Molecular Epidemiological Investigation of a Diffuse Outbreak Caused by Salmonella enterica Serotype Montevideo Isolates in Osaka Prefecture,Japan

Abstract

In Osaka Prefecture, Japan, three foodborne outbreaks were caused by Salmonella enterica serotype Montevideo in rapid succession between September 2007 and May 2008. Further, Salmonella Montevideo was also isolated from several sporadic diarrhea patients and asymptomatic carriers examined during approximately the identical period. To investigate the relatedness of the isolates, we performed antimicrobial susceptibility testing, pulsed-field gel electrophoresis (PFGE) analysis, and multiple-locus variable-number tandem repeat (VNTR) analysis (MLVA) for 29 Salmonella Montevideo isolates obtained in this region between 1991 and 2008. Although antimicrobial susceptibility tests had low discriminatory power, PFGE patterns revealed 17 unique types with <90% similarity in combined analyses involving XbaI and BlnI. Moreover, we detected three VNTR loci that were useful to genotype Salmonella Montevideo isolates, with our method ultimately classifying the isolates into 11 MLVA types based on differences in repeat unit number in each examined locus. Six isolates obtained from patients of two separate foodborne disease outbreaks, one sporadic patient, and three different carriers between 2007 and 2008 had nearly identical PFGE patterns and were classified into the identical MLVA type; further, the isolates with this PFGE and MLVA pattern appeared only at that time between 1991 and 2008. These data strongly suggest that genetically identical Salmonella Montevideo strains may have caused the 2007 and 2008 outbreaks in Osaka Prefecture. Our results demonstrate that PFGE using XbaI and BlnI is useful for discriminating between Salmonella Montevideo isolates, even within a limited area, and reconfirm that continuous epidemiological surveillance for bacterial intestinal infections such as salmonellosis may be useful to not only monitor changes in the genetic diversity of isolates, but to also detect diffuse outbreaks.

Introduction

I n Japan, Salmonella enterica serotype Montevideo ranked in the top 10 S. enterica serotypes in each year between 2006 and 2009 reported to the Infectious Diseases Surveillance Center of the National Institute of Infectious Diseases (NIID), Tokyo, Japan, with 1.7%–5.5% of annual Salmonella human isolates (NIID, 2011). Although Salmonella Montevideo is acknowledged as a relatively rare serotype worldwide compared to serotypes Enteritidis and Typhimurium, Salmonella Montevideo has been attributed to several recent foodborne illness outbreaks not only in Japan but also in other countries (Hamada et al., 2002; Unicomb et al., 2005; Saito et al., 2006; Patel et al., 2010). For example, a large foodborne illness outbreak of Salmonella Montevideo in the United States between 2009 and 2010 involved salami products containing contaminated black and red peppers (CDC, 2010).

The proportion of Salmonella Montevideo among Salmonella strains annually collected or isolated at Osaka Prefectural Institute of Public Health, Japan, during bacterial intestinal infection surveillance or investigation of the causes of foodborne outbreaks between 1991 and 2006 fluctuated between 0% and 3.5%; however, the proportion dramatically increased to 22.6% in 2007. This increase was a result of two Salmonella Montevideo foodborne outbreaks associated with Japanese sushi food, and the more frequent isolation of strains from sporadic diarrhea patients and asymptomatic carriers examined. Moreover, a third Salmonella Montevideo foodborne outbreak associated with Japanese turtle dishes occurred shortly after in May 2008. To characterize and compare the phenotypic and genetic diversity of the Salmonella Montevideo isolates obtained between 2007 and 2008, epidemiologic data for Salmonella Montevideo during the past several years in Japan are required; however, to our knowledge, no such epidemiological studies of Salmonella Montevideo isolates have been conducted. Here, in the present study, 29 Salmonella Montevideo isolates collected between 1991 and 2008 in Osaka Prefecture were characterized by antimicrobial susceptibility testing, pulsed-field gel electrophoresis (PFGE) with two restriction endonucleases (XbaI and BlnI), and multiple-locus variable-number tandem repeat (VNTR) analysis (MLVA).

