Antibiotic Resistance in Escherichia coli Isolated from Retail Raw Chicken Meat in Taif,Saudi Arabia

Abstract

The present study was carried out to screen and analyze the genetic characteristics of antibiotic resistance in Escherichia coli strains isolated from chicken meat marketed in the local markets of the Taif region in Saudi Arabia. A total of 119 samples were purchased from various supermarkets and examined for bacterial contamination with resistant E. coli. Thirty-seven E. coli isolates were evaluated for their antibiotic susceptibilities and the presence of class 1 integrons and antibiotic resistance genes. Results of antibiograms revealed that E. coli isolates were resistant to one or more of the antibiotics tested. Resistance was most frequently observed against sulphafurazole (89.2%), ampicillin (78.4%), nalidixic acid (70.3%), streptomycin (48.6%), chloramphenicol (32.4%), and gentamicin (24.3%). Fifteen E. coli strains have multidrug resistance phenotypes and harbored at least three antibiotic resistance genes. The bla _TEM (β-lactamase) and sul (sulfonamide) resistance encoding genes were detected in all the tested isolates. Polymerase chain reaction screening detected class 1 integrons in all multiresistant E. coli isolates. The present study provides an assessment of the occurrence of multidrug resistance of E. coli from raw chicken meat collected from local markets.

Introduction

A ntibiotics are used for therapeutic and prophylactic purposes in animals and humans, and some have also been used as growth promoters to improve animal production. Antibiotics with similar structure are being used in medical and veterinary practices. Chicken being raised for meat must be housed with room for a maximum of 10 birds per square meter. A flock must not contain more than 1000 birds. As per Soil Association organic rules, the number of birds in each poultry house must not be more than 1000 for chickens reared for meat. But intensively reared broiler chickens are normally housed in groups of up to 40,000 in large sheds. In such intensively reared animals, antibiotics may be administered through feed or drinking water to whole flocks rather than to individual animals. Therefore, the antibiotic selection pressure for resistance in bacteria in poultry is responsible for high proportion of resistant bacteria (Smith, 1974; Aronson, 1975; Linton, 1977; Allan et al., 1993a, 1993b; Van den Bogaard and Stobberingh, 2000; Van et al., 2008).

Foods contaminated with antibiotic-resistant bacteria could be a major threat to public health via the transmission of antibiotic resistance determinants to other bacteria of human clinical significance. Escherichia coli is a candidate vehicle for such transfers because of its diversity and also because it survives as common flora in the gastrointestinal tracts of both humans and animals. E. coli are sensitive to selection pressure exerted by antibiotic usage and carry genetic mobile elements to achieve the transmission of antibiotic resistance determinants to other bacteria (Van den Bogaard and Stobberingh, 2000; Zhao et al., 2001b). Although the carriage of antibiotic resistance genes is not confined to commensal E. coli in the face of antibiotic selection, the capacity to threaten human consumers was significantly enhanced if foodborne strains carried virulence genes that qualified them as potential human pathogens (Orskov and Orskov, 1992; Schroeder et al., 2004).

In Saudi Arabia, poultry meat comprises a substantial portion of the Saudi diet. Prior studies have focused on the occurrence of microbial pathogens in poultry meat, but not on the presence of antibiotic resistance within the bacteria (Al-Dughaym et al., 2003). Moreover, antimicrobial agents are widely used in the poultry industry. Al-Ghamdi et al. (1999) showed that 28 antimicrobial agents were available for poultry use in the Eastern Province of Saudi Arabia. They are mainly added, often concomitantly, to drinking water for infection prophylaxis.

The present work examined the contamination of raw chicken meat with antibiotic-resistant E. coli and characterized antibiotic resistance markers in isolated strains.

Materials and Methods

Collecting samples

A total of 119 chilled raw chicken samples (whole eviscerated carcasses) were collected in the city of Taif, western region of Saudi Arabia. The samples were collected from 20 supermarkets, with chicken from different industrialized slaughterhouses. At least five samples were collected from each supermarket. The sampling period was from February to May 2009 when temperatures varied from 17°C to 26°C and relative humidity between 36% and 52%. All samples were sent to the laboratory in sterile bags on ice and processed the same day.

