Application of Real-Time Polymerase Chain Reaction in Detection of Entamoeba histolytica in Pus Aspirates of Liver Abscess Patients

Abstract

Entamoeba histolytica is the second major cause of liver abscess disease in humans, particularly in developing countries. Recently, DNA molecular-based methods have been employed to enhance the detection of E. histolytica in either pus or stool specimens. In this study, the results of real-time polymerase chain reaction (PCR) to detect E. histolytica DNA in pus from liver abscess cases were compared with those of indirect hemagglutination assay on the corresponding serum samples. Bacterial cultures were also performed on the pus samples for the diagnosis of pyogenic liver abscess. The real-time PCR detected E. histolytica DNA in 23 of 30 (76.7%) pus samples, when compared with 14 of 30 (46.7%) serum samples in which anti-Entamoeba antibodies were detected by indirect hemagglutination assay and 4 of 30 (13.3%) pus samples that showed bacterial infection by culture. The use of real-time PCR is a promising detection method for diagnosis and epidemiology assessment of amoebic liver abscess.

Introduction

A moebic liver abscess (ALA) is caused by Entamoeba histolytica. It is believed that the disease in human is initiated by hematogenous spread of trophozoites from the colon, which reach the liver by the portal vein and finally develop into an abscess, commonly in the right hepatic lobe (Rustgi and Richter, 1989; WHO, 1997). Amoebiasis is known to cause morbidity and mortality worldwide, especially in the bottom billion population in developing countries, mainly as a result of poor sanitation (Haque et al., 2003; Haque and Petri, 2006). This foodborne disease is transmitted via the ingestion of E. histolytica cysts from fecally contaminated food and/or water. Annually approximately 100,000 deaths are reported to be caused by this disease (WHO, 1997).

ALA, pyogenic liver abscess (PLA), or noninfectious liver abscess are often diagnosed radiologically using imaging procedures such as ultrasound, computed tomography scanning, or magnetic resonance imaging. These techniques are sensitive for the detection of liver abscess but are unable to differentiate the three conditions. Consequently, other laboratory techniques such as antibody and antigen detection tests, bacterial culture, microscopic examination, and DNA-based techniques need to be performed to achieve a final diagnosis.

In the diagnosis of ALA, antibody-detection tests such as indirect hemagglutination assay (IHA) and ELISA are reliable in countries that are nonendemic for amoebiasis. However, in endemic areas, these tests may detect antibodies from both present and previous infections, and thus the results are often unable to confirm cases of current infection (Zengzhu et al., 1999). Nevertheless, these tests are routinely used in diagnostic laboratories in developing countries because they are cheaper and/or less technically demanding compared with more advance techniques such as antigen detection and polymerase chain reaction (PCR). The available stool antigen detection tests are sensitive in detecting E. histolytica antigen in stool samples; however, variable sensitivity has been shown for the detection of antigens in serum and pus samples (Haque et al., 1998; Haque et al., 2000; Roy et al., 2005; Mohammadi et al., 2006; Ahmad et al., 2007; Fotedar et al., 2007; Zeehaida et al., 2008).

Recently, DNA-based techniques such as real-time PCR have been developed and used in the diagnosis of amoebiasis. The assays have been reported to greatly improve the sensitivity and specificity of detection of infection using pus or stool specimens (Verweij et al., 2004; Roy et al., 2005; Ahmad et al., 2007). Further, real-time PCR shortens the time to obtain the result when compared with conventional PCR because of the simultaneous monitoring of the amplification process. In this study, real-time PCR was used to detect E. histolytica DNA in pus of liver abscess patients. The results were then compared with those obtained using the routine IHA antibody detection test.

Materials and Methods

Sample collection

Thirty pairs of pus and serum samples from patients with liver abscess were collected from the Hospital Universiti Sains Malaysia (HUSM, Kubang Kerian, Kelantan, Malaysia). The samples were collected during a 1-year period (2007–2008) from patients who had pain and tenderness in the right upper quadrant of abdomen, hepatomegaly, and/or fever, and ultrasound findings showed abscess in the liver parenchymal tissue. The lesions of the liver abscess were measured by ultrasound and the total volume of each abscess was calculated.

Approximately 1–3 mL of liver pus was aseptically aspirated from the liver abscess under ultrasound guidance and 1 mL of serum was collected from each patient. This study was conducted in accordance with the requirements of USM Human Ethics Committee.

Bacterial culture

Briefly, the pus sample was centrifuged at 800 g for 10–15 min. The supernatant was aspirated and 500 μL was retained in the tube. The retained pus sample was vortexed for 30 s, and 50 μL was inoculated onto blood, chocolate, and McConkey agar plates and incubated at 35°C for 48 h. Any bacterial growth was identified by Gram staining and standard biochemical identification methods.

Antibody detection test

The IHA for detection of antiamoebic antibody was performed on the serum samples using the Cellognost^® Amoebiasis Kit (Dade Behring Marburg GmbH, Marburg, Germany) according to the manufacturer's instruction. A serum titer of ≥1:32 indicates the possible presence of extraintestinal amoebiasis.

Cloning of SSU rRNA region of E. histolytica

The 172 bp SSU rRNA region was amplified from native E. histolytica HM1 DNA template using the E. histolytica/Entamoeba dispar primer set, as shown in Table 1. The PCR mixture (25 μL final volume) comprised 12.5 μL Hotstar Taq mastermix (Qiagen, Hilden, Germany), 5 mM MgCl₂ (Fermentas, Amherst, NY), and 300 nM of each primer (Verweij et al., 2003). DNA amplification was performed as follows: 95°C for 15 min, followed by 50 cycles of 95°C for 9 s and 60°C for 60 s (BioRad, Hercules, CA). Subsequently, the PCR product was cloned into pCR^®2.1-TOPO^® cloning vector (Invitrogen, Carlsbad, CA). One of the positive clones was sent for sequencing, and the sequence analysis (Bioedit, Carlsbad, CA) (Hall, 1999) was used to verify the presence of the target sequence in the recombinant plasmid. This clone, called pTEh1, was subsequently used for construction of a standard curve for real-time PCR assay.

Table 1.

List of Primers and Probes Used in This Study

Organism	Primer and probe sequence 5′–3′	Amplicon size (bp)
Entamoeba histolytica (Verweij et al., 2003)
Ehd-239F	5′ ATTGTCGTGGCATCCTAACTCA 3′	172
Ehd-88R	5′ GCGGACGGCTCATTATAACA 3′
Histolytica-96T	VIC 5′ TCATTGAATGAATTGGCCATTT 3′ NFQ
Phocine Herpes Virus 1 (Internal control) (Niester, 2002)
PhHV-267s	5′ GGGCGAATCACAGATTGAATC 3′	69
PhHV-337as	5′ GCGGTTCCAAACGTACCAA 3′
PhHV-305tq	Cy5 5′ TTTTTATGTGTCCGCCACCATCTGGATC 3′

DNA extraction

Pus aspirate of 0.1 g was added to 200 μL of 2% polivinylpolypyrolidone (Sigma Aldrich) before DNA extraction using QIAamp tissue extraction kit (Qiagen). The AL buffer was spiked with 1:100 dilution of Phocine Herpes Virus (PhHV-1), which served as inhibitor or internal control for DNA extraction and PCR. Finally, the DNA was eluted with 100 μL AE buffer. The PhHV-1 was a kind contribution from Dr. Martin Schutten, Erasmus MC, Department of Virology (Rotterdam, The Netherlands). For each pus sample, two separate DNA extractions were performed. Each DNA extract was then used in separate real-time PCR experiments.

DNA extraction and PCR were repeated for the following samples: one sample that was positive in all three techniques; three samples that were positive by real-time PCR and bacterial culture but negative by IHA; and six samples that were positive by real-time PCR but negative by IHA and bacterial culture. This step was performed to exclude the possibility of false-positive results due to contamination.