Materials and Methods

Salmonella Montevideo isolates

A total of 29 Salmonella Montevideo isolates obtained from patients of three foodborne outbreaks (outbreaks A, B, and C; n=1, 1, and 2, respectively), sporadic diarrhea patients (n=5), asymptomatic carriers (n=18), and food samples (n=2) between 1991 and 2008 in Osaka Prefecture, Japan, were used in this study (Fig. 1). Foodborne outbreak A was associated with presumed contaminated sushi, a traditional Japanese food consisting of small vinegared rice balls with fish slices or shellfish on top, which was served at seven chain restaurant locations, whereas outbreak B was associated with sushi sold at a supermarket. However, outbreak C was associated with soft-shelled turtle dishes, such as raw soft-shelled turtle and soft-shelled turtle congee, served at a restaurant. Previous laboratory investigation of outbreak A had suggested that all Salmonella Montevideo outbreak A isolates (n=31) were identical. Similarly, the Salmonella Montevideo isolates obtained in outbreak B (n=3) exhibited the identical antimicrobial susceptibility profiles and PFGE patterns. Therefore, only one representative isolate was selected from each of these two outbreaks for this study. However, since two separate PFGE patterns were identified from Salmonella Montevideo isolates in outbreak C, both isolates were used. On the other hand, all 25 isolates from sporadic diarrhea patients, asymptomatic carriers, and food samples had no known epidemiological links.

FIG. 1.

Dendrogram of the cluster analysis based on DNA restriction banding patterns with XbaI and BlnI, and number of tandem repeat units at three variable-number tandem repeat loci for 29 Salmonella Montevideo isolates. The degree of similarity (%) is shown on the scale. For each strain, the number of repeats at loci M-6, M-10, and M-12, source of the isolate, and the isolation date are listed in the table on the right.

Testing for antibiotic resistance

Antimicrobial susceptibility was evaluated using the Kirby-Bauer disk diffusion method with commercial susceptibility disks (Becton Dickinson and Company, Sparks, MD) according to the criteria established by the Clinical and Laboratory Standard Institute (CLSI, 2009). The antibiotics used were as follows: ampicillin, chloramphenicol, streptomycin, tetracycline, kanamycin, gentamicin, trimethoprim-sulfamethoxazole, nalidixic acid, ofloxacin, ciprofloxacin, and cefotaxime.

Pulsed-field gel electrophoresis

Molecular typing of Salmonella Montevideo isolates was performed using PFGE with the restriction endonucleases XbaI or BlnI according to the standardized protocols used by PulseNet laboratories (Ribot et al., 2006). The PFGE standard strain S. enterica serotype Braenderup H9812 was obtained from the PulseNet program (Swaminathan et al., 2001), Enteric Diseases Laboratory Branch, Centers for Disease Control and Prevention (Atlanta, GA) through NIID. PFGE banding patterns from the XbaI and BlnI digests were compared on dendrograms generated using BioNumerics (Applied Maths, Kortrijk, Belgium) and the unweighted pair group method with arithmetic mean clustering algorithm and a Dice similarity coefficient with 1% band matching criterion. PFGE clusters (designated type a-q) were assigned based on <90% similarity of banding patterns. For each PFGE profile, banding patterns with >90% similarity were assigned a numeric subprofile designation.