Sample processing and isolation of E. coli

E. coli from whole meats were isolated as previously described (Zhao et al., 2001c). Briefly, 25-g portions (breast and thigh muscles) of each sample were taken aseptically by scalpel excision, placed into a separate stomacher bag with 225 mL of sterile peptone water (Difco, Detroit, MI), and homogenized at 230 rpm for 2 min. From the homogenate, 100 μL aliquots were plated onto MacConkey's agar (Difco) and incubated for 24 h at 37°C. Three to five lactose-fermenting colonies from separate regions of multiple plates were subcultured onto eosin–methylene blue agar (Difco). Only one E. coli isolate was selected from each food sample. Colonies that showed a dark blue color with characteristic metallic sheen were selected from each of the agar plates and identified as E. coli by API 20E commercial strips (Biomerieux, Paris, France).

Antibiotic susceptibility testing

Antibiotic susceptibility of all E. coli strains was determined against eight antimicrobial agents by the disc diffusion method according to Bauer et al. (1966). The bacterial suspensions were adjusted in sterile 0.9% saline to 0.5 McFarland standard (10⁸ cfu/mL) and spread on Mueller-Hinton agar (Difco). The criterion for the antibiotic chosen was based on their use in both food animals and human therapy. The antibiotics studied were ampicillin (25 μg), chloramphenicol (50 μg), kanamycin (30 μg), nalidixic acid (30 μg), streptomycin (25 μg), gentamicin (10 μg), sulphafurazole (300 μg), and cephalothin (5 μg) (MASTRING-S; Mast Diagnostics, United Kingdom, and Hi-Media, Mumbai, India). After incubation for 24 h at 37°C, the organisms were classified as sensitive or resistant according to the inhibition zone diameter (NCCLS, 2004).

DNA preparation and polymerase chain reaction

An overnight bacterial culture (200 μL) was mixed with 800 μL of sterilized distilled water and boiled for 10 min (100°C). The resulting solution was centrifuged and the supernatant was used as the DNA template. Fifteen multiresistant isolates were screened for class 1 integrons and associated resistance genes by polymerase chain reaction (PCR) using primers as previously described (Zhao et al., 2001a; Van et al., 2008). Four antibiotic resistance genes were targeted to detect aadA, bla _TEM, cmlA, and sul genes (Table 1). PCR amplification was conducted with initial denaturation at 95°C for 5 min, followed by 30 cycles of denaturation at 94°C for 30 sec, annealing at 58°C for 30 sec, and extension at 72°C for 1 min. Final extension at 72°C for 10 min was applied. After PCRs, the reaction products were subjected to electrophoresis in a 1.0% agarose gel, stained with ethidium bromide, and visualized under ultraviolet light.

Table 1.

Summary of Primer Sets Used for the Amplification of the Class 1 Integron and Associated Resistance Genes

Gene name	Target genes	Primers	DNA sequence (5′→3′)	Amplified product (bp)	Primer concentration	Reference
intI	Class 1 Integron	CS1	GGCATCCAAGCACAAGC	1000–2000	50 pmol	Zhao et al. (2001a)
		CS2	AAGCAGACTTGACTGAT
int	Integrase	int-F	CCTCCCGCACGATGATC	250	50 pmol	Zhao et al. (2001a)
		int-R	TCCACGCATCGTCAGGC
sul	Sulfonamide	Sull-F	TTCGGCATTCTGAATCTCAC	822	0.56 μM	Van et al. (2008)
		Sull-R	ATGATCTAACCCTCGGTCTC
aadA	Aminoglycoside	aadA-F	TGATTTGCTGGTTACGGTGAC	284	0.28 μM	Van et al. (2008)
		aadA-R	CGCTATGTTCTCTTGCTTTTG
bla _TEM	β-Lactam	blaTEM-F	GAGTATTCAACATTTTCGT	857	0.56 μM	Van et al. (2008)
		blaTEM-R	ACCAATGCTTAATCAGTGA
cmlA	Chloramphenicol	cmlA-F	CCGCCACGGTGTTGTTGTTATC	698	0.28 μM	Van et al. (2008)
		cmlA-R	CACCTTGCCTGCCCATCATTAG

Results

From 119 chilled raw chicken meat samples collected in the city of Taif, 37 samples (31.1%) showed contamination with E. coli. One strain from each positive sample was used for further analysis.

Of the 37 E. coli isolates, 32 (86.5%) of those were resistant to at least one antibiotic, whereas 40.5% of the isolates were resistant to at least three antibiotics (Table 2). Overall resistance was most frequently observed to sulphafurazole (89.2%), ampicillin (78.4%), nalidixic acid (70.3%), streptomycin (48.6%), chloramphenicol (32.4%), and gentamicin (24.3%) (Table 2).

