Detection by Multiplex Real-Time Polymerase Chain Reaction Assays and Isolation of Shiga Toxin–Producing Escherichia coli Serogroups O26,O45,O103,O111,O121,and O145 in Ground Beef

Abstract

Six Shiga toxin–producing Escherichia coli (STEC) serogroups, which include O26, O45, O103, O111, O121, and O145, are responsible for the majority of non–O157 STEC infections in the United States, representing a growing public health concern. Cattle and other ruminants are reservoirs for these pathogens; thus, food of bovine origin may be a vehicle for infection with non–O157 STEC. Methods for detection of these pathogens in animal reservoirs and in food are needed to determine their prevalence and to develop intervention strategies. This study describes a method for detection of non–O157 STEC in ground beef, consisting of enrichment in modified tryptic soy broth at 42°C, followed by real-time multiplex polymerase chain reaction (PCR) assays targeting stx ₁, stx ₂, and eae genes and the wzx gene in the O-antigen gene clusters of the six serogroups, and then immunomagnetic separation (IMS) followed by plating onto Rainbow^® Agar O157 and PCR assays for confirmation of isolates. All ground beef samples artificially inoculated with 1–2 and 10–20 CFU/25 g of ground beef consistently gave positive results for all of the target genes, including the internal amplification control using the multiplex real-time PCR assays after enrichment in modified tryptic soy broth for a total of 24 h (6 h at 37°C and 18 h at 42°C). The detection limit of the real-time multiplex PCR assays was ∼50 CFU per PCR. IMS for O26, O103, O111, and O145 was performed with commercially available magnetic beads, and the IMS beads for O45 and O121 were prepared using polyclonal antiserum against these serogroups. A large percentage of the presumptive colonies of each serogroup picked from Rainbow Agar O157 were confirmed as the respective serogroups; however, the percent recovery of STEC O111 was somewhat lower than that of the other serogroups. This work provides a method for detection and isolation in ground beef and potentially other foods of non–O157 STEC of major public health concern.

Introduction

S higa toxin–producing Escherichia coli (STEC), also known as verocytotoxin-producing E. coli, are important foodborne pathogens responsible for outbreaks of hemorrhagic colitis (HC) and hemolytic uremic syndrome (HUS). STEC that cause HC and HUS are also referred to as enterohemorrhagic E. coli (Gyles, 2007). E. coli O157:H7 is the most commonly recognized STEC in the United States; however, many other STEC serogroups have been isolated from animals and food and have caused human illness. A number of these serogroups, including STEC O26, O103, O111, and O145, have been associated with outbreaks and sporadic cases of HC and HUS worldwide (Paton et al., 1996; Hiruta et al., 2001; Hoshina et al., 2001; McCarthy et al., 2001; McMaster et al., 2001; Werber et al., 2002; Misselwitz et al., 2003; Brooks et al., 2004; Ethelberg et al., 2007; Gyles, 2007). Cattle are the most important reservoir for E. coli O157:H7 and other STEC strains, and food of bovine origin or food or water contaminated with bovine feces has been linked to HC and HUS (Smith and Fratamico, 2005; Hussein, 2007). In 1994, the Food Safety and Inspection Service, U.S. Department of Agriculture, declared E. coli O157:H7 an adulterant in beef products and began a verification sampling program to test for the pathogen in samples collected from federally inspected establishments and retail stores. These efforts have proven to be effective in reducing the risk of infection with E. coli O157:H7.

STEC possess a number of virulence factors, and the production of Shiga toxins (Stx1 and/or Stx2) is the most critical. STEC also possess a pathogenicity island called the locus of enterocyte effacement, which encodes for proteins necessary for the formation of attaching and effacing lesions, including intimin (Eae), an outer membrane protein, a translocated intimin receptor (Tir), a type III secretion apparatus, and effector proteins translocated by the secretion system. Non–O157 STEC strains that carry both the stx ₂ and the eae genes were more often associated with severe disease, including HUS, independent of serogroup, and the importance of stx ₂ and eae was also demonstrated using an infant rabbit animal model (Boerlin et al., 1999; Ritchie et al., 2003; Werber et al., 2003). Several other candidate pathogenicity islands, including OI (O-island)-57, OI-71, and OI-122 found in STEC correlated independently with outbreak and HUS potential of non–O157 STEC (Coombes et al., 2008). However, the role of virulence genes carried on these pathogenicity islands in disease is not fully clear. STEC also carry genes for a hemolysin encoded in the hly operon found on the virulence plasmid, and for various adhesins and cytotoxins, which may also contribute to virulence (Gyles, 2007).

Twenty percent to 70% of STEC infections throughout the world are due to non–O157 STEC (WHO, 1998). In 2000, CDC's FoodNet surveillance program began collecting data on non–O157 STEC, and the Council of State and Territorial Epidemiologists recommended that non–O157 STEC that cause human illness become reportable to the Nationally Notifiable Diseases Surveillance System. Consequently, reporting of non–O157 STEC by public health departments has increased. A review of the records for non–O157 STEC isolates forwarded by state public health laboratories to the CDC's reference laboratory between 1983 and 2002 for confirmation and serotyping showed that six serogroups, O26, O45, O111, O103, O121, O45, and O145, of the 61 serogroups identified accounted for 71% of the isolates recovered (Brooks et al., 2005).