Detection of VNTR loci in Salmonella Montevideo

To identify potential VNTR loci in the Salmonella Montevideo genome, the complete genome sequences of S. enterica subsp. enterica serovar Typhimurium str. LT2 chromosome (GenBank accession no. NC_003197), serovar Newport str. SL254 chromosome (GenBank accession no. NC_011080), serovar Schwarzengrund str. CVM19633 chromosome (GenBank accession no. NC_011094), and serovar Heidelberg str. SL476 chromosome (GenBank accession no. NC_011083) were analyzed using Tandem Repeats Finder software (Benson, 1999). The four non-Montevideo reference strains were selected because we could not locate the genome sequences of any Salmonella Montevideo strains in public databases. As potential VNTR loci of Salmonella Montevideo, we searched for short repeat loci (3–12 bp) with the fewest mismatches and which were shared with at least two of the four reference strains. Thirteen potential loci (M-1–M-13) were identified that met these criteria, and polymerase chain reaction (PCR) primer pairs were designed using Primer3 (Rozen and Skaletsy, 2000) to amplify each locus (Table 1). Ten Salmonella Montevideo isolates with diverse PFGE profiles were initially assayed using the designed primer pairs to investigate whether each potential VNTR locus was polymorphic in the isolates. Template DNA was prepared by boiling cells in sterile water for 10 min. PCR mixtures were prepared using puReTaq Ready-To-Go PCR Beads (GE Healthcare, Piscataway, NJ) containing 5 pmol of each primer and 2 μL DNA template in a total volume of 25 μL. Amplification conditions involved an initial denaturation at 94°C for 5 min, 30 cycles of denaturation at 94°C for 30 s, annealing at 55°C for 30 s, and extension at 72°C for 30 s, followed by a final elongation step at 72°C for 5 min. The amplified products were electrophoresed in a 20-cm-long 3.0% agarose gel (Metaphor agarose; Cambrex Bio Science, Copenhagen, Denmark) at 15°C and 8 V/cm, as previously described (Kawamori et al., 2008). We visually compared the amplicon sizes of the 10 Salmonella Montevideo isolates on the agarose gel, and selected loci with several size variations of PCR products as VNTR loci. Based on this analysis, we selected three VNTR loci (M-6, M-10, and M-12) as targets for our MLVA analysis (Table 1).

Table 1.

Polymerase Chain Reaction Primers and Characteristics of Variable-Number Tandem Repeat Loci Used for Multiple-Locus Variable-Number Tandem Repeat Analysis in Four Reference Strains

			Reference strain (GenBank accession no.)
			Salmonella Typhimurium str. LT2 (NC_003197)		Salmonella Newport str. SL254 (NC_011080)		Salmonella Schwarzengrund str. CVM19633 (NC_011094)		Salmonella Heidelberg str. SL476 (NC_011083)
Locus	Tandem repeat sequence (repeat array size [bp])	Primer sequence (5′–3′)	Location	No. of repeats (expected amplicon size [bp])	Location	No. of repeats (expected amplicon size [bp])	Location	No. of repeats (expected amplicon size [bp])	Location	No. of repeats (expected amplicon size [bp])
M-1	GTAT (4)	(F) ATACGCTGGTGCCTGTTACC	282139–282154	4.0 (95)	284315–284326	3.0 (91)	—	—	—	—
		(R) GTAAAGGTCGCCGCATCG
M-2	TAGGAGATG (9)	(F) TTCCCTGCGAGGAAAAGTTA	341809–341819	1.2 (85)	345623–345714	10.2 (166)	342758–342768	1.2 (85)	—	—
		(R) GGCATCGTTGCAACATTGTTTA
M-3	ACCCTCTT (8)	(F) TACGTTAATGCTGGCAGGTG	622622–622637	2.0 (213)	627029–627044	2.0 (213)	705571–705601	4.0 (229)	671052–671067	2.0 (213)
		(R) AAATTCGCAATACGCTGGAG
M-4	GCG (3)	(F) AAGAGATCCCACGCATTACG	886766–886781	5.3 (120)	891087–891099	4.3 (117)	942080–942092	4.3 (−)^a	936204–936216	4.3 (117)
		(R) GATTTTGTCCGCGTCCAC
M-5	GCTTAACAC (9)	(F) GCAGAACGGATTGACATGAG	1714746–1714761	1.8 (173)	1711099–1711114	1.8 (173)	1685466–1685481	1.8 (173)	1762839–1762863	2.8 (182)
		(R) CGTGCGGGTGACAAGTAAAG
M-6	CGAGTCAT (8)	(F) CATGCGCCTATGTGATGTAGA	1723077–1723084	1.0 (129)	1719430–1719437	1.0 (129)	1693800–1693823	3.0 (148)	1771179–1771186	1.0 (−)^a
		(R) TTGGTGGCTTTACCCATTTT
M-7	AAATTTCGG (9)	(F) CGATGAACGCGATAATAAAGC	1958279–1958306	3.1 (203)	1963295–1963313	2.1 (194)	—	—	2006085–2006130	5.1 (220)
		(R) CCGTAAGCGGGAATCGTAT
M-8	CGGCAGCGGCGT (12)	(F) GTGGGTCATTGAGGACGTGT	2053194–2053229	3.0 (248)	2057454–2057477	2.0 (236)	2030366–2030389	2.0 (236)	2100825–2100848	2.0 (236)
		(R) GACCATGCTCTCCGATGACT
M-9	CAGGATGG (8)	(F) CATCCCACAATACGGTGACA	2141428–2141435	1.0 (93)	2150107–2150114	1.0 (93)	2121150–2121170	2.6 (101)	2189047–2189054	1.0 (93)
		(R) GTATGGCGATGGAGATCACA
M-10	CACGAC (6)	(F) ATGTTCTGGCGGACATGG	3184543–3184622	13.3 (158)	3168881–3168918	6.3 (116)	3088817–3088878	10.3 (140)	3167188–3167281	15.7 (176)
		(R) CCTTCCGGATGTATGTGACC
M-11	TGCGATGTC (9)	(F) CCGGTACTGTCAGGGAAAGA	3246675–3246714	4.4 (247)	—	—	—	—	3239065–3239077	1.4 (220)
		(R) GCATACCAAACGACCGCTAT
M-12	CTG (3)	(F) GTACGTGGTTGCTGAACAGG	4301590–4301602	4.3 (88)	4293205–4293229	8.3 (100)	4178641–4178683	14.3 (118)	4305971–4305986	5.3 (91)
		(R) CAGAACAACGCCAGCAAAC
M-13	TATT (4)	(F) CAAACGTTCTGTCCGCTTTT	4374459–4374470	3.0 (110)	4365913–4365928	4.0 (114)	4241783–4241794	3.0 (110)	4371179–4371190	3.0 (110)
		(R) AAGAATAACGGTGGCGACAA

PCR did not generate a product, because reverse primer did not match the genomic DNA sequence of the reference strain.

F, forward; R, reverse; PCR, polymerase chain reaction.

Direct sequencing of amplified VNTR loci

To confirm the number of repeats in each Salmonella Montevideo isolate at each of the three examined loci, we sequenced the PCR products amplified from the 29 isolates using the above-described PCR procedure. Direct PCR amplification was conducted using the following forward (F) and reverse (R) flanking primers: (F) 5′-AACCCCAAA CACCAACAAAG-3′ and (R) 5′-ACTGCCAACCGGATAA CAAA-3′ for locus M-6; (F) 5′-CGGCTTTTATCATTGCC ATT-3′ and (R) 5′-GGTCAGGCCGAATAGCAGGAT-3′ (STTR5-L) (Lindstedt et al., 2003) for locus M-10; and (F) 5′-CCAGCGACGTTCATCTTTTT-3′ and (R) 5′-AATCCGAATCAGCTCACCAG-3′ for locus M-12. DNA sequencing of the amplified fragments was performed using the dideoxy chain termination method with an ABI PRISM 3130 Genetic Analyzer (Applied Biosystems, Foster City, CA).

Statistical analysis

Discriminatory power of the PFGE and MLVA typing techniques was calculated using Simpson's index of diversity (Hunter and Gaston, 1988).

Results

All 29 of the examined Salmonella Montevideo isolates were susceptible to the 11 antimicrobial agents tested in this study, except for a single isolate (16A78) that exhibited nalidixic acid resistance. The PFGE banding patterns of these isolates after DNA digestion with XbaI and BlnI showed 18 and 16 unique types, respectively, with <90% banding pattern similarity. The discriminatory power of the PFGE analyses was assessed using Simpson's index of diversity, with values of 0.95 and 0.94 calculated for XbaI and BlnI, respectively. In combined analysis involving XbaI and BlnI, 17 unique PFGE banding patterns with <90% similarity (designated type a–q) were identified (Fig. 1). The PFGE types a, c, d, e, and p were further subdivided into two (a1 and a2), three (c1–c3), two (d1 and d2), two (e1 and e2), and three (p1–p3) subtypes, respectively, based on similarity of >90% (Fig. 1). Simpson's index of diversity increased to 0.97 for the combined data of the two DNA restriction endonucleases. Of the 10 Salmonella Montevideo isolates obtained between June 2007 and May 2008, six (19A232, 19A271, 19A332, 19A338, 19A345, and 19A313) had nearly indistinguishable PFGE patterns and formed the largest PFGE cluster (PFGE type d).