Table 2.

Antibiotic Resistance in Escherichia coli Isolated from Raw Chicken Meat

Antibiotics	No. of samples (n = 37)	Resistance (%)
SUL	33	89.2
AMP	29	78.4
NAL	26	70.3
STR	18	48.6
CHL	12	32.4
GM	9	24.3
CEF	5	13.5
KAN	2	5.4
Resistance to ≥1 antibiotic	32	86.5
Multiresistance^a	15	40.5

Resistance to at least three different antibiotics.

SUL, sulphafurazole; AMP, ampicillin; NAL, nalidixic acid; STR, streptomycin; CHL, chloramphenicol; GM, gentamicin; CEF, cephalothin; KAN, kanamycin.

Fifteen E. coli isolates showed resistance to at least three different antibiotics and were chosen for molecular analysis (integrons and antibiotic resistance genes). Class 1 integrons were detected in all the tested isolates (Table 3). The antibiotic resistance phenotype results (Table 2) correlated with their genotypes. One strain carried more than one gene encoding the same resistance. Four isolates (TUE2, TUE4, TUE19, and TUE20) had four resistance genes (bla _TEM, cmlA, aadA, and sul). All the tested isolates contained β-lactam gene (bla _TEM) and sulfonamide gene (sul). Twelve isolates carried aadA gene, whereas six isolates had cmlA gene.

Table 3.

Characterization of Antimicrobial Resistance Genes in Escherichia coli Strains Isolated from Retail Chicken Meat

Strain name	Resistance phenotypes	Resistance genes	Class 1 integrons
TUE 2	AMP, CHL, GM, NAL, STR, SUL	TEM, cmlA, aadA, sul	+
TUE 3	AMP, CEF, GM, NAL, STR, SUL	TEM, aadA, sul	+
TUE 4	AMP, CHL, NAL, STR, SUL	TEM, cmlA, aadA, sul	+
TUE 6	AMP, STR, SUL	TEM, aadA, sul	+
TUE 8	AMP, CHL, SUL	TEM, cmlA, sul	+
TUE 12	AMP, GM, NAL, SUL	TEM, aadA, sul	+
TUE 16	AMP, NAL, SUL	TEM, aadA, sul	+
TUE 19	AMP, CHL, GM, NAL, STR	TEM, cmlA, aadA	+
TUE 20	AMP, CHL, STR, SUL	TEM, cmlA, aadA, sul	+
TUE 22	AMP, CEF, SUL	TEM, aadA, sul	+
TUE 23	AMP, NAL, SUL	TEM, aadA, sul	+
TUE 25	AMP, CEF, CHL, SUL	TEM, cmlA, sul	+
TUE 28	AMP, KAN, NAL, STR, SUL	TEM, aadA, sul	+
TUE 31	CHL, STR, SUL	TEM, cmlA, sul	+
TUE 36	AMP, NAL, STR, SUL	TEM, aadA, sul	+

Discussion

Antibiotic resistance in E. coli isolates

Throughout the world, microbiologists are encouraged to survey the antibiotic resistances of major pathogens to provide the people in charge of public health with epidemiological data helpful in making recommendations on the best use of antibiotics (Leflon-Guibout et al., 2000). Van et al. (2007) reported a similar rate of resistance of E. coli from meat samples. Several studies have shown that the occurrence of resistance is closely related to the medical use of a drug, even though the association may be variable (Mouton et al., 1990; Baquero et al., 1991; Miranda et al., 2008). This association has also been demonstrated for antimicrobial agents used for growth promotion (Bager et al., 1997; Aarestrup and Carstensen, 1998; Aarestrup et al., 2000). At slaughter, resistant strains from the gut readily contaminate poultry carcasses, and as a result, poultry meats are often contaminated with resistant E. coli (Linton et al., 1977; Caudry and Stanisich, 1979; Nazer, 1980; Bensink and Botham, 1983; Chaslus Dancla and Lafont, 1985; Jayaratne et al., 1990; Turtura et al., 1990; Van den Bogaard et al., 2001; Vaidya et al., 2005; Akond et al., 2009; Altekruse et al., 2009). The high frequency of antibiotic resistance obtained in the present work is in agreement with that stated by Van et al. (2007, 2008). A high prevalence of multidrug resistance among generic E. coli has been previously reported in chicken in different countries (Kolar et al., 2001; Schroeder et al., 2003).

In Saudi Arabia, resistance to antibiotics in chilled chicken was studied. Other authors identified antibiotic-resistant enteric bacteria from chicken feces, live chickens within a poultry house, and contact workers (Bazile-Pham-Khac et al., 1996; Al-Ghamdi et al., 1999, 2001). Al-Ghamdi et al. (1999) reported antibiotic resistance in the E. coli isolates, from chicken feces and contact workers, to tetracycline (99.1%), spectinomycin (95.7%), trimethoprim–sulfamethoxazol (92.2%), gentamicin (89.7%), ampicillin (88.7%), and chloramphenicol (57.0%). Further, Bazile-Pham-Khac et al. (1996) studied the E. coli isolates from poultry for quinolone resistance. In our study, a similar antibiotic resistance was reported to ampicillin, chloramphenicol, nalidixic acid, and sulfonamide.

In the present study, resistance to other antibiotics including cephalothin and streptomycin were also found. Possible sources could be the contamination of meat during their manipulation after the slaughtering process and/or the different antimicrobials used as therapy in live birds.

Resistance integrons and genes in E. coli isolates

Class 1 integrons are mobile elements known for the efficient spread of antibiotic resistance genes due to mobilization capabilities of gene cassettes (Recchia and Hall, 1995; Tosini et al., 1998; Goldstein et al., 2001). Class 1 integrons were detected in all the 15 E. coli strains that showed multiple antibiotic resistance. Integrons are associated with multiple antimicrobial resistance in the isolates taken from on-farm poultry (Bass et al., 1999). It was reported that class 1 integrons were found in 63% of multiple antimicrobial-resistant E. coli of poultry origin.

Our findings are similar to previous findings in other countries showing that E. coli strains from food animal origins had β-lactam genes (Brinas et al., 2002; Guerra et al., 2003; Van et al., 2008). El-Enbaawy and Yousif (2006) reported β-lactam genes in multidrug-resistant clinical bacterial isolates from Egyptian food animal species.

The results presented indicate that enteric bacteria in Saudi raw chicken meat samples contain antibiotic resistance genes. In the light of recent epidemiological findings, it was found that urinary tract infections in humans may be associated with poultry consumption (Manges et al., 2007). These findings support the need for more rigorous surveillance and improved farming practices that can reduce the carriage of antibiotic resistance genes and thereby minimize the likelihood of horizontal gene transfers of these antimicrobial resistance genes to other microbes in the food chain. Further study is required on the role of chicken-borne bacteria as vectors in transmitting drug resistance. Attention needs to be paid to personnel hygiene in processing and handling of raw chicken and chicken products and to these likely sources of resistant bacteria in Saudi Arabia. This investigation provides a profile of antibiotic resistance and markers in E. coli isolated from raw chicken meat commonly sold at the marketplace in the city of Taif, Saudi Arabia.

Footnotes

Disclosure Statement

No competing financial interests exist.

References

Aarestrup

, Bager

, Andersen

. The association between the use of avilamycin for growth promotion and the occurrence of resistance among Enterococcus faecium. Microb Drug Resist, 2000; 6:71–76.

Aarestrup

, Carstensen

. Effect of tylosin used as a growth promoter on the occurrence of macrolide resistant enterococci and staphylococci in pigs. Microb Drug Resist, 1998; 4:307–312.

Akond

, Hassan

SMR

, Alam

et al. Antibiotic resistance of Escherichia coli isolated from poultry and poultry environment of Bangladesh. Am J Environ Sci, 2009; 5:47–52.

AL-Dughaym

, Altabari

, Hamdy

. Safety and quality of chicken meat products, 2003. http://www.kfu.edu.sa/ar/Deans/Research/Documents/3003.pdf(Online.)

Al-Ghamdi

, El-Morsy

, Al-Mustafa

et al. Antibiotic resistance of Escherichia coli isolated from poultry workers, patients and chicken in the eastern province of Saudi Arabia. Trop Med Int Health, 1999; 4:278–283.

Al-Ghamdi

, El-Morsy

, Al-Mustafa

et al. Bacterial organisms isolated from healthy chicken in the east province of Saudi Arabia and their pattern of resistance to antimicrobial agents. Sci J King Faisal Univ (Basic Appl Sci), 2001; 2:113–127.

Allan

, Van-den-Hurk

, Potter

. Characterization of Escherichia coli isolated from cases of avian colibacillosis. Can J Vet Res, 1993a. 57:146–151.

Allan

, Pringle

, Smith

, Conlon

et al. Handbook of Veterinary Drugs. Philadelphia: Lippincott, 1993b. 257–258.

Altekruse

, Berrang

, Marks

et al. Enumeration of Escherichia coli cells on chicken carcasses as a potential measure of microbial process control in a random selection of slaughter establishments in the United States. Appl Environ Microb, 2009; 75:3522–3527.

10.

Aronson

. Potential impact of the use of antimicrobial drugs in farm animals on public health. Presented at the meeting on Pharmacology in the Animal Health Sector. Colorado State University: Fort Collins, CO, September 23–24, 1975.

11.

Bager

, Madsen

, Christensen

et al. Avoparcin used as a growth promoter is associated with the occurrence of vancomycin resistant Enterococcus faecium on Danish poultry and pig farms. Prev Vet Med, 1997; 31:95–112.

12.

Baquero

, Martinez-Beltran

, Loza

. A review of antibiotic resistance patterns of Streptococcus pneumoniae in Europe. J Antimicrob Chemother, 1991; 28,Suppl C:31–83.

13.

Bass

, Liebert

, Lee

et al. Incidence and characterization of integrons, genetic elements mediating multiple drug resistance, in avian Escherichia coli. Antimicrob Agents Chemother, 1999; 43:2925–2929.

14.

Bauer

, Kirby

WMM

, Sherris

et al. Antibiotic susceptibility testing by a standardized single disk method. Am J Clin Pathol, 1966; 45:493–496.

15.

Bazile-Pham-Khac

, Truong

, Lafont

et al. Resistance to fluoroquinolones in Escherichia coli isolated from poultry. Antimicrob Agents Chemother, 1996; 40:1504–1507.

16.

Bensink

, Botham

. Antibiotic resistant coliform bacilli, isolated from freshly slaughtered poultry and from chilled poultry at retail outlets. Aust Vet J, 1983; 60:80–83.

17.

Brinas

, Zarazaga

, Saenz

et al. β-lactamases in ampicillin-resistant Escherichia coli isolates from foods, humans, and healthy animals. Antimicrob Agents Chemother, 2002; 46:3156–3163.

18.

Caudry

, Stanisich

. Incidence of antibiotic resistant Escherichia coli associated with frozen chicken carcasses and characterization of conjugative R-plasmids derived from such strains. Antimicrob Agents Chemother, 1979; 16:701–709.

19.

Chaslus

Dancla E

, Lafont

. IncH plasmids in Escherichia coli strains isolated from broiler chicken carcasses. Appl Environ Microbiol, 1985; 49:1016–1018.

20.

El-Enbaawy

, Yousif

. β-Lactamase gene in multi-drug resistant clinical bacterial isolates from Egyptian food animal species. Arab J Biotechnol, 2006; 9:71–82.

21.

Goldstein

, Lee

, Sanchez

et al. Incidence of class 1 and 2 integrases in clinical and commensal bacteria from livestock, companion animals, and exotics. Antimicrob Agents Chemother, 2001; 45:723–726.

22.

Guerra

, Junker

, Malorny

et al. Phenotypic and genotypic characterization of antimicrobial resistance in German Escherichia coli isolates from cattle, swine and poultry. J Antimicrob Chemother, 2003; 52:489–492.

23.

Jayaratne

, Collins-Thompson

, Trevors

. Occurrence of aminoglycoside phosphotransferase subclass I and II structural genes among Enterobacteriaceae spp. isolated from meat samples. Appl Microbiol Biotechnol, 1990; 33:547–552.

24.

Kolar

, Pantucek

, Bardon

et al. Occurrence of antibiotic-resistant bacterial strains isolated in poultry. Vet Med Czech, 2001; 47:52–59.

25.

Leflon-Guibout

, Speldooren

, Heym

et al. Epidemiological survey of amoxicillin–clavulanate resistance and corresponding molecular mechanisms in Escherichia coli isolates in France. New genetic features of blaTEM genes. Antimicrob Agents Chemother, 2000; 44:2709–2714.

26.

Linton

. Antibiotics, animals and man. An appraisal of a continuous subject. Antibiotics and Antibiosis in Agriculture. Woobine

. London: Butterworths, 1977; 315–343.

27.

Linton

, Howe

, Hartley

et al. Antibiotic resistance among Escherichia coli O-serotypes from the gut and carcasses of commercially slaughtered broiler chickens: a potential public health hazard. J Appl Bacteriol, 1977; 42:365–378.

28.

Manges

, Smith

, Lau

et al. Retail meat consumption and the acquisition of antimicrobial resistant Escherichia coli causing urinary tract Infections: a case–control study. Foodborne Pathog Dis, 2007; 4:419–431.

29.

Miranda

, Vázquez

, Fente

et al. Evolution of resistance in poultry intestinal Escherichia coli during three commonly used antimicrobial therapeutic treatments in poultry. Poult Sci, 2008; 87:1643–1648.

30.

Mouton

, Hermans

, Simoons-Smit

et al. Correlations between consumption of antibiotics and methicillin resistance in coagulase-negative staphylococci. J Antimicrob Chemother, 1990; 26:573–583.

31.

Nazer

. Transmissible drug resistance in Escherichia coli isolated from poultry and their carcasses in Iran. Cornell Vet, 1980; 70:365–371.

32.

[NCCLS] National Committee for Clinical Laboratory Standards. Performance standards for antimicrobial disk and dilution susceptibility tests for bacteria isolated from animals. Approved standard (M31-A2) Wayne, PA: NCCLS, 2004.

33.

Orskov

, Orskov

. Escherichia coli serotyping and disease in man and animals. Can J Microbiol, 1992; 38:699–704.

34.

Recchia

, Hall

. Gene cassettes: a new class of mobile element. Microbiology, 1995; 141:3015–3027.

35.

Schroeder

, White

, Ge

et al. Isolation of antimicrobial-resistant Escherichia coli from retail meats purchased in Greater Washington, DC, USA. Int J Food Microbiol, 2003; 85:197–202.

36.

Schroeder

, White

, Meng

. Retail meat and poultry as a reservoir of antimicrobial-resistant Escherichia coli. Food Microbiol, 2004; 21:249–255.

37.

Smith

. Veterinary and food aspects of drug resistance. J Sci Food Agric, 1974; 25:227–237.

38.

Tosini

, Visca

, Luzzi

et al. Class 1 integron-borne multiple-antibiotic resistance carried by IncFI and IncL/M plasmids in Salmonella enterica serotype Typhimurium. Antimicrob Agents Chemother, 1998; 42:3053–3058.

39.

Turtura

, Massa

, Chazvinizadeh

. Antibiotic resistance among coliform bacteria isolated from carcasses of commercially slaughtered chickens. Int J Food Microbiol, 1990; 11:351–354.

40.

Vaidya

, Paturkar

, Waskar

et al. Detection of indicator organisms on poultry carcass sites in an organized slaughterhouse. J Muscle Food, 2005; 16:289–297.

41.

Van

TTH

, Chin

, Chapman

et al. Safety of raw meat and shellfish in Vietnam: an analysis of Escherichia coli isolations for antibiotic resistance and virulence genes. Int J Food Microbiol, 2008; 124:217–223.

42.

Van

TTH

, Moutafis

, Tran

et al. Antibiotic resistance in food-borne bacterial contaminants in Vietnam. Appl Environ Microbiol, 2007; 73:7906–7911.

43.

Van den Bogaard

, Stobberingh

. Epidemiology of resistance to antibiotics. Links between animals and humans. Int J Antimicrob Agents, 2000; 14:327–335.

44.

Van den Bogaard

, London

, Driessen

et al. Antibiotic resistance of faecal Escherichia coli in poultry, poultry farmers and poultry slaughterers. J Antimicrob Chemother, 2001; 47:763–771.

45.

Zhao

, Ge

, De

Villena J

et al. Prevalence of Campylobacter spp., Escherichia coli, and Salmonella serovars in retail chicken, turkey, pork, and beef from the Greater Washington, D.C. area. Appl Environ Microbiol, 2001c. 67:5431–5436.

46.

Zhao

, White

, Beilei

et al. Identification and characterization of integron-mediated antibiotic resistance among Shiga toxin-producing Escherichia coli isolates. Appl Environ Microbiol, 2001a. 67:1558–1564.

47.

Zhao

, White

, McDermott

et al. Identification and expression of cephamycinase bla CMY genes in Escherichia coli and Salmonella isolates from food animals and ground meat. Antimicrob Agents Chemother, 2001b. 45:3647–3650.