Real-time PCR amplification and detection

The primers and probes were used as reported previously (Table 1). Two standard curves were made using a serial dilution series of the recombinant plasmid harboring E. histolytica SSU rRNA region and DNA isolated from trophozoites that were serially diluted to 10 copies/reaction and 10^–2 cell/mL, respectively. Amplification reactions were performed in a volume of 25 μL with 12.5 μL Hotstar Taq mastermix (Qiagen), 5 mM MgCl₂ (Fermentas), 0.1 mg/mL bovine serum albumin (Sigma-Aldrich, St. Louis, MO), 60 nM each Ehd primer, 80 nM each PhHV-1 specific primer, 0.25 μM E. histolytica-specific MGB-Taqman probe, 0.25 μM PhHV-1-specific double-labeled probe, and 5 μL of the DNA sample. The amplification parameters were as follows: 95°C for 15 min, followed by 50 cycles of 95°C for 9 s and 60°C for 60 s. Amplification, detection, and data analysis were performed using the Rotor Gene 6000 machine (Rotorgene-Q, Hilden, Germany). Fluorescence was measured during the annealing step of each cycle. For each PCR run, three control reactions were incorporated, namely negative control comprising PCR mixture without DNA template, positive control comprising E. histolytica DNA obtained from cultured organism, and PhHV-1 DNA. The viral DNA was used as a control to ensure that there is no inhibition during the DNA extraction and PCR reaction.

Conventional PCR amplification and sequencing

Sequence analysis of the PCR products were performed only on the samples with the following criteria: samples that were positive for bacterial culture and also by E. histolytica PCR (irrespective of the IHA results); or samples that were negative by IHA but positive by E. histolytica PCR. Thus, based on Table 2, there were 10 samples that fulfilled the above criteria, namely one sample that was positive for all three techniques, three that were positive by real-time PCR and bacterial culture but negative by IHA, and six samples that were positive by real-time PCR but negative by IHA and bacterial culture. The PCR reactions and thermal profile used were the same as that used for cloning of SSU rRNA E. histolytica. PCR products were run on a 2% agarose gel and visualized with ethidium bromide. The PCR product from each sample was purified using Wizard SV Clean-Up kit (Promega, San Luis Obispo, CA) and sent for sequencing. The sequencing result was confirmed using BLAST search to verify the presence of E. histolytica DNA sequence.

Table 2.

Summary of Results of Indirect Hemagglutination Assay, Bacterial Culture, and Real-Time Polymerase Chain Reaction on Samples from Patients with Liver Abscess

		No. of samples (%) PCR (ALA)
IHA (ALA)	Bacterial culture (PLA)	Positive	Negative	Total no. of samples
Positive	Positive	1 (3%)	0 (0%)	1
Negative	Negative	6 (20%)	1 (3%)	7
Positive	Negative	13 (43%)	0 (0%)	13
Negative	Positive	3 (10%)	6 (20%)	9
		23 (77%)	7 (23%)	30

IHA, indirect hemagglutination assay; ALA, amoebic liver abscess; PLA, pyogenic liver abscess; PCR, polymerase chain reaction.

Results

Detection limit of the real-time PCR assay

The detection limit of the assay, when measured by the detection of the recombinant plasmid that carries the SSU rRNA of E. histolytica, was found to be 10 copies/reaction When measured using DNA extracted from known number of E. histolytica trophozoites, the detection limit was 10^–2 cells/mL.

Real-time PCR assay, IHA, and bacterial culture on patients' samples

The detection of PhHV-1 amplification in all PCR reactions showed that the DNA extraction and real-time PCR steps had been successful. Twenty three of 30 liver abscess samples (77%) were found to be positive by the real-time PCR assay with median cycle threshold (Ct) values of 29.4 (22.8 < Ct < 37.8), whereas 10 patients' samples were positive by bacterial culture. The PCR was scored as negative when the Ct value was 40 or above, or when no amplification curve was obtained. In all the PCR runs, the three controls (negative, positive, PhHV-1) performed as expected. In addition, all duplicate PCR runs gave consistent results.

Antibodies against E. histolytica antigens were detected with IHA in 14 of 30 serum samples (46.7%). Real-time PCR significantly detected more positive cases (1.6×) than IHA (p = 0.008, Fisher's exact test, SPSS version 12). Among the 23 patients whose pus samples were positive by real-time PCR, 14 (61%) were also positive by IHA and 4 (17%) were positive by bacterial culture. There were nine samples that were PCR positive but IHA negative, and only one of the samples showed a relative low load (Ct value > 35). Meanwhile, six patients' liver abscess samples were negative by real-time PCR and IHA, but positive by bacterial culture (thus purely PLA cases). Only one patient was negative by all three tests (Table 2).

From a total of 10 samples that were positive for PLA, one sample was positive for all assays (IHA, real-time PCR, and bacterial culture); three were positive by real-time PCR and bacterial culture, and negative by IHA; and six samples were positive in the bacterial culture but negative by IHA and real-time PCR. The bacteria that were isolated from the pus samples comprised Aeromonas caviae, Staphylococcus aureus, and mixed bacterial growth (Table 3). Sequence analysis on the DNA produced by the E. histolytica real-time PCR on these 10 pus samples confirmed the presence of E. histolytica DNA in all samples, and BLAST analysis showed 99–100% sequence identities to E. histolytica 18S sRNA (GenBank accession no. AB282660, AB282659, and AB282658).

Table 3.

Results of Samples from Four Patients Who Had Mixed Entamoeba histolytica and Bacterial Infections

Sample	IHA	PCR	Types of bacterial isolates	Sequencing
A	+	+	Mix bacterial growth	+
B	−	+	A. caviae	+
C	−	+	S. aureus	+
D	−	+	S. aureus	+

The median interquartile range (IQR) volumes of liver abscess lesions in IHA+, PCR+ patients and IHA−, PCR+ patients were analyzed by Mann–Whitney test (SPSS version 12) and found to be not significantly different, that is, 394.95 cm³ (440.0) and 491.00 cm³ (532.9), respectively (p = 0.45). The duration of fever and abdominal pain for both groups were also found to be not significantly different, that is, p = 0.77 and 0.55, respectively.

Discussion

In this study, we used previously validated primers and probes for real-time PCR detection of E. histolytica from stool specimens (Verweij et al., 2003, 2004; Qvarnstrom et al., 2005). The results confirmed the usefulness of these primers and probes for amplification and detection of E. histolytica DNA in liver abscess samples.

It has been reported that different real-time PCR machines may influence the PCR conditions, detection limits of DNA copy number, and detection limit of the organism load (Qvarnstrom et al., 2005). Previous studies on molecular diagnosis of amoebiasis used the I-cycler real-time PCR (BioRad), Mx3000P thermocycler (Stratagene, La Jolla, CA), and ABI PRISM 7700 (Applied Biosystems, Foster City, CA) (Verweij et al., 2003, 2004; Qvarnstrom et al., 2005). Rotor Gene 6000 (Rotorgene-Q) has not been reported for molecular diagnosis of amoebiasis, and this study shows that this thermocycler produces good results.

In a previous study, a standard curve of the load of the E. histolytica was constructed to determine the detection limit of the assay, which was reported to be 0.5 trophozoites per milliliter (Qvarnstrom et al., 2005). In this study, the assay detection limit was tested by constructing standard curves based on the number of recombinant plasmid DNA (E. histolytica SSU rRNA region) and based on the number of organisms. The results show that this real-time PCR for the detection of E. histolytica DNA is very sensitive and able to detect as low as 10 copies/reaction of the recombinant plasmid and less than one E. histolytica trophozoite per milliliter. This can be explained by the fact that each disrupted trophozoite releases several hundred copies of target DNA, which results in the presence of amplifiable DNA even in samples that should not contain any cell according to cell count calculation (Qvarnstrom et al., 2005).

Antibodies against E. histolytica could not be detected in 9 of 23 cases in which E. histolytica DNA was detected with real-time PCR in the liver abscess samples. These nine patients may be at an early stage of the infection and therefore had undetectable levels of anti-E. histolytica antibodies. According to previous reports, serology may be negative in patients in the acute phase within 7–10 days postinfection (Hira et al., 2001; Fotedar et al., 2007). At this stage, liver abscess may have developed and thus early detection is crucial to avoid complications. However, in this study, the statistical analysis of the sizes of the lesions between the group with IHA+, PCR+ and the group with IHA−, PCR+ showed no significant difference. Similarly, statistical analysis of the duration of fever and abdominal pain between the two groups also showed no significant difference. It is notable that there were no IHA positive cases that were negative by real-time PCR, thus reflecting the sensitivity of the latter. The etiology of liver abscess in one patient whose samples were negative by all three tests could not be established.

Although it is generally thought that serology has a high sensitivity in ALA case, in a recent review paper, sensitivity of antibody detection in ALA (acute infection) was reported to range from 70% to 100% (Fotedar et al., 2007). In this study, antibody test detected 1.6 times fewer number of patients when compared with detection of E. histolytica DNA in liver abscess samples. The low sensitivity of serology when compared with real-time PCR is comparable with previous observations comparing conventional PCR and IHA (Parija and Khainar, 2007).

There are several studies on detection of E. histolytica antigen in liver abcess samples, which showed sensitivity that ranged from <40% to 100%, depending on whether treatment was given (Roy et al., 2005; Ahmad et al., 2007; Fotedar et al., 2007). In our study, most of the patients received treatment before pus aspirations were performed, and thus we would expect the antigen test to yield low-positive results, which may not be useful to be performed, especially considering the high cost of the commercial kit.

This study revealed that mixed parasite and bacterial infections in liver abscess disease occur among the population in the eastern Peninsular Malaysia. The bacteria isolated were A. caviae, S. aureus, and mixed organisms. The real-time PCR assay detected E. histolytica DNA in 4 of 10 samples with bacterial infections. The presence of E. histolytica DNA in these samples was verified through sequencing analysis. The occurrence of mixed parasitic and bacterial infection in liver abscess samples has been reported only once previously. In that report, conventional PCR identified two genera of anaerobic bacteria, namely Peptostreptococcus and Bacteroides spp. (Rani et al., 2006). However, the investigators were unable to isolate the bacteria by culture method on agar plate. The information of single or mix infection in liver abscess would be important for clinician to assign appropriate treatment. It would also be interesting to investigate whether ALA precedes PLA or otherwise. Intestinal bacterial overgrowth and compromised mucosal barrier were reported to be possible methods for extraintestinal bacterial infection (O'Boyle et al., 1988). Intestinal inflammation caused by bacterial infection may have facilitated the entry of E. histolytica into the blood. The amoeba could then carry the bacteria with it, thus resulting in the parasite and bacteria coinfection in the liver. Further studies on mixed amoeba–bacteria extraintestinal infections are needed to provide important epidemiological data (Rani et al., 2006).

In conclusion, this study showed that the real-time PCR assay is a very useful diagnostic and epidemiological tool for detection of ALA because it is highly sensitive, saves time by elimination of post-PCR analysis, reduces risk of amplicon contamination (Klein, 2002), and is specific and rapid. However, because of the current high cost of the real-time thermocycler and reagents, and the technical skill required, it may not be applicable to many laboratories in underdeveloped countries where most cases of ALA are found. Nevertheless, it can be performed in reference laboratories, private laboratories, and university hospitals.

Footnotes

Acknowledgments

This study was funded by a research grant from the Malaysian Ministry of Higher Education (FRGS grant no. 203/CIPPM/6711122). The first author received financial support through the university's Vice Chancellor Award.

Disclosure Statement

No competing financial interests exist.

References

Ahmad

, Khan

, Hoque

, Haque

, Mondol

. Detection of Entamoeba histolytica DNA from liver abscess aspirate using polymerase chain reaction (PCR): a diagnostic tool for amoebic liver abscess. Bangladesh Med Res Counc Bull, 2007; 33:13–20.

Fotedar

, Stark

, Beebe

, Marriot

, Ellis

, Harkness

. Laboratory diagnostic techniques for Entamoeba species. Clin Microbiol Rev, 2007; 20:511–532.

Hall

. BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 5/98/NT. Nucl Acids Symp Ser, 1999; 41:95–98.

Haque

, Ali

IKM

, Petri

Jr.

A case report of Entamoeba moshkovskii infection in a Bangladeshi Child. Parasitol Int, 1998; 47:201–202.

Haque

, Kress

, Wood

, Jackson

TFGH

, Lyerly

, Wilkins

, Petri

Jr.

Current concept: amebiasis. N Engl J Med, 2003; 348:1565–1573.

Haque

, Mollah

, Ali

IKM

, Alam

, Eubank

, Luerly

, Petri

Jr.

Diagnosis of amebic liver abscess and intestinal infection with the Techlab Entamoeba histolytica II antigen detection and antibody tests. J Clin Microbiol, 2000; 38:3255–3239.

Haque

, Petri

Jr.

Diagnosis of amebiasis in Bangladesh. Arch Med Res, 2006; 37:273–276.

Hira

, Mollah

, Ali

IKM

, Alam

, Eubanks

, Lyerly

, Petri

Jr.

Invasive amebiasis: challenges in diagnosis in a non-endemic country (Kuwait)

Am J Trop Med Hyg, 2001; 65:341–345.

Klein

. Quantification using real-time PCR technology: applications and limitations. Trend Mol Med, 2002; 8:257–260.

10.

Mohammadi

, Rezaian

, Babaei

, Rajabpour

, Meamer

, Pourbabai

, Petri

Jr.

Comparison of stoll antigen detection kit and PCR for diagnosis of Entamoeba histolytica and Entamoeba dispar infections in asymptomatic cyst passers in Iran. J Clin Microbiol, 2006; 44:2258–2261.

11.

Niester

. Clinical virology in real time. J Clin Virol, 2002; 25,Suppl 3:S3–S12.

12.

O'Boyle

, Mac

, Mitchell

. Microbiology of bacterial translocation in humans. Gut, 1988; 42:29–35.

13.

Parija

, Khairnar

. Detection of excretory Entamoeba histolytica DNA in the urine, and detection of E. histolytica DNA and lectin antigen in the liver abscess pus for the diagnosis of amebic liver abscess. BMC Microbiol, 2007; 7:41.

14.

Qvarnstrom

, James

, Xayavong

, Holloway

, Visvesvara

, Sriram

, da Silva

. Comparison of real-time PCR protocols for differential laboratory diagnosis of amebiasis. J Clin Microbiol, 2005; 43:5491–5497.

15.

Rani

, Murthy

, Bhattacharya

, Ahuja

, Rizvi

, Paul

. Changes in bacterial profile during amebiasis: demonstration of anaerobic bacteria in ALA pus samples. Am J Trop Med Hyg, 2006; 75:880–885.

16.

Roy

, Kabir

, Mondal

, Ali

IKM

, Petri

Jr. , Haque

. Real-time- PCR assay for diagnosis of Entamoeba histolytica infection. J Clin Microbiol, 2005; 43:2168–2178.

17.

Rustgi

, Richter

. Pyogenic and amebic liver abscess. Med Clin N Am, 1989; 73:847–858.

18.

Verweij

, Blange

, Templeton

, Schinkel

, Brienen

, Van Rooyen

, van

Lieshout L

, Polderman

. Simultaneous detection of Entamoeba histolytica, Giardia lamblia and Cryptosporodium parvum in fecal samples by using multiplex real-time PCR. J Clin Microbiol, 2004; 42:1220–1223.

19.

Verweij

, Oostvogel

, Brienen

EAT

, Nang-Neifubah

, Ziem

, Polderman

. Prevalence of Entamoeba histolytica and Entamoeba dispar in northern Ghana. Trop Med Int Health, 2003; 8:1153–1156.

20.

[WHO] World Health Organization, World Health Organization/Pan American Health Organization/UNESCO report of a consultation of experts on amoebiasis. Wkly Epidemiol Rec, 1997; 72:97–99.

21.

Zeehaida

, Wan Nor Amilah

WAW

, Amry

, Hassan

, Rahmah

. A study on the usefulness of Techlab Entamoeba histolytica II antigen ELISA in the diagnosis of amoebic liver abscess (ALA) at Hospital Sains Malaysia (HUSM), Kelantan, Malaysia. Trop BioMed, 2008; 25:209–216.

22.

Zengzhu

, Bracha

, Nuchamowitz

, Cheng

, Mirelman

. Analysis by enzyme-linked immunosorbent assay and PCR of human liver aspirates from patients in China for Entamoeba histolytica. J Clin Microbiol, 1999; 37:3034–3036.