborne Pathog Dis, 2009; 6:669–680.

26.

Olier

, Pierre

, Lemaître

, Divies

, Rousset

, Guzzo

. Assessment of the pathogenic potential of two Listeria monocytogenes human faecal carriage isolates. Microbiology, 2002; 148:1855–1862.

27.

Oomen

, Rompelberg

, Bruil

, Dobbe

, Pereboom

, Sips

. Development of an in vitro digestion model for estimating the bioaccessibility of soil contaminants. Arch Environ Contam Toxicol, 2003; 44:281–287.

28.

Palumbo

, Borucki

, Mandrell

, Gorski

. Serotyping of Listeria monocytogenes by enzyme-linked immunosorbent assay and identification of mixed-serotype cultures by colony immunoblotting. J Clin Microbiol, 2003; 41:564–571.

29.

Pfaffl

. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res, 2001; 29:e45.

30.

Phan-Thanh

. Physiological and biochemical aspects of the acid survival of Listeria monocytogenes. J Gen Appl Microbiol, 1998; 44:183–191.

31.

Ragon

, Wirth

, Hollandt

, Lavenir

, Lecuit

, Le Monnier

, Brisse

. A new perspective on Listeria monocytogenes evolution. PLoS Pathog, 2008; 4:e1000146.

32.

Roche

, Kerouanton

, Minet

, Le Monnier

, Brisabois

, Velge

. Prevalence of low-virulence Listeria monocytogenes strains from different foods and environments. Int J Food Microbiol, 2009; 130:151–155.

33.

Roldgaard

, Andersen

, Hansen

, Christensen

, Licht

. Comparison of three Listeria monocytogenes strains in a guinea-pig model simulating food-borne exposure. FEMS Microbiol Lett, 2009; 291:88–94.

34.

Ryan

, Begley

, Gahan

, Hill

. Molecular characterization of the arginine deiminase system in Listeria monocytogenes: regulation and role in acid tolerance. Environ Microbiol, 2009; 11:432–445.

35.

SAS. SAS/STAT User's Guide, version 8. Cary, NC: SAS, 1999.

36.

Schwab

, Bowen

, Nadon

, Wiedmann

, Boor

. The Listeria monocytogenes prfAP2 promoter is regulated by sigma B in a growth phase dependent manner. FEMS Microbiol Lett, 2005; 245:329–336.

37.

Sue

, Fink

, Wiedmann

, Boor

. Sigma B-dependent gene induction and expression in Listeria monocytogenes during osmotic and acid stress conditions simulating the intestinal environment. Microbiology, 2004; 150:3843–3855.

38.

Swaminathan

, Gerner-Smidt

. The epidemiology of human listeriosis. Microbes Infect, 2007; 9:1236–1243.

39.

Vázquez-Boland

, Kuhn

, Berche

, Chakraborty

, Domínguez-Bernal

, Goebel

, González-Zorn

, Wehland

, Kreft

. Listeria pathogenesis and molecular virulence determinants. Clin Microbiol Rev, 2001; 14:584–640.

40.

Versantvoort

, Oomen

, Van de Kamp

, Rompelberg

, Sips

. Applicability of an in vitro digestion model in assessing the bioaccessibility of mycotoxins from food. Food Chem Toxicol, 2005; 43:31–40.

41.

Vicente

, Baquero

, Pérez-Díaz

. Cloning and expression of the Listeria monocytogenes haemolysin in Escherichia coli. FEMS Microbiol Lett, 1985; 30:77–79.

42.

Watson

. Listeriosis remains a cause for concern in Europe. BMJ, 2009; 338:b319.

43.

Werbrouck

, Grijspeerdt

, Botteldoorn

, Van Pamel

, Rijpens

, Van Damme

, Uyttendaele

, Herman

, Van Coillie

. Differential inlA and inlB expression and interaction with human intestinal and liver cells by Listeria monocytogenes strains of different origins. Appl Environ Microbiol, 2006; 72:3862–3871.

44.

Yamamoto

, Sashinami

, Takaya

, Tomoyasu

, Matsui

, Kikuchi

, Hanawa

, Kamiya

, Nakane

. Disruption of the genes for ClpXP protease in Salmonella enterica serovar Typhimurium results in persistent infection in mice, and development of persistence requires endogenous gamma interferon and tumor necrosis factor alpha. Infect Immun, 2001; 69:3164–3174.

45.

Zhang

, Yeh

, Hall

, Cripe

, Bhagwat

, Meng

. Characterization of Listeria monocytogenes isolated from retail foods. Int J Food Microbiol, 2007; 113:47–53.

Survival of Listeria monocytogenes in Simulated Gastrointestinal System and Transcriptional Profiling of Stress- and Adhesion-Related Genes

Abstract

Introduction

Materials and Methods

Bacterial strains and growth conditions

Serogroup identification

Lineage classification

In vitro gastrointestinal system

TaqMan® quantitative real-time (qRT) PCR

Statistical analysis

GenBank accession numbers

Results

Serotyping using PCR and lineages analysis based on partial actA sequence

Survival of L. monocytogenes strains in the in vitro gastrointestinal tract

Descriptive analysis of gene transcription in L. monocytogenes strains exposed to the in vitro gastrointestinal process

Discussion

Footnotes

Acknowledgments

Disclosure Statement

References

TaqMan^® quantitative real-time (qRT) PCR