Determining the true incidence of disease caused by non–O157 STEC is problematic since it is important to detect the presence of the Shiga toxins or the stx genes and other virulence genes, and then it is necessary to isolate the strain and determine the serotype. Unlike E. coli O157:H7, most non–O157 STEC cannot be easily distinguished from nonpathogenic strains using commercially available selective and differential media. A plating medium consisting of washed sheep's blood agar containing mitomycin C enhanced the ability to detect enterohemolysin-producing O157:H7 and non–O157 STEC strains (Sugiyama et al., 2001); however, STEC strains that do not produce the hemolysin will not be detected. Therefore, there is a need for methods for detection, identification, and isolation of important non–O157 STEC serogroups to determine the true incidence of human infections caused by these pathogens and their prevalence in food.

The objective of this study was to develop a method for detection and isolation of the top six non–O157 STEC serogroups: O26, O45, O103, O111, O121, and O145. The method described in this report involves screening enrichments using multiplex polymerase chain reaction (PCR) assays targeting virulence genes and the wzx gene in the O-antigen gene clusters of the six serogroups followed by immunomagnetic separation (IMS), plating onto selective/differential agar, and PCR assays for confirmation of isolates.

Materials and Methods

Bacteria

E. coli strains used in this study and their sources are listed in Table 1. A total of 29 STEC belonging to serogroups O26, O45, O103, O111, O121, and O145 were used for artificial inoculation of ground beef samples. The bacteria were stored at −70°C in tryptic soy broth (TSB; Becton Dickinson and Company) with 10% glycerol (Sigma-Aldrich Corp.). Working cultures were made by inoculating from the frozen stocks into TSB and incubating for 19 h at 37°C.

Table 1.

Serotype and Virulence Profiles of Shiga Toxin–Producing Escherichia coli Strains Used for Artificial Inoculation of Ground Beef

Strain	Serotype	Source	stx₁	stx₂	eae
SJ1	O26:H11	CDC^a	+	−	+
SJ2	O26:H11	CDC	+	+	+
SJ3	O26:H11	CDC	−	+	+
00971	O26:H11	FDA^b	+	−	+
05-6544	O26:H11	PHAC^c	+	−	+
SJ7	O45:H2	CDC	+	−	+
SJ8	O45:H2	CDC	+	−	+
SJ9	O45:H2	CDC	+	+	+
05-6545	O45:H2	PHAC	+	−	+
SJ10	O103:H2	CDC	+	−	+
SJ11	O103:H25	CDC	+	−	+
SJ12	O103:H11	CDC	+	+	+
04162	O103:H6	FDA	+	−	+
04-3973	O103:H11	PHAC	+	−	+
00-4748	O111:NM	PHAC	+	+	+
98-8338	O111:NM	PHAC	+	−	+
01387	O111:H8	FDA	+	−	+
SJ13	O111:NM	CDC	+	+	+
SJ14	O111:H8	CDC	+	+	+
SJ15	O111:NM	CDC	+	−	+
SJ16	O121:H19	CDC	−	+	+
08023	O121:H19	FDA	−	+	+
SJ18	O121:H19	CDC	+	+	+
03-2832	O121:H19	PHAC	−	+	+
SJ23	O145:NM	CDC	+	+	+
SJ24	O145:NM	CDC	−	+	+
SJ25	O145:H25	CDC	−	+	+
07865	O145:H18	FDA	−	+	+
03-4699	O145:NM	PHAC	+	−	+

CDC, Centers for Disease Control and Prevention, Atlanta, GA.

FDA, Food and Drug Administration, Center for Food Safety and Applied Nutrition, College Park, MD.

PHAC, Public Health Agency of Canada, Winnipeg, Manitoba, Canada.

Inoculation and enrichment of ground beef samples

Ground beef (15% fat) obtained from local markets was used on the day of purchase. Overnight cultures were diluted in 0.1% peptone (Becton Dickinson), and 25 g of the ground beef samples were inoculated with 2 mL of diluted cultures, resulting in 1–2 and 10–20 CFU/25g. The diluted cultures were plated onto tryptic soy agar (TSA; Becton Dickinson) and incubated at 37°C for 18 h, and then colonies were enumerated. The medium used for enrichment was modified TSB (mTSB) as described by Possé et al. (2008a) with modifications. Briefly, 25-g portions of the ground beef were placed into filter Stomacher bags (VWR), and 225 mL of TSB containing 10 mg/L of cefsulodin and 16 mg/L of vancomycin (Sigma-Aldrich Corp.) were added followed by pummeling for 1 min using a Stomacher lab blender (Cooke Laboratory Products). The samples were incubated static for 6 h at 37°C. After this 6-h pre-enrichment step, bile salts (1.5 g/L; Difco Laboratories), rifampicin (2.0 mg/L), and potassium tellurite (1.0 mg/L; Sigma-Aldrich) were added, and incubation was continued for 18 h at 42°C. As a negative control, an uninoculated ground beef sample was also subjected to enrichment. Aerobic plate counts of uninoculated ground beef samples were determined by preparing dilutions in 0.1% peptone and plating onto TSA. After incubation for 18 h at 37°C, the colonies were enumerated.

DNA extraction

One milliliter of the enrichments was transferred to a microcentrifuge tube, and the cells were harvested by centrifugation at 16,000 g for 3 min. The supernatant was removed, and the pellet was resuspended in 200 μL of the PrepMan Ultra reagent (Applied Biosystems). The tubes were heated in a boiling water bath for 10 min, cooled to room temperature, and then centrifuged for 3 min at 16,000 g. The supernatant, which was used as template for the real-time multiplex PCR assays, was transferred to a sterile microcentrifuge tube or was stored at −20°C when not used immediately.

Real-time multiplex PCR assays

Omnimix™ reagent beads (Fisher Scientific) were rehydrated as recommended by the manufacturer, and per 25 μL reaction consisted of 1.5 U TaKaRa hot start Taq polymerase, 200 μM dNTP, 4 mM MgCl₂, and 25 mM HEPES, pH 8.0. One microliter of template DNA was used per reaction. The sequences of the primers and probes and the dyes used for the TaqMan probes, the concentrations of each primer and probe (Integrated DNA Technologies, Inc.) used in the multiplex PCR assays, and the expected sizes of the PCR products are shown in Table 2.

Table 2.

Oligonucleotide Primers and Probes Used in the Real-Time Polymerase Chain Reaction Assays

Primers and probes	Sequence (5′–3′)	Concentration (μM)	Target gene	Product size (bp)
stx1-150-F	GACTGCAAAGACGTATGTAGATTCG	0.25	stx ₁	150
stx1-150-R	ATCTATCCCTCTGACATCAACTGC	0.25
stx1-150-P	Texas Red-TGAATGTCATTCGCTCTGCAATAGGTACTC-Iowa Black	0.1875
stx2-200-F	ATTAACCACACCCCACCG	0.25	stx ₂	200
stx2-200-R	GTCATGGAAACCGTTGTCAC	0.25
stx2-200-P	Texas Red-CAGTTATTTTGCTGTGGATATACGAGGGCTTG-Iowa Black	0.1875
Eae170-F	CTTTGACGGTAGTTCACTGGAC	0.25	eae	170
Eae170-R	CAATGAAGACGTTATAGCCCAAC	0.25
Eae170-P	FAM-CTGGCATTTGGTCAGGTCGGGGCG-BHQ1	0.1875
Wzx158-O26-F	GTATCGCTGAAATTAGAAGCGC	0.25	O26 wzx	158
Wzx158-O26-R	AGTTGAAACACCCGTAATGGC	0.25
Wzx158-O26-P	FAM-TGGTTCGGTTGGATTGTCCATAAGAGGG-BHQ1	0.20
Wzx237-O111-F	TGTTCCAGGTGGTAGGATTCG	0.25	O111 wzx	237
Wzx237-O111-R	TCACGATGTTGATCATCTGGG	0.25
Wzx237-O111-P	Texas Red-TGAAGGCGAGGCAACACATTATATAGTGC-Iowa Black	0.20
Wzx72-O45-F	CGTTGTGCATGGTGGCAT	0.25	O45 wzx	72
Wzx72-O45-R	TGGCCAAACCAACTATGAACTG	0.25
Wzx72-O45-P	FAM-ATTTTTTGCTGCAAGTGGGCTGTCCA-BHQ1	0.1875
Wzx189-O121-F	AGGCGCTGTTTGGTCTCTTAGA	0.25	O121 wzx	189
Wzx189-O121-R	GAACCGAAATGATGGGTGCT	0.25
Wzx189-O121-P	Texas Red-CGCTATCATGGCGGGACAATGACAGTGC-Iowa Black	0.1875
Wzx191-O103-F	TTGGAGCGTTAACTGGACCT	0.25	O103 wzx	191
Wzx191-O103-R	ATATTCGCTATATCTTCTTGCGGC	0.25
Wzx191-O103-P	Texas Red-AGGCTTATCTGGCTGTTCTTACTACGGC-Iowa Black	0.20
Wzx135-O145-F	AAACTGGGATTGGACGTGG	0.25	O145 wzx	135
Wzx135-O145-R	CCCAAAACTTCTAGGCCCG	0.25
Wzx135-O145P	FAM-GCTAATTGCAGCCCTTGCACTACGAGGC-BHQ1	0.10
IC-F	GCAGCCACTGGTAACAGGAT	0.25	pUC19	118
IC-R	GCAGAGCGCAGATACCAAAT	0.25	pMB1 rep
IC-P	Cy5-AGAGCGAGGTATGTAGGCGG-BHQ2	0.20
16SrRNA IC-F	CCTCTTGCCATCGGATGTG	0.10	16S rRNA	99
16SrRNA IC-R	GGCTGGTCATCCTCTCAGACC	0.10
16SrRNA IC-P	Cy5-GTGGGGTAACGGCTCACCTAGGCGAC-BHQ2	0.0313

Two internal controls were evaluated in the multiplex PCR assays. The first targeted the 16S rRNA gene of gamma-proteobacteria, yielding a 99-bp PCR product (Fratamico et al., 2009a). The concentration of the 16S rRNA primers and Cy5-labeled probe used in the PCR are shown in Table 2. The second internal control that was evaluated consisted of linearized pUC19 (New England Biolabs), and the sequences of the primers and probe targeting pMB1 rep gene (118-bp product) and the concentrations used are shown in Table 2. pUC19 was linearized by digestion with EcoRI (37°C for 2 h) and extracted from an agarose gel using the QIAquick Gel Extraction Kit (Qiagen) according to the manufacturer's instructions. The DNA, eluted using Buffer EB, was diluted in TE buffer, pH 8.0, to a concentration of 10⁴ copies per microliter. One microliter was used in the multiplex PCR assays.

The four multiplex PCR assays used were (1) primers and probes targeting the stx ₁ , stx ₂, and eae genes and the internal control; (2) the E. coli O26 and O111 wzx genes and the internal control; (3) the E. coli O103 and O145 wzx genes and the internal control; and (4) the E. coli O121 and O45 wzx genes and the internal control. The multiplex PCR assays were performed using a SmartCycler (Cepheid), and the cycling conditions for all of the multiplex PCR assays consisted of an initial DNA denaturation step at 94°C for 2 min followed by 40 cycles of 94°C for 20 sec, 60°C for 30 sec, and 72°C for 50 sec.

Sensitivity of the multiplex PCR assays

The sensitivity of the PCR assays was determined for E. coli serogroups O26, O45, O103, O111, O121, and O145. Ten-fold serial dilutions of overnight cultures were made in 0.1% peptone, and dilutions (100 μL) were added to 900-μL aliquots of uninoculated control enrichments to obtain samples containing 10⁷ to 10¹ CFU/mL. Only one strain of each serogroup was inoculated to determine sensitivity, and the concentration of the bacteria was verified by plating onto TSA. DNA extraction and the multiplex PCR assays were performed as described above.

Preparation of magnetic beads for IMS of E. coli O45 and E. coli O121

Magnetic beads for IMS of E. coli O45 and E. coli O121 are not commercially available; therefore, these were prepared using polyclonal anti-O45 and anti-O121 antisera. The typing sera were kindly provided by Dr. Chitrita DebRoy at the E. coli Reference Center at the Pennsylvania State University. IgG was purified from the rabbit antiserum using Protein G Plus Agarose (Cat. No. 22851; Thermo Fisher Scientific) based on the method published by Medina (2006). The IgG was then biotinylated using the EZ-Link Maleimide-PEO Solid Phase Biotinylation Kit (Cat. No. 21930; Thermo Fisher Scientific) according to the manufacturer's instructions. After determining the protein concentration of the biotinylated anti-O45 and anti-O121 antisera using the Bio-Rad Protein Assay (Bio-Rad), Dynabeads M-280 Streptavidin (Invitrogen; Cat. No. 112.05D) were coated with the biotinylated antibodies according to the manufacturer's instructions. The beads were stored at 4°C.

IMS and plating onto Rainbow^® Agar O157

E. coli O26, O45, O103, O111, O121, and O145 strains were recovered from enrichments of artificially inoculated ground beef samples by IMS. Twenty microliters of Dynabeads EPEC/VTEC O26, O103, O111, O145 (Invitrogen), or Dynabeads M-280 streptavidin with biotinylated E. coli O45 and E. coli O121 antibodies were mixed with 1 mL of the enrichments in a 1.5 mL microcentrifuge tube. The tubes were placed on a rotator for 10 min, before collecting the beads using a Dynal magnetic particle concentrator, and then the supernatant was removed. The beads were washed three times using 1 mL of phosphate-buffered saline containing 0.05% Tween 20 (PBS-T; Sigma-Aldrich), and then were resuspended in 100 μL PBS-T. As recommended by the manufacturer, a sterile swab was used to streak the Dynabeads onto Rainbow Agar O157 (Biolog, Inc.), and the plates were incubated at 37°C for 24 h. Colonies for confirmation by the PCR assays were picked from Rainbow Agar O157 plates based on the typical color of the colonies of the different serogroups (Table 3).

Table 3.

Isolation of Non–O157 Shiga Toxin–Producing Escherichia coli on Rainbow Agar O157

		No. of colonies confirmed as correct serogroup/no. of colonies picked (%)
E. coli serogroup	Colony color on Rainbow Agar O157	Immunomagnetic separation	Plated without immunomagnetic separation
O26	Purple	15/21 (71%)	7/12 (58%)
O45	Gray-purple, purple, light magenta	23/27 (85%)	14/22 (68%)
O103	Gray, purple, blue-purple	18/20 (90%)	10/12 (83%)
O111	Gray-blue, gray	8/44 (18%)	8/27 (30%)
O121	Magenta, purple	22/27 (81%)	12/24 (50%)
O145	Gray-purple, blue-purple	17/20 (85%)	9/10 (90%)

Confirmation of presumptive isolates

One to five presumptive E. coli O26, O45, O103, O111, O121, or O145 colonies were picked from each Rainbow Agar O157 plate, and the colonies were resuspended in 100 μL of sterile water and lysed by heating at 99°C for 10 min. The multiplex PCR assays targeting the stx ₁ , stx ₂, and eae genes and the O-serogroup-specific wzx genes were performed using 1 μL of the lysates as described above to confirm the identity of the colonies.

Results and Discussion

Detection and isolation of STEC other than serogroup O157 from food and other types of samples is problematic due to the lack of differential phenotypic characteristics from nonpathogenic E. coli. The development of molecular reagents capable of identifying both virulence genes and serogroup-specific genetic determinants holds promise for a more comprehensive characterization of food samples to determine the prevalence of specific non–O157 STEC in food and to establish the incidence of human infections caused by these emerging pathogens. Six non–O157 STEC serogroups (O26, O45, O103, O111, O121, and O145) are responsible for the majority of non–O157 STEC infections in the United States, and outbreaks caused by these pathogens have been linked to a variety of foods, drinking and recreational water, and animal contact (Brooks et al., 2005). Similar to STEC O157:H7, cattle are an important reservoir for non–O157 STEC, and beef products and food potentially contaminated with animal feces have been associated with human illness (Smith and Fratamico, 2005; CDC Outbreak Surveillance Data, www.cdc.gov/foodborneoutbreaks/outbreak_data.htm).

The stx ₁, stx ₂, and eae genes are important STEC virulence markers, and PCR assays for detection of E. coli O157:H7 and non–O157 STEC have targeted these and other virulence genes (Fratamico et al., 2000; Paton and Paton, 2002; Fratamico and DebRoy, 2010). Further, multiplex PCR assays targeting STEC virulence genes and genes in the O-antigen gene clusters of STEC serogroups have also been described (Fratamico et al., 2003; DebRoy et al., 2004; Perelle et al., 2004; Fratamico et al., 2005; Monday et al., 2007; Fratamico et al., 2009b). In the current study, an approach was designed to detect the top six non–O157 STEC serogroups (O26, O45, O103, O111, O121, and O145), which involved (1) enrichment in mTSB; (2) DNA extraction followed by multiplex PCR assays targeting the stx ₁, stx ₂, and eae genes; (3) multiplex PCR assays targeting the wzx genes in the O-antigen gene clusters of the six serogroups; (4) IMS; (5) plating onto Rainbow Agar O157; and (6) confirmation of presumptive positive colonies using the multiplex PCR assays.

Enrichment of ground beef samples

E. coli O26, O45, O103, O111, O121, and O145 strains (Table 1) inoculated into 25-g samples of ground beef were subjected to enrichment in the mTSB medium described by Possé et al. (2008a). When multiplex PCR assays were performed as described below, E. coli O111 did not generate a fluorescence signal, or the signal was very weak. It was ascertained that novobiocin (8 mg/L) in the mTSB medium slowed the growth of STEC O111 strains. The level of STEC O111 strains was ∼2–3 log₁₀ CFU/mL lower when grown in mTSB that contained novobiocin as one of the selective agents compared to growth in TSB (data not shown). Therefore, novobiocin was not added, and instead cefsulodin at 10 mg/L was included in the mTSB. Vimont et al. (2007) also reported that non–O157 STEC strains were inhibited to a larger extent than E. coli O157:H7 strains in the presence of novobiocin in the enrichment medium. They indicated that addition of novobiocin at 20 mg/L could lead to false negative results when testing for non–O157 STEC in food. Cefsulodin inhibits the growth of Aeromonas and some Pseudomonas species, and it is frequently used in enrichment media for detection of E. coli (Weagant et al., 1995; Kannan et al., 2010). The presence of the other selective agents did not inhibit the growth of the non–O157 STEC serogroups as was shown by inoculation of 25 g of sterile ground beef with the STEC strains in mTSB and TSB (data not shown). The aerobic plate counts in the ground beef samples used for artificial inoculation were determined by plating an uninoculated sample before enrichment and were between 10⁵ and 10⁶ CFU/g.

Real-time multiplex PCR assays

The strategy for detection of the six non–O157 STEC serogroups in ground beef was to use multiplex real-time PCR assays targeting stx ₁, stx ₂, and eae to test enrichments as a rapid screen to quickly rule out negative samples. Samples that are positive for the stx ₁ and/or stx ₂ and the eae genes are then subjected to the serogroup-specific multiplex real-time PCR assays targeting the wzx genes in the O-antigen gene clusters of the six serogroups. Three multiplex PCR assays are performed with each targeting the wzx genes of two serogroups (O26 and O111; O103 and O145; and O121 and O45). Enrichments (stx ₁/stx ₂- and eae-positive) that are positive for one of the serogroups are then subjected to IMS and plating as described below. All of the assays were designed to have the same amplification conditions. All samples inoculated with 1–2 and 10–20 CFU/25 g of ground beef consistently gave positive results using the multiplex real-time PCR assays after enrichment in mTSB. Two internal amplification controls were evaluated with each assay. The first consisted of the use of primers and probe targeting the 16 rRNA gene of gamma proteobacteria (99-bp product) (Fratamico et al., 2009a). The other internal system evaluated employed linearized pUC19 and primers and probe targeting the pMB1 rep gene carried on the plasmid (118-bp product). Both internal controls worked equally well generating a signal in the Cy5 channel of the SmartCycler. The detection limit of the PCR assays was determined by adding dilutions of the non–O157 STEC strains to aliquots of uninoculated ground beef enrichments and performing the multiplex real-time PCR assays after DNA extraction. A signal from each of the PCR products, including the internal control, was obtained consistently with samples that had been inoculated with 10⁴ CFU/mL of enrichment; therefore, the detection limit per PCR was ∼50 CFU. Since the cell pellet from 1 mL of enrichment was processed in 200 μL of the PrepMan Ultra reagent, this resulted in fivefold concentration, and 1 μL was used for the PCR assays; therefore, the detection limit was calculated to be ∼50 CFU per PCR. These results are similar to those of Amoako et al. (2010), who reported a detection limit of 13–220 CFU in pure cultures of Y. pestis and 10²–10⁵ CFU/g in ground beef (without pre-enrichment). Perelle et al. (2007) used a PCR-ELISA targeting the stx ₁ and stx ₂ genes to screen food samples enriched in modified EC medium with novobiocin. This was followed by a multiplex real-time PCR assay targeting O-antigen-specific genes of E. coli serogroups O26, O103, O111, O145, and O157. Finally, singleplex PCR assays were performed to identify the E. coli serogroup. A method for isolation of the STEC strain and the confirmation protocol were not described. Twenty-one percent and 15% of raw milk (n = 205) and meat samples (n = 300), respectively, were positive by the PCR-ELISA; however, the authors commented that isolation of the STEC strain from the food samples is important to confirm the presence of the pathogen.

IMS and isolation of non–O157 STEC

Enrichments were subjected to IMS, and then the beads were plated onto Rainbow Agar O157. By and large, it was not difficult to identify and confirm the target STEC serogroups, based on the color of the colony (Table 3). When testing naturally contaminated samples, plating would be performed on enrichments in which the serogroup of the contaminating STEC would have been identified by the O-group-specific PCR assay; therefore, isolation of the STEC strain should not be problematic. Other agars, including ChromAgar O157 (Durso and Keen, 2007) and washed sheep blood agar (Sugiyama et al., 2001), have also been evaluated for isolation of STEC, and further studies will also investigate the suitability of these selective/differential agars. For comparison, enrichments from some experiments were plated directly onto Rainbow Agar without IMS. Generally, there was much higher background when plating enrichments without performing IMS, and it was more difficult to identify the presumptive non–O157 STEC colonies. However, it was possible to select the target STECs from plates that were not subjected to IMS. For example, 23 out of 27 (85%) colonies picked from Rainbow Agar plates after IMS from samples inoculated with O45 were confirmed, whereas 14 out of 22 (68%) colonies were positive from samples plated without IMS (Table 3). One reason to explain why it was possible to isolate the non–O157 STECs without IMS is that incubation in mTSB at 42°C is sufficiently selective to suppress the growth of some of the background flora. Confirmation of presumptive positive colonies was performed by using the same real-time multiplex PCR assays that were used for screening enrichments.

Isolation of E. coli O111 from mTSB enrichments after IMS was somewhat more problematic than the other serogroups. Out of 44 presumptive colonies from samples that were subjected to IMS, 8 (18%) were confirmed by the PCR assays. It is possible that the antibody used with the commercial Dynabeads EPEC⁄VTEC O111 has low affinity for E. coli serogroup O111. Our results agree with those of Verstraete et al. (2010), who reported that the percent recovery of STEC O111 in contaminated fecal samples after IMS performed with Dynabeads EPEC⁄VTEC O111 was low, whereas there was a greater ability to isolate STEC O26, O103, and O157. These investigators also suggested that the affinity of the O111 antibodies coating the beads may be low; however, they used the medium described by Possé et al. (2008b) containing novobiocin for enrichment, which may also have prevented optimal growth of STEC O111. Further, they also found that under certain conditions, significant differences in the isolation rate from fecal enrichments that were plated directly compared to those subjected to IMS before plating were not observed with non–O157 STEC. Current investigations are examining the ability of our non-O157 detection protocol to detect and isolate the non–O157 STEC serogroups from naturally contaminated ground beef and other types of food.

Footnotes

Acknowledgments

The technical assistance of Brad Garman is gratefully acknowledged.

Disclaimer

Mention of trade names or commercial products is solely for the purpose of providing specific information and does not imply recommendation or endorsement by the U.S. Department of Agriculture.

Disclosure Statement

No competing financial interests exist.

References

Amoako

, Goji

, MacMillan

, Said

, Druhan

, Tanaka

, Thomas

. Development of multi-target real-time PCR for the rapid, specific, and sensitive detection of Yersinia pestis in milk and ground beef. J Food Prot, 2010; 73:18–25.

Boerlin

, McEwen

, Boerlin-Petzold

, Wilson

, Johnson

, Gyles

. Associations between virulence factors of Shiga toxin-producing Escherichia coli and disease in humans. J Clin Microbiol, 1999; 37:497–503.

Brooks

, Bergmire-Sweat

, Kennedy

, Hendricks

, Garcia

, Marengo

, Wells

, Ying

, Bibb

, Griffin

, Hoekstra

, Friedman

. Outbreak of Shiga toxin-producing Escherichia coli O111:H8 infections among attendees of a high school cheerleading camp. Clin Infect Dis, 2004; 38:190–198.

Brooks

, Sowers

, Wells

, Greene

, Griffin

, Hoekstra

, Strockbine

. Non-O157 Shiga toxin–producing Escherichia coli infections in the United States, 1983–2002. J Infect Dis, 2005; 192:1422–1429.

Coombes

, Wickham

, Mascarenhas

, Gruenheid

, Finlay

, Karmali

. Molecular analysis as an aid to assess the public health risk of non-O157 Shiga toxin-producing Escherichia coli strains. Appl Environ Microbiol, 2008; 74:2153–2160.

DebRoy

, Roberts

, Kundrat

, Davis

, Briggs

, Fratamico

. Detection of Escherichia coli serotypes O26 and O113 by amplification of the wzx and wzy genes. Appl Environ Microbiol, 2004; 70:1830–1832.

Durso

, Keen

. Shiga-toxigenic Escherichia coli O157 and non-Shiga-toxigenic E. coli O157 respond differently to culture and isolation from naturally-contaminated bovine faeces. J Appl Microbiol, 2007; 103:2457–2464.

Ethelberg

, Smith

, Torpdahl

, Lisby

, Boel

, Jensen

, Mølbak

. An outbreak of Verocytotoxin-producing Escherichia coli O26:H11 caused by beef sausage, Denmark 2007. Euro Surveill, 2007; 12:E070531.4.

Fratamico

, DebRoy

. Detection of Escherichia coli O157:H7 in food using real-time multiplex PCR assays targeting the stx₁, stx₂, wzy_O157, and the fliC_h7 or eae genes. Food Anal Methods, 2010; 3:330–337.

10.

Fratamico

, Bagi

, Pepe

. A multiplex PCR for rapid detection and identification of Escherichia coli O157:H7 in foods and bovine feces. J Food Prot, 2000; 63:1032–1037.

11.

Fratamico

, Briggs

, Needle

, Chen

C-Y

, DebRoy

. Sequence of the Escherichia coli O121 O-antigen gene cluster and detection of enterohemorrhagic E. coli O121 by PCR amplification of the wzx and wzy genes. J Clin Microbiol, 2003; 41:3379–3383.

12.

Fratamico

, DebRoy

, Liu

. The DNA sequence of the Escherichia coli O22 O-antigen gene cluster and detection of pathogenic strains belonging to E. coli serogroups O22 and O91 by multiplex PCR assays targeting virulence genes and genes in the respective O-antigen gene clusters. Food Anal Methods, 2009a. 2:169–179.

13.

Fratamico

, DebRoy

, Miyamoto

, Liu

. Detection of enterohemorrhagic Escherichia coli O145 in food by PCR targeting genes in the E. coli O145 O antigen gene cluster and the Shiga toxin 1 and Shiga toxin 2 genes. Foodborne Pathog Dis, 2009b. 6:605–611.

14.

Fratamico

, Briggs

, DebRoy

, Strobaugh

, Chen

. DNA sequence of the Escherichia coli O103 O antigen gene cluster and detection of enterohemorrhagic E. coli O103 by PCR amplification of the wzx and wzy genes. Can J Microbiol, 2005; 51:515–522.

15.

Gyles

. Shiga toxin-producing Escherichia coli: an overview. J Anim Sci, 2007; 85,E Suppl:E45–E62.

16.

Hiruta

, Murase

, Okamura

. An outbreak of diarrhea due to multiple antimicrobial-resistant Shiga toxin-producing Escherichia coli O26:H11 in a nursery. Epidmiol Infect, 2001; 127:221–227.

17.

Hoshina

, Itagaki

, Seki

, Yamamoto

, Masuda

, Muku

, Okada

. Enterohemorrhagic Escherichia coli O26 outbreak caused by contaminated natural water supplied by facility owned by local community. Jpn J Infect Dis, 2001; 54:247–248.

18.

Hussein

. Prevalence and pathogenicity of Shiga toxin-producing Escherichia coli in beef cattle and their products. J Anim Sci, 2007; 85:E63–E72.

19.

Kannan

, Yong

, Reiman

, Cleaver

, Patel

, Bhagwat

. Bacteriophage-based rapid and sensitive detection of Escherichia coli O157:H7 isolates from ground beef. Foodborne Pathog Dis, 2010; 7:1551–1558.

20.

McCarthy

, Barrett

, Hadler

, Salsbury

, Howard

, Dingman

, Brinkman

, Bibb

, Carter

. Hemolytic-uremic syndrome and Escherichia coli O121 at a lake in Connecticut, 1999. Pediatrics, 2001; 108:E59.

21.

McMaster

, Roch

, Willshaw

, Doherty

, Kinnear

, Cheasty

. Verocytotoxin-producing Escherichia coli serotype O26:H11 outbreak in an Irish crèche. Eur J Clin Microbiol Infect Dis, 2001; 20:430–432.

22.

Medina

. A biosensor method for detection of staphylococcal enterotoxin A (SEA) in raw whole egg. J Rapid Meth Autom Microbiol, 2006; 14:119–132.

23.

Misselwitz

, Karch

, Bielazewska

, John

, Ringelmann

, Rönnefarth

, Patzer

. Cluster of hemolytic-uremic syndrome caused by Shiga toxin-producing Escherichia coli O26:H11. Pediatr Infect Dis J, 2003; 22:349–354.

24.

Monday

, Beisaw

, Feng

. Identification of Shiga toxigenic Escherichia coli seropathotypes A and B by multiplex PCR. Mol Cell Probes, 2007; 21:308–311.

25.

Paton

, Paton

. Direct detection and characterization of Shiga toxigenic Escherichia coli by multiplex PCR for stx₁, stx₂, eae, ehxA, and saa. J Clin Microbiol, 2002; 40:271–274.

26.

Paton

, Ratcliff

, Doyle

, Seymour-Murray

, Davos

, Lanser

, Paton

. Molecular microbiological investigation of an outbreak of hemolytic-uremic syndrome caused by dry fermented sausage contaminated with Shiga-like toxin-producing Escherichia coli. J Clin Microbiol, 1996; 34:1622–1627.

27.

Perelle

, Dilasser

, Grout

, Fach

. Detection by 5’-nuclease PCR of Shiga-toxin producing Escherichia coli O26, O55, O91, O103, O111, O113, O145, and O157:H7. Mol Cell Probes, 2004; 18:185–192.

28.

Perelle

, Dilasser

, Grout

, Fach

. Screening food raw materials for the presence of the world's most frequent clinical cases of Shiga toxin-encoding Escherichia coli O26, O103, O111, O145 and O157. Int J Food Microbiol, 2007; 113:284–288.

29.

Possé

, De Zutter

, Heyndrickx

, Herman

. Quantitative isolation efficiency of O26, O103, O111, O145 and O157 STEC serotypes from artificially contaminated food and cattle faeces samples using a new isolation protocol. J Appl Microbiol, 2008a. 105:227–35.

30.

Possé

, De Zutter

, Heyndrickx

, Herman

. Novel differential and confirmation plating media for Shiga toxin-producing Escherichia coli serotypes O26, O103, O111, O145, and sorbitol-positive and -negative O157. FEMS Microbiol Lett, 2008b. 282:124–131.

31.

Possé

, DeZutter

, Heyndrickx

, Herman

. Metabolic and genetic profiling of clinical O157 and non-O157 Shiga-toxin-producing Escherichia coli. Res Microbiol, 2007; 158:591–599.

32.

Ritchie

, Thorpe

, Rogers

, Waldor

. Critical roles for stx₂, eae, and tir in Enterohemorrhagic Escherichia coli-induced diarrhea and intestinal inflammation in infant rabbits. Infect Immun, 2003; 71:7129–7139.

33.

Smith

, Fratamico

. Diarrhea-inducing Escherichia coli. Foodborne Pathogens: Microbiology and Molecular Biology. Fratamico

, Bhunia

, Smith

. Norfolk, UK: Caister Academic Press, 2005; 357–382.

34.

Sugiyama

, Inoue

, Sakazaki

. Mitomycin-supplemented washed blood agar for the isolation of Shiga toxin-producing Escherichia coli other than O157:H7. Lett Appl Microbiol, 2001; 33:193–195.

35.

Verstraete

, De Zutter

, Messens

, Herman

, Heyndrickx

, De Reu

. Effect of the enrichment time and immunomagnetic separation on the detection of Shiga toxin-producing Escherichia coli O26, O103, O111, O145 and sorbitol positive O157 from artificially inoculated cattle faeces. Vet Microbiol, 2010; 145:106–112.

36.

Vimont

, Delignette-Muller

, Vernozy-Rozand

. Supplementation of enrichment broths by novobiocin for detecting Shiga toxin-producing Escherichia coli from food: a controversial use. Lett Appl Microbiol, 2007; 44:326–331.

37.

Weagant

, Bryant

, Jinneman

. An improved rapid technique for isolation of Escherichia coli from foods. J Food Prot, 1995; 58:7–12.

38.

Werber

, Fruth

, Buchholz

, Prager

, Kramer

, Ammon

, Tschäpe

. Strong association between Shiga toxin-producing Escherichia coli O157 virulence genes stx2 and eae as possible explanation for predominance of serogroup O157 in patients with hemolytic uremic syndrome. Eur Clin Microbiol Infect Dis, 2003; 22:726–730.

39.

Werber

, Fruth

, Liesegang

, Littmann

, Buchholz

, Prager

, Karch

, Breuer

, Tschäpe

, Ammon

. A multistate outbreak of Shiga toxin-producing Escherichia coli O26:H11 infections in Germany, detected by molecular subtyping surveillance. J Infect Dis, 2002; 186:419–422.

40.

[WHO] World Health Organization. Zoonotic non-O157 Shiga toxin-producing Escherichia coli (STEC) Report of a WHO Scientific Working Group Meeting, 23 to 26 June 1998, Berlin, Germany, 1998. www.who.int/emc-documents/zoonoses/docs/whocsraph988.html/shigaindex.html(Online.)

Detection by Multiplex Real-Time Polymerase Chain Reaction Assays and Isolation of Shiga Toxin–Producing Escherichia coli Serogroups O26,O45,O103,O111,O121,and O145 in Ground Beef

Abstract

Introduction

Materials and Methods

Bacteria

Inoculation and enrichment of ground beef samples

DNA extraction

Real-time multiplex PCR assays

Sensitivity of the multiplex PCR assays

Preparation of magnetic beads for IMS of E. coli O45 and E. coli O121

IMS and plating onto Rainbow® Agar O157

Confirmation of presumptive isolates

Results and Discussion

Enrichment of ground beef samples

Real-time multiplex PCR assays

IMS and isolation of non–O157 STEC

Footnotes

Acknowledgments

Disclaimer

Disclosure Statement

References

IMS and plating onto Rainbow^® Agar O157