To type the 29 Salmonella Montevideo isolates using a different method, we applied MLVA to examine the three identified VNTR loci. Targeted PCR amplicons were identified for all three loci in each isolate, with the exception of locus M-6 in isolate 6A118. All amplified PCR products were analysed by direct sequencing to determine the number of repeats at each loci, and were also compared with genomic sequences of the reference strains to confirm whether the correct sequence was amplified. Based on the results of this sequence analysis, the 29 Salmonella Montevideo isolates were divided into four types with 1.0–3.5 repeats at locus M-6, six types with 8.3–21.3 repeats at locus M-10, and six types with 5.3–16.3 repeats at locus M-12 (Fig. 1). Further classification based on variations of the repeat number at the three VNTR loci ultimately revealed 11 unique types (MLVA types A to K; Fig. 1), including 7 types (MLVA types A, C, E, F, I, G, and H) which consisted of only a single isolate. The Simpson's index of diversity was determined to be 0.81 for the MLVA method. Notably, the six strains clustered into PFGE type d, which were isolated between September 2007 and February 2008, were also classified as the identical MLVA type (MLVA type D) by this method, whereas all other strains but one (9A138) were of different types.

Discussion

MLVA recently developed for typing Salmonella spp. such as Salmonella Enteritidis, Salmonella Typhimurium, and Salmonella Newport has proven to be an effective strain-typing procedure that is easily standardized between laboratories (Lindstedt et al., 2003; Witonski et al., 2006; Boxrud et al., 2007; Davis et al., 2009). Here, we have detected three suitable VNTR loci for molecular epidemiological characterization of Salmonella Montevideo isolates. Interestingly, locus M-10 appears identical to loci SE-5, STTR5, and 3184543, which were used for distinguishing isolates of Salmonella Enteritidis, Salmonella Typhimurium and Salmonella Infantis, and Salmonella Newport, respectively (Lindstedt et al., 2003; Witonski et al., 2006; Boxrud et al., 2007; Ross and Heuzenroeder, 2008; Davis et al., 2009); thus, locus M-10 might be useful in the genotyping of isolates containing various S. enterica serotypes. Although our MLVA method was useful for investigating genetic relatedness among Salmonella Montevideo isolates between 2007 and 2008, the Simpson's diversity index of the method, 0.81, is not an acceptable level of discrimination for the sole use of this method for typing Salmonella Montevideo. To improve MLVA-based strain discrimination of Salmonella Montevideo, further studies, such as determination of complete genome sequences of several Salmonella Montevideo strains, are needed to identify other suitable VNTR loci within this serotype.

Foodborne outbreaks A, B, and C were caused by Salmonella Montevideo in September 2007, December 2007, and May 2008, respectively, and occurred in rapid succession within Osaka Prefecture. We determined that all of the Salmonella Montevideo isolates in outbreak A, which were obtained from 15 of 37 symptomatic patients and 16 restaurant employees, whose disease status was unknown, had the identical PFGE banding pattern with XbaI and BlnI. Similarly, the Salmonella Montevideo isolates obtained from three of the four symptomatic patients in outbreak B all exhibited the identical PFGE banding pattern with XbaI and BlnI. However, Salmonella Montevideo was isolated from two of the four symptomatic patients (isolates 20A58 and 20A59) in outbreak C, and the PFGE patterns differed substantially. Given that both outbreaks A and B appeared to be caused by presumed contaminated sushi, which is rarely implicated in Salmonella foodborne illness outbreaks in Japan, the two outbreaks were suspected to be epidemiologically related. As expected, isolates 19A232 and 19A332, which were associated with outbreaks A and B, respectively, exhibited identical PFGE patterns (PFGE type d1). Additionally, among the eight Salmonella Montevideo strains isolated from asymptomatic carriers and patients during the identical time period as the three outbreaks, isolates 19A271, 19A313, 19A338, and 19A345 also showed nearly identical PFGE patterns (PFGE type d). Notably, these four isolates and the outbreak isolates 19A232 and 19A332 were grouped within the identical MLVA type. The molecular epidemiological evidence demonstrates that these infections may be acquired through widely consumed foodstuffs, including raw and frozen seafood contaminated by symptomatically or asymptomatically infected food handlers or by cross-contamination from other food products. Although trace-back analyses did not determine the common source of the two outbreaks, and those of the other four Salmonella Montevideo isolates are also unknown, our PFGE and MLVA results strongly suggest that a diