Prevalence of Serogroups,Virulence Genotypes,Antimicrobial Resistance,and Phylogenetic Background of Avian Pathogenic Escherichia coli in South of China

Abstract

Avian pathogenic Escherichia coli (APEC) is an important respiratory pathogen of poultry. A variety of virulence-associated genes and serogroups are associated with avian colibacillosis caused by APEC strains. One hundred forty-eight E. coli isolates recovered from diagnosed cases of avian colibacillosis from Guangdong province between 2005 and 2008 were serotyped, and characterized for virulence-associated genes, phylogenetic backgrounds, antibiotic susceptibility, and genetic relatedness. Associations between virulence-associated genes and antimicrobial resistance were further analyzed. Although 148 APEC isolates belonged to 21 different serogroups, 81% were of one of eight serogroups: O65 (27%), O78 (10%), O8 (9%), O120 (9%), O2 (7%), O92 (6%), O108 (5%), and O26 (5%). Polymerase chain reaction analysis showed that the most prevalent gene was traT (90%), followed by iroN (63%), fimH (58%), hlyF (55%), cvaC (54%), and sitA (51%). The APEC strains mainly belonged to groups A (73%) and D (14%). Multiple antimicrobial-resistant phenotypes (greater than or equal to three antimicrobials) were detected in all E. coli isolates, with the majority of isolates displaying resistance to tetracycline (97%), sulfamethoxazole (93%) and fluoroquinolones (87% for ciprofloxacin and 84% for enrofloxacin), chloramphenicol (74%), and florfenicol (66%). All E. coli isolates were further genetically characterized by pulsed-field gel electrophoresis. A total of 125 different pulsed-field gel electrophoresis profiles were obtained, implying that the multiresistant E. coli isolates carrying virulence-associated genes and belonging to multiple serogroups were not derived from a specific clone, but represented a wide variety of chromosomal backgrounds. Statistical analysis showed that several virulence-associated genes were significantly present in APEC isolates susceptibility to multiple antimicrobials. The findings demonstrate that a wide variety of serogroups and potential virulence genes, multiple-resistances, and the clear association of susceptibility and virulence genes have commonly emerged in APEC strains, and these also suggest that antimicrobials should be prudently used to reduce the emergence and spread of resistant strains carrying virulence-associated genes.

Introduction

E scherichia coli is a commensal resident of the intestine as well as a pathogen that can cause both enteric and extraintestinal infections of humans and animals (Russo and Johnson, 2003; Kaper et al., 2004; Barnes et al., 2008). Avian pathogenic E. coli (APEC) can cause extraintestinal infections, including respiratory infections (airsacculitis and pneumonia) and septicemia of poultry (Dho-Moulin and Fairbrother, 1999; Barnes et al., 2008), resulting in large annual losses for the poultry industry due to mortality, lost production, and condemnations. Several studies have suggested that certain APEC isolates are potential zoonotic pathogens (Ewers et al., 2007; Moulin-Schouleur et al., 2007; Mora et al., 2009). APEC isolates have been compared to extraintestinal pathogenic E. coli isolates from human urinary tract infections and neonatal meningitis, revealing that they have some overlap in serogroups (O1, 2, 4, 6, 7, 8, 16, 18, 75, and 78), phylogenetic groups, and virulence genotypes (Ewers et al., 2007; Ananias and Yano, 2008).

Antimicrobials are commonly used for the treatment of avian colibacillosis caused by E. coli; however, increased resistance has been frequently reported in E. coli isolates from poultry in China (Yang et al., 2004; Zhao et al., 2005; Dai et al., 2008; Jiang et al., 2009). Resistant pathogens have emerged as a major concern for human and veterinary medicine. A study has reported the transmission of resistant E. coli clones from poultry to humans (Van den Bogaard et al., 2001). To tackle the development and spread of resistance and choose effective antimicrobial agents in various clinical settings, reliable data on the prevalence of resistance to specific antimicrobials of bacteria isolated from both humans and animals are required. Recently, a number of studies have reported that significantly reduced virulence potential was associated with resistance to certain antibiotics, such as fluoroquinolones, chloramphenicol, and tetracycline (Johnson et al., 2003; Horcajada et al., 2005; Moreno et al., 2006). However, up to now, the correlation between antimicrobials resistance and virulence-associated genes has not been studied in APEC strains isolated from south China.

The objective of this study was to determine the prevalence of serogroups, virulence-associated genes, phylogenetic groups, antimicrobial resistance, and genetic relatedness among APEC strains and to estimate the relationship of potential virulence genes with resistance to antimicrobial agents.

Materials and Methods

Bacterial strains

A large number of diseased or dead animals were submitted to the Veterinary Research Institute, Guangdong Academy of Agricultural Sciences, for diagnostic investigation. A total of 148 E. coli strains were isolated from broiler chickens found to have colibacillosis from November 2005 to March 2008. These diseased chickens were from 58 farms all over Guangdong Province, China. The farms typically housed ∼5000 animals. One to three flocks of chickens were sampled from each farm; each sample was from an individual animal. All samples were collected from a variety of tissues, including the air sac (2005, 5 isolates), trachea (2005, 15 isolates; 2007, 4 isolates; 2008, 11 isolates), liver (2005, 30 isolates; 2007, 14 isolates; 2008, 30 isolates), spleen (2007, 8 isolates), or heart blood samples (2005, 10 isolates; 2007, 18 isolates; 2008, 3 isolates) and inoculated onto MacConkey agar. The bacterial strains were identified by classical biochemical methods and confirmed by the API-20E system (bioMérieux). All strains were stored at −80°C in brain heart infusion broth with 15% glycerol until further use. For preparation of samples for testing, isolates were cultured on blood agar or trypticase-soy agar at 37°C over night.

Serotyping

The determination of O antisera was carried out by the method described by Orskov and Orskov (1990), by using antisera for all available somatic O types (O1-O171).

Virulence genotyping

All isolates were tested for 11 potential virulence genes by polymerase chain reaction (PCR) amplification. The primers used are listed in Table 1. Bacterial DNA was prepared by a rapid boiling method including a heating step at 100°C of a single colony in a volume of 100 μL of distilled water; after being cooled to room temperature, the suspension was centrifuged for 3 min at maximum speed to remove cell debris. Three multiplex PCR, used in the bulk of the genotyping studies, were as follows: (1) tsh, iss, and iucA; (2) hlyF and sitA; (3) ibeA, traT, cdtB, iroN, and cvaC. The fimH was detected in simple PCR assays. Amplification was done in a 25 μL volume reaction mixture containing 2 μL template DNA (except for 1 μL for fimH) and 50 pmol of each primer. All PCRs were done with the following conditions: 1 cycle of 5 min at 95°C; 30 cycles, each consisting of 30 sec at 95°C, 30 sec at annealing temperature, and 45 sec at 72°C; and 1 cycle of 5 min at 72°C. The PCR products were analyzed by electrophoresis and observed by ultraviolet transilluminator.

Table 1.

Primers Used for Polymerase Chain Reaction Amplifications

Gene	Oligonucleotide sequence (5′–3′)	Annealing temperature (°C)	Amplicon size (bp)	Reference
iucA	ATGAGAATCATTATTGACATAATT CTCACGGGTGAAAATATTTT	55	1482	Tivendale et al. (2004)
tsh	GGTGGTGCACTGGAGTGG AGTCCAGCGTGATAGTGG	55	642	Tivendale et al. (2004)
iss	GTGGCGAAAACTAGTAAAACAGC CGCCTCGGGGTGGATAA	55	762	Tivendale et al. (2004)
fimH	GATCTTTCGACGCAAATC CGAGCAGAAACATCGCAG	52	389	Moulin-Schouleur et al. (2006)
sitA	AGGGGGCACAACTGATTCTCG TACCGGGCCGTTTTCTGTGC	60	608	Johnson et al. (2006)
hlyF	GGCGATTTAGGCATTCCGATACTC ACGGGGTCGCTAGTTAAGGAG	60	599	Johnson et al. (2006)
iroN	AAGTCAAAGCAGGGGTTGCCCG GACGCCGACATTAAGACGCAG	63	667	Johnson et al. (2006)
traT	GGTGTGGTGCGATGAGCACAG CACGGTTCAGCCATCCCTGAG	63	290	Johnson and Stell (2000)
cdtB	AAATCACCAAGAATCATCCAGTTA GAAAGTAAATGGAATATAAATGTCCG	63	430	Johnson and Stell (2000)
ibeA	AGGCAGGTGTGCGCCGCGTAC TGGTGCTCCGGCAAACCATGC	63	170	Johnson and Stell (2000)
cvaC	CACACACAAACGGGAGCTGTT CTTCCCGCAGCATAGTTCCAT	63	697	Johnson and Stell (2000)
chuA	GACGAACCAACGGTCAGGAT TGCCGCCAGTACCAAAGACA	55	279	Clermont et al. (2000)
yjaA	TGAAGTGTCAGGAGACGCTG ATGGAGAATGCGTTCCTCAAC	55	211	Clermont et al. (2000)
TSPE4.C2	GAGTAATGTCGGGGCATTCA CGCGCCAACAAAGTATTACG	55	152	Clermont et al. (2000)

Phylogenetic analysis

Multiplex PCR-based method, as described by Clermont et al. (2000), was used for phylogenetic analysis. The primer pairs used were chuA, yjaA, and TSPE4.C2, which generate 279-, 211-, and 152-bp fragments, respectively (Table 1). The PCR was performed in a 25 μL volume consisting of 3 μL of template DNA and 50 pmol of each primer. The PCR steps were as follows: denaturation for 5 min at 94°C; 30 cycles of 30 sec at 94°C, 30 sec at 55°C, and 30 sec at 72°C, and a final extension step of 7 min at 72°C. The combinations of three genetic markers (chuA, yjaA, and TSPE4.C2) were used for determining the phylogenetic group of each strain (Clermont et al., 2000).

Antimicrobial susceptibility testing

All strains were determined for susceptibility to the following antimicrobial agents by agar dilution method: ceftriaxone, ceftiofur, amikacin, apramycin, streptomycin, gentamycin, chloramphenicol, florfenicol, tetracycline, doxycycline, sulfamethoxazole, ciprofloxacin, enrofloxacin, and levofloxacin. Antimicrobial susceptibility testing was conducted and the results were interpreted according to the guidelines of Clinical and Laboratory Standards Institute document M31-S1 (CLSI, 2004). As there are no CLSI breakpoints for doxycycline that are applicable to E. coli of animal origin, breakpoints of doxycycline (≥16 mg/L) were referred to CLSI document M100-S18 (CLSI, 2008) for isolates of human origin. E. coli ATCC 25922 was used as a quality control strain.

Pulsed-field gel electrophoresis

Pulsed-field gel electrophoresis (PFGE) was used to analyze genomic relatedness among all APEC isolates. PFGE of chromosomal DNA digested with the restriction enzyme XbaI was carried out according to a standard protocol using a CHEF-MAPPER System (Bio-Rad Laboratories). Salmonella serovar Braenderup H9812 standards served as size markers. The gels were run at 6.0 V cm⁻¹ with an angle of 120° at 14°C for 22 h. The results were interpreted according to the criteria described by Tenover et al. (1995).

Statistical analysis

Comparisons of the associations between resistance and potential virulence genes were carried out using Fisher's exact test (SAS, version 8.2; SAS Institute, Inc.). A p-value of <0.05 was considered significant; in such a case, odds ratio (OR) and their 95% confidence interval (CI) were calculated. For the purpose of this analysis, isolates with intermediate minimum inhibitory concentrations were considered susceptible.

Results

Serotyping

The majority of APEC strains (97%) were typeable with standard O antisera; for those that were typeable (146 isolates), a total of 21 different O serogroups were identified (Table 2). Among the isolates that could be typed, the most prevalent serogroups were O65 (27%), O78 (10%), O8 (9%), O120 (9%), O2 (7%), O92 (6%), O108 (5%), and O26 (5%). Other infrequent serogroups ranged from 1% to 3%, including O5, O53, O66, O79, O84, O88, O96, O115, O121, O123, O159, O160, and O163.

Table 2.

Prevalence of Virulence-Associated Genes in Relation to Serogroups in Avian Pathogenic Escherichia coli Strains

		No. of isolates carrying virulence-associated genes (%)
Serogroups	No. of isolates	sitA	iucA	iss	traT	fimH	tsh	iroN	hlyF	ibeA	cvaC
O65	40	45	20	48	93	60	35	67	48	30	55
O78	15	67	27	53	100	64	67	53	67	40	67
O8	14	50	29	64	100	71	36	79	71	57	79
O120	13	54	8	62	77	85	8	62	46	38	54
O2	11	45	18	36	91	45	9	45	55	36	27
O92	9	67	22	56	89	67	56	56	56	33	67
O108	8	50	25	13	88	25	25	50	63	75	38
O26	7	43	14	14	100	57	29	100	57	14	57
O115	5	100	40	100	100	80	60	100	80	80	100
O79	4	50	25	50	75	75	50	75	50	50	75
O159	4	25	0	50	100	50	50	25	25	75	25
O66	3	67	0	100	100	33	0	100	67	67	0
O5	2	100	100	50	50	100	50	50	50	50	0
O121	2	0	0	50	100	0	0	50	50	50	0
O123	2	50	0	50	100	100	0	100	50	50	50
O160	2	100	50	50	100	100	100	100	100	50	50
O53	1	100	100	100	100	100	100	100	100	100	100
O84	1	0	0	0	100	0	100	0	100	100	0
O88	1	100	100	100	100	100	100	100	100	0	0
O96	1	100	0	100	100	100	0	100	0	0	50
O163	1	0	100	100	100	0	0	100	0	0	0
NT	2	0	0	0	0	100	0	0	50	0	50
All isolates	148	51	22	48	90	58	36	63	55	41	54

NT, nontypeable with standard O antisera.

Prevalence of virulence-associated genes

The prevalence of 11 virulence-associated genes was present in Table 2. The cdtB was not found in any of the E. coli isolates. None of the 11 virulence-associated genes was detected in two (1%) isolates. The traT was detected with the highest prevalence in all isolates. The iroN (63%), fimH (58%), hlyF (55%), cvaC (54%), and sitA (51%) genes were found in more than half of isolates. The distribution of virulence-associated genes related to serogroups showed that the traT gene was the most prevalent among typeable APEC isolates. The iroN and cvaC genes were detected in 79% of O8 strains. The genes for sitA and cvaC were found in 67% of O78- and O92-strains, respectively (Table 2). However, no significant association was found between 11 virulence-associated genes and O serogroups. With regard to seropathotypes, O78-sitA/iss/iroN/tsh/cvaC/traT (six isolates) was the most common, followed by O2-sitA/iss/iroN/hlyF/fimH/traT (four isolates) and O8-iss/iroN/hlyF/ibeA/cvaC/fimH/traT (four isolates) (data not shown).

Phylogenetic distribution of virulence-associated genes and serogroups

According to multi-PCR-based phylotyping, the majority of isolates belonged to phylogenetic group A (108 strains, 73%), followed by groups D (20 isolates, 14%) and B1 (18 isolates, 12%), whereas group B2 only accounted for 1% (2 isolates) of all isolates. Figure 1 displays the different profiles obtained by triplex PCR for the four phylogenetic groups. For all virulence-associated genes and serogroups considered, a very significant phylogenetic distribution emerged (Table 3). A significant association was observed between the presence of sitA and group D (p = 0.007, OR = 4.53; 95% CI, 1.44–14.30). A similar association was observed between the presence of tsh and D group (p < 0.001, OR = 5.32; 95% CI, 1.9–14.89). The differences in the distribution of O-serogroups with regard to phylogenetic groups were minimal, except for O92 (p = 0.019, OR = 6.15; 95% CI, 1.5–25.30) being significantly prevalent in group D than in other groups (Table 3).

FIG. 1.

The polymerase chain reaction profiles specific for Escherichia coli phylogenetic groups. The combinations of chuA, yjaA, and TSPE4.C2 genes were used for determining the phylogenetic group of each strain. Lane 1, group A; lane 2, group D; lanes 3–9, group A; lane 10, group B2; lane 11, group B1; lane M, marker (100–2000 bp).

Table 3.

Distribution of Virulence-Associated Genes and O Serogroups Among 148 Avian Pathogenic Escherichia coli Isolates According to Phylogenetic Groups

	No. (%) of Escherichia coli isolates
Virulence gene/serogroups	Total (n = 148)	Other groups (n = 128)	Group D (n = 20)	p^a	OR	95% CI
sitA	76 (51)	50 (40)	16 (80)	0.007	4.53	1.44–14.30
tsh	53 (36)	39 (30)	14 (70)	<0.001	5.32	1.9–14.89
O92	9 (6)	5 (4)	4 (20)	0.019	6.15	1.5–25.30

Only p-values <0.05 (by the Fisher exact test) are shown.

OR, odds ratio; CI, confidence interval.

Antimicrobial resistance phenotypes

The majority of the avian E. coli isolates were resistant to tetracycline (97%), sulfamethoxazole (93%), chloramphenicol (74%), and florfenicol (66%). Resistance to enrofloxacin and ciprofloxacin among APEC strains were quite high, which were found in 125 (84%) and 129 (87%) isolates, respectively, while to levofloxacin, in 51 (34%) isolates (Table 4). APEC isolates were less frequently resistant to apramycin (28%), ceftiofur (28%), ceftriaxone (19%), and amikacin (34%). With regard to multidrug resistance profiles, all isolates were resistant to >3 of the 14 antimicrobials tested, 40% were resistant to >10 antimicrobials, and 7% were resistant to >13 antimicrobials. Among multidrug resistance profiles, resistance to seven, eight, and nine antimicrobials were prevalent (17%, 18%, and 14%, respectively).

Table 4.

Antimicrobial Resistance Phenotypes of Avian Pathogenic Escherichia coli Isolates (n = 148)

Agents	Resistance breakpoint (≥μg mL⁻¹)	% Resistant strains (n = 148)
Ceftriaxone	64	19
Ceftiofur	8	28
Ciprofloxacin	4	87
Enrofloxacin	2	84
Levofloxacin	8	34
Streptomycin	64	43
Gentamicin	16	52
Amikacin	64	34
Apramycin	32	28
Chloramphenicol	32	74
Florfenicol	32	66
Tetracycline	16	97
Doxycycline	16	64
Sulfamethoxazole	512	93

Association of antimicrobial resistance phenotype with virulence-associated genes

Of the 148 isolates, 143 were successfully typed by PFGE, and a total of 125 different PFGE profiles were obtained, suggesting that most of the isolates in the study were from epidemiologically unrelated E. coli clones. Possible statistical associations of antibiotic resistance/susceptibility phenotypes and virulence traits of epidemiologically unrelated isolates were further analyzed. However, the prevalence of resistance phenotypes according to phylogenetic groups was minimal (p > 0.05), except that enrofloxacin-susceptible isolates were significantly prevalent in phylogenetic group D (p = 0.02) (data not shown).

A more detailed analysis displayed associations of resistance/susceptibility phenotypes with potential virulence genes. First, none of virulence-associated genes were significantly associated with certain antimicrobial resistance/susceptibility phenotypes (including ceftriaxone, ceftiofur, gentamycin, tetracycline, ciprofloxacin, enrofloxacin, levofloxacin, florfenicol, and sulfamethoxazole); second, the presence of iss, cvaC, iroN/hlyF, tsh/cvaC, and iss/tsh was associated with susceptibility to amikacin, apramycin, streptomycin, chloramphenicol, and doxycycline, respectively (Table 5).

Table 5.

Associations Between Resistance Phenotypes and Virulence Genes in Epidemiologically Unrelated Isolates of Escherichia coli (n = 125)

		No. of isolates			Outcome–predictor association
Agents	Vgs	Total	Resistant	Susceptible	OR	95% CI	P^a
AMK	iss	61	13	48	0.35	0.16–0.770.59	0.008
APR	cvaC	67	11	56	0.24	0.11–0.55	<0.0001
STR	iroN	75	24	51	0.40	0.19–0.84	0.017
	hlyF	70	20	50	0.31	0.15–0.65	0.002
CHL	tsh	47	29	18	0.38	0.17–0.87	0.023
	cvaC	67	43	24	0.33	0.14–0.78	0.014
DOX	iss	61	32	29	0.40	0.19–0.84	0.017
	tsh	47	21	26	0.29	0.13–0.6	0.001

OR values above 1 represent positive associations and those below 1 represent negative associations.

Only the results for antimicrobial resistance that exhibited an association with virulence genes at a p < 0.05 are shown.

AMK, amikacin; APR, apramycin; STR, streptomycin; CHL, chloramphenicol; DOX, doxycycline; Vgs, virulence genes.

Discussion

Colibacillosis remains a major problem all over the world; however, it has not been established whether globally avian E. coli causing such infections share similar characteristics with regard to serogroups, virulence-associated genes, phylogenetic background, and antibiotic resistance. Therefore, the evaluation of these characteristics in avian E. coli from South China is very important.

Although a large number of serogroups have been described for E. coli strains, only a few of these, principally O1, O2, O78, O8, O35, and O36, have been commonly implicated in avian colibacillosis on a worldwide scale (Peighambari et al., 1995; Barnes et al., 2008). Of the eight predominant serogroups detected in this study, the prevalence of O2, O8, and O78 is in agreement with other studies (Blanco et al., 1998; Dho-Moulin and Fairbrother, 1999; La Ragione and Woodward, 2002; Ewers et al., 2004; Zhao et al., 2005), while the prevalence of O26, O65, O92, O108, and O120 is different from these reports. Unexpectedly, several studies found that other serogroups O4, O6, O8, O54, O61, O78, O88, and O93 were more prevalent in APEC isolates in the other geographic regions of China (Jin et al., 2008; Song et al., 2008). This discrepancy is interpreted by the fact that the distribution of serogroups can vary considerably from region to region. However, O35 and O36 serogroups reported by other people were not detected in any of the isolates. In addition to O2, O8, and O78 serogroups implicated in various human diseases, O26 detected in the study has been reported frequently associated with severe illness in humans (Brooks et al., 2005; Bielaszewska et al., 2007). Other infrequent serogroups, including O5, O53, O79, O88, O115, O123, O159, and O160 identified in this study, were also found in E. coli isolates from avian colibacillosis in other countries (Blanco et al., 1998; Monroy et al., 2005). However, several serogroups, including O26, O65, O84, O120, O121, O163, and O96, were not previously described in E. coli isolates from diseased poultry but in E. coli isolates from pigs (Gannon et al., 1988; Garabal et al., 1996; Leung et al., 2001; Fratamico et al., 2004). This supports a wide diversity of antigens present in APEC isolates, and may indicate that the emergence of the new serogroups associated with avian colibacillosis has not yet been reported.

The potential virulence genes, sitA, iss, tsh, iroN, hlyF, iucA, fimH, traT, and cvaC, were detected in all isolates in the study. These genes were also found in colibacillosis isolates from other countries (Janßen et al., 2001; Delicato et al., 2003; Rodriguez-Siek et al., 2005), which reveal that multiple potential virulence genes may participate in the pathogenesis of colibacillosis. However, the prevalence of these genes displayed relatively large differences in several studies. For instance, other studies showed that the tsh was detected in 19%, 49.7%, 84%, and 85.3% of the E. coli strains, respectively (Dozois et al., 2000; Janßen et al., 2001; de Brito et al., 2003; Zhao et al., 2005), whereas in 36% of the strains in this study and in 39.5% of the colibacillosis strains (Delicato et al., 2003). Similarly, the iss gene was detected in 83%, 86%, and 38.5% of the colibacillosis strains (de Brito et al., 2003; Delicato et al., 2003; Zhao et al., 2005), whereas it was found in 48% of the isolates in this study.

The fimH, cvaC, and traT genes were equally carried by E. coli isolates from cellulitis lesions and from feces (Peighambari et al., 1995; Ngeleka et al., 1996; de Brito et al., 2003); however, this could not be interpreted as a sign that these genes are unimportant in pathogenesis. For instance, fimH has been proven essential to human urinary tract infection (Mulvey et al., 1998), and F1 fimbriae are expressed by E. coli colonizing the trachea and the air sacs in vivo in chickens inoculated by the intratracheal route (Pourbakhsh et al., 1997), although other studies showed that fimH is not necessary for the colonization of trachea and air sacs (Marc et al., 1998; Arné et al., 2000). A study also suggests that these genes still might be required for infection (de Brito et al., 2003). It is plausible that different APEC strains can exploit several alternative paths to adhere, colonize, and invade their hosts.

Virulent extraintestinal pathogenic E. coli strains presumably belong mainly to group B2 and, to a lesser extent, to group D, whereas most commensal E. coli strains belong to group A (Clermont et al., 2000). However, phylogenetic analysis showed that APEC strains in this study mainly belonged to phylogenetic groups A and D. Several recent studies have reported similar results that APEC isolates frequently fall into A and D groups (Kariyawasam et al., 2007; Dissanayake et al., 2008; Ghanbarpour et al., 2010). This suggests that predictions about the virulence of APEC strains cannot be based only on chromosomal differences (Kariyawasam et al., 2007).

Antimicrobial therapy is one of the important measures for reducing significant economic losses to the poultry industry caused by colibacillosis. However, most of the APEC isolates from colibacillosis in this study showed high resistance to multiple antimicrobials such as tetracycline, sulfamethoxazole, and chloramphenicol, which also displayed multiple resistances to as many as five different antimicrobial classes. This observation is consistent with another Chinese study (Zhao et al., 2005), which is also similar to other reports (Sáenz et al., 2001; Gyles, 2008),

High resistance to doxycycline and florfenicol, two antibiotics now used legally and extensively in veterinary practice in China, was observed in this study; similar results were reported previously (Salehi and Bonab, 2006; Dai et al., 2008). The increase in resistance to doxycycline and florfenicol in this study is likely related to the increasing use of them on animal farms, or to the cross resistance as a result of the use of the same class such as tetracycline and chloramphenicol. The direct relationship between antimicrobial resistance and antimicrobial use was described by several studies (Moniri and Dastehgoli, 2007; Miranda et al., 2008; Varga et al., 2009).

Fluoroquinolones and cephalosporins are the most commonly used antimicrobials in both human and veterinary clinical medicine, but high resistance to fluoroquinolones has been reported: 90% of chicken isolates were resistant to ciprofloxacin (Sáenz et al., 2001) and more than half of all isolates were resistant to enrofloxacin and ciprofloxacin (Yang et al., 2004; Moniri and Dastehgoli, 2007). Likewise, in this study, most isolates also displayed high resistance to fluoroquinolones tested. Resistance to ceftiofur and ceftriaxone has increased over time, with the rates of 13% and 3% in 2000 (Zhao et al., 2005), 6.9% and 3.6% in 2003 (Liu et al., 2007), and 28% and 19% in the present study; thus, resistance to both antimicrobials should be carefully monitored in the future.

Physical linkages and statistical associations between resistance and virulence genes have been reported in swine pathogenic E. coli (Boerlin et al., 2005; Travis et al., 2006). However, in this study, we observed that some virulence-associated genes significantly present in APEC strains susceptible to amikacin, apramycin, streptomycin, chloramphenicol, and doxycycline, which are partly in agreement with previous reports that certain virulence-associated genes among human pathogenic E. coli isolates were significantly enriched in strains susceptible to certain antibiotics, such as chloramphenicol, tetracycline, and others (Johnson et al., 2003; Starčič Erjavec et al., 2007). This suggests that certain virulence genes may significantly exist in susceptible poultry as well as human strains. This indicates that the relationship of resistance with virulence-associated genes may vary according to particular host. The difference in such associations may be related to virulence-associated genes, geographical origin, and antimicrobial use of the strains under investigation.

Conclusions

These results reveal that a wide diversity of serogroups, multiple virulence-associated genes, and high resistance to multiple antimicrobial agents exist in avian E. coli isolates from colibacillosis. The analysis of genetic relatedness suggests that resistance has widely emerged among different APEC isolates. We believe that E. coli strains should be considered as important causative agents of development of avian disease, and antimicrobial resistance and virulence traits were as parts of an interconnected system. Virulence-associated genes significantly present in the susceptible APEC strains, suggesting that antimicrobial agents should be prudently used to control the emergence and increase of resistant isolates harboring virulence-associated genes.

Footnotes

Acknowledgments

We thank Professor Song Gao (College of Veterinary Medicine, Yangzhou University) for providing standard strains. This work was supported in part by the following grants: the National Natural Science Foundation of China (U0631006), Provincial Science Foundation of Guangdong (5200638), and the Program for Changjiang Scholars and Innovative Research Team in University (IRT0723).

Disclosure Statement

No competing financial interests exist.

References

Ananias

, Yano

. Serogroups and virulence genotypes of Escherichia coli isolated from patients with sepsis. Braz J Med Biol Res, 2008; 41:877–883.

Arné

, Marc

, Brée

, Schouler

, Dho-Moulin

. Increased tracheal colonization in chickens without impairing pathogenic properties of avian pathogenic Escherichia coli MT78 with a fimH deletion. Avian Dis, 2000; 44:343–355.

Barnes

, Nolan

, Vaillancourt

. Colibacillosis. Diseases of Poultry. Saif

. Oxford: Blackwell Publishing, 2008; 691–737.

Bielaszewska

, Zhang

, Mellmann

, Karch

. Enterohaemorrhagic Escherichia coli O26:H11/H-: a human pathogen in emergence. Berl Munch Tierarztl Wochenschr, 2007; 120:279–287.

Blanco

, Blanco

, Mora

, Jansen

, García

, Vázquez

, Blanco

. Serogroups of Escherichia coli isolated from septicaemic chickens in Galicia (northwest Spain) Vet Microbiol, 1998; 61:229–235.

Boerlin

, Travis

, Gyles

, Reid-Smith

, Janecko

, Lim

, Nicholson

, McEwen

, Friendship

, Archambault

. Antimicrobial resistance and virulence genes of Escherichia coli isolates from Swine in Ontario. Appl Environ Microbiol, 2005; 71:6753–6761.

Brooks

, Sowers

, Wells

, Greene

, Griffin

, Hoekstra

, Strockbine

. Non-O157 Shiga toxin-producing Escherichia coli infections in the United States, 1983–2002. J Infect Dis, 2005; 192:1422–1429.

Clermont

, Bonacorsi

, Bingen

. Rapid and simple determination of the Escherichia coli phylogenetic group. Appl Environ Microbiol, 2000; 66:4555–4558.

[CLSI] Clinical and Laboratory Standards Institute. Performance Standards for Antimicrobial Disk and Dilution Susceptibility Tests for Bacteria Isolated from Animals: Informational Supplement M31-S1. Wayne, PA: CLSI, 2004.

10.

[CLSI] Clinical and Laboratory Standards Institute. Performance Standards for Antimicrobial Susceptibility Testing: Eighteenth Informational Supplement M100-S18. Wayne, PA: CLSI, 2008.

11.

Dai

, Lu

, Wu

, Li

, Huang

, Wang

, Qi

, Shen

. Characterization of antimicrobial resistance among Escherichia coli isolates from chickens in China between 2001 and 2006. FEMS Microbiol Lett, 2008; 286:178–183.

12.

de Brito

, Gaziri

, Vidotto

. Virulence factors and clonal relationships among Escherichia coli strains isolated from broiler chickens with cellulitis. Infect Immun, 2003; 71:4175–4177.

13.

Delicato

, de Brito

, Gaziri

, Vidotto

. Virulence-associated genes in Escherichia coli isolates from poultry with colibacillosis. Vet Microbiol, 2003; 94:97–103.

14.

Dho-Moulin

, Fairbrother

. Avian pathogenic Escherichia coli (APEC) Vet Res, 1999; 30:299–316.

15.

Dissanayake

, Wijewardana

, Gunawardena

, Poxton

. Distribution of lipopolysaccharide core types among avian pathogenic Escherichia coli in relation to the major phylogenetic groups. Vet Microbiol, 2008; 132:355–363.

16.

Dozois

, Dho-Moulin

, Bree

, Fairbrother

, Desautels

, Curtiss

3rd . Relationship between the Tsh autotransporter and pathogenicity of avian Escherichia coli and localization and analysis of the Tsh genetic region. Infect Immun, 2000; 68:4145–4154.

17.

Ewers

, Janßen

, Kießling

, Philipp

, Wieler

. Molecular epidemiology of avian pathogenic Escherichia coli (APEC) isolated from colisepticemia in poultry. Vet Microbiol, 2004; 104:91–101.

18.

Ewers

, Li

, Wilking

, Kießling

, Alt

, Antáo

, Laturnus

, Diehl

, Glodde

, Homeier

, Böhnke

, Steinrück

, Philipp

, Wieler

. Avian pathogenic, uropathogenic, and newborn meningitis-causing Escherichia coli: how closely related are they? Int J Med Microbiol, 2007; 297:163–176.

19.

Fratamico

, Bagi

, Bush

, Solow

. Prevalence and Characterization of Shiga toxin-producing Escherichia coli in swine feces recovered in the National Animal Health Monitoring System's Swine 2000 Study. Appl Environ Microbiol, 2004; 70:7173–7178.

20.

Gannon

, Gyles

, Friendship

. Characteristics of verotoxigenic Escherichia coli from pigs. Can J Vet Res, 1988; 52:331–337.

21.

Garabal

, Gonzalez

, Vazquez

, Blanco

. Serogroups of Escherichia coli isolated from piglets in Spain. Vet Microbiol, 1996; 48:113–123.

22.

Ghanbarpour

, Salehi

, Oswald

. Virulence genotyping of Escherichia coli isolates from avian cellulitis in relation to phylogeny. Comp Clin Pathol, 2010; 19:147–153.

23.

Gyles

. Antimicrobial resistance in selected bacteria from poultry. Anim Health Res Rev, 2008; 9:149–158.

24.

Horcajada

, Soto

, Gajewski

, Smithson

, Jiménez de Anta

, Mensa

, Vila

, Johnson

. Quinolone-resistant uropathogenic Escherichia coli strains from phylogenetic group B2 have fewer virulence factors than their susceptible counterparts. J Clin Microbiol, 2005; 43:2962–2964.

25.

Janßen

, Schwarz

, Preikschat

, Voss

, Philipp

, Wieler

. Virulence-associated genes in avian pathogenic Escherichia coli (APEC) isolated from internal organs of poultry having died from colibacillosis. Int J Med Microbiol, 2001; 291:371–378.

26.

Jiang

, Lü

, Chen

, Wang

, Chen

, Liu

, Liao

, Liu

, Zeng

. High prevalence and widespread distribution of multi-resistant Escherichia coli isolates in pigs and poultry in China. Vet J, 2009, 10.1016/j.tvjl.2009.10.017.

27.

Jin

, Zheng

, Zhang

, Qin

, Shao

, Liu

, Wang

. Distribution of virulence-associated genes of avian pathogenic Escherichia coli isolates in China. Agric Sci China, 2008; 7:1511–1515.

28.

Johnson

, Stell

. Extended virulence genotypes of Escherichia coli strains from patients with urosepsis in relation to phylogeny and host compromise. J Infect Dis, 2000; 181:261–272.

29.

Johnson

, Kuskowski

, Owens

, Gajewski

, Winokur

. Phylogenetic origin and virulence genotype in relation to resistance to fluoroquinolones and/or extended-spectrum cephalosporins and cephamycins among Escherichia coli isolates from animals and humans. J Infect Dis, 2003; 188:759–768.

30.

Johnson

, Siek

, Johnson

, Nolan

. DNA sequence of a ColV plasmid and prevalence of selected plasmid-encoded virulence genes among avian Escherichia coli strains. J Bacteriol, 2006; 188:745–758.

31.

Kaper

, Nataro

, Mobley

. Pathogenic Escherichia coli. Nat Rev Microbiol, 2004; 2:123–140.

32.

Kariyawasam

, Scaccianoce

, Nolan

. Common and specific genomic sequences of avian and human extraintestinal pathogenic Escherichia coli as determined by genomic subtractive hybridization. BMC Microbiol, 2007; 7:81.

33.

La Ragione

, Woodward

. Virulence factors of Escherichia coli serotypes associated with avian colisepticaemia. Res Vet Sci, 2002; 73:27–35.

34.

Leung

, Yam

, Ng

, Peiris

. The prevalence and characterization of verotoxin-producing Escherichia coli isolated from cattle and pigs in an abattoir in Hong Kong. Epidemiol Infect, 2001; 126:173–179.

35.

Liu

, Wei

, Ma

, Zeng

, Lü

, Yang

, Chen

. Detection and characterisation of CTX-M and CMY-2 β-lactamases among Escherichia coli isolates from farm animals in Guangdong Province of China. Int J Antimicrob Agents, 2007; 29:576–581.

36.

Marc

, Arne

, Bree

, Dho-Moulin

. Colonization ability and pathogenic properties of a fim-mutant of an avian strain of Escherichia coli. Res Microbiol, 1998; 149:473–485.

37.

Miranda

, Guarddon

, Vazquez

, Fente

, Barros-Velazquez

, Cepeda

, Franco

. Antimicrobial resistance in enterobacteriaceae strains isolated from organic chicken, conventional chicken and conventional turkey meat: a comparative survey. Food Control, 2008; 19:412–416.

38.

Moniri

, Dastehgoli

. Antimicrobial resistance among Escherichia coli strains isolated from healthy and septicemic chickens. Pak J Biol Sci, 2007; 10:2984–2987.

39.

Monroy

, Knöbl

, Bottino

, Ferreira

. Virulence characteristics of Escherichia coli isolates obtained from broiler breeders with salpingitis. Comp Immun Microbiol Infect Dis, 2005; 28:1–15.

40.

Mora

, López

, Dabhi

, Blanco

, Alonso

, Herrera

, Mamani

, Bonacorsi

, Moulin-Schouleur

, Blanco

. Extraintestinal pathogenic Escherichia coli O1:K1:H7/NM from human and avian origin: detection of clonal groups B2 ST95 and D ST59 with different host distribution. BMC Microbiol, 2009; 9:132.

41.

Moreno

, Prats

, Sabaté

, Pérez

, Johnson

, Andreu

. Quinolone, fluoroquinolone and trimethoprim/sulfamethoxazole resistance in relation to virulence determinants and phylogenetic background among uro-pathogenic Escherichia coli. J Antimicrob Chemother, 2006; 57:204–211.

42.

Moulin-Schouleur

, Répérant

, Laurent

, Brée

, Mignon-Grasteau

, Germon

, Rasschaert

, Schouler

. Extraintestinal pathogenic Escherichia coli strains of avian and human origin: link between phylogene-tic relationships and common virulence patterns. J Clin Microbiol, 2007; 45:3366–3376.

43.

Moulin-Schouleur

, Schouler

, Tailliez

, Kao

, Brée

, Germon

, Oswald

, Mainil

, Blanco

. Common virulence factors and genetic relationships between O18: K1: H7 Escherichia coli isolates of human and avian origin. J Clin Microbiol, 2006; 44:3484–3492.

44.

Mulvey

, Lopez-Boado

, Wilson

, Roth

, Parks

, Heuser

, Hultgren

. Induction and evasion of host defenses by type-1 piliated uropathogenic Escherichia coli. Science, 1998; 282:1494–1497.

45.

Ngeleka

, Kwaga

, White

, Whittam

, Riddell

, Goodhope

, Potter

, Allan

. Escherichia coli cellulitis in broiler chickens: clonal relationships among strains and analysis of virulence-associated factors of isolates from diseased birds. Infect Immun, 1996; 64:3118–3126.

46.

Orskov

, Orskov

. The serology of capsular antigens. Curr Top Microbiol Immunol, 1990; 150:43–63.

47.

Peighambari

, Vaillancourt

, Wilson

, Gyles

. Characteristics of Escherichia coli isolates from avian cellulitis. Avian Dis, 1995; 39:116–124.

48.

Pourbakhsh

, Boulianne

, Martineau-Doizé

, Fairbrother

. Virulence mechanisms of avian fimbriated Escherichia coli in experimentally inoculated chickens. Vet Microbiol, 1997; 58:195–213.

49.

Rodriguez-Siek

, Giddings

, Doetkott

, Johnson

, Nolan

. Characterizing the APEC pathotype. Vet Res, 2005; 36:241–256.

50.

Russo

, Johnson

. Medical and economic impact of extraintestinal infections due to Escherichia coli: focus on an increasingly important endemic problem. Microbes Infect, 2003; 5:449–456.

51.

Sáenz

, Zarazaga

, Briñas

, Lantero

, Ruiz-Larrea

, Torres

. Antibiotic resistance in Escherichia coli isolates obtained from animals, foods and humans in Spain. Int J Antimicrob Agents, 2001; 18:353–358.

52.

Salehi

, Bonab

. Antibiotics susceptibility pattern of Escherichia coli strains isolated from chickens with colisepticemia in Tabriz Province. Iran Int J Poult Sci, 2006; 5:677–684.

53.

Song

, Ning

, Zhang

, Sheng

, Zhang

, Lin

, Wu

, Zhao

, Gao

, Feng

. Comparative research on serogroups distribution and antimicrobial resistance of Escherichia coli isolates from poultry in different areas of China. Agric Sci China, 2008; 7:381–386.

54.

Starčič Erjavec

, Rijavec

, Krizan-Hergouth

, Fruth

, Zgur-Bertok

. Chloramphenicol- and tetracycline-resistant uropathogenic Escherichia coli (UPEC) exhibit reduced virulence potential. Int J Antimicrob Agents, 2007; 30:436–442.

55.

Tenover

, Arbeit

, Goering

, Mickelsen

, Murray

, Persing

, Swaminathan

. Interpreting chromosomal DNA restriction patterns produced by pulsed-field gel electrophoresis: criteria for bacterial strain typing. J Clin Microbiol, 1995; 33:2233–2239.

56.

Tivendale

, Allen

, Ginns

, Crabb

, Browning

. Association of iss and iucA, but not tsh, with plasmid-mediated virulence of avian pathogenic Escherichia coli. Infect Immun, 2004; 72:6554–6560.

57.

Travis

, Gyles

, Reid-Smith

, Poppe

, McEwen

, Friendship

, Janecko

, Boerlin

. Chloramphenicol and kanamycin resistance among porcine Escherichia coli in Ontario. J Antimicrob Chemother, 2006; 58:173–177.

58.

Van den Bogaard

, London

, Driessen

, Stobberingh

. Antibiotic resistance of faecal Escherichia coli in poultry, poultry farmers and poultry slaughterers. J Antimicrob Chemother, 2001; 47:763–771.

59.

Varga

, Rajić

, McFall

, Reid-Smith

, Deckert

, Checkley

, McEwena

. Associations between reported on-farm antimicrobial use practices and observed antimicrobial resistance in generic fecal Escherichia coli isolated from Alberta finishing swine farms. Prev Vet Med, 2009; 88:185–192.

60.

Yang

, Chen

, White

, Zhao

, McDermott

, Walker

, Meng

. Characterization of multiple-antimicrobial-resistant Escherichia coli isolates from diseased chickens and swine in China. J Clin Microbiol, 2004; 42:3483–3489.

61.

Zhao

, Maurer

, Hubert

, De Villena

, McDermott

, Meng

, Ayers

, English

, White

. Antimicrobial susceptibility and molecular characterization of avian pathogenic Escherichia coli isolates. Vet Microbiol, 2005; 107:215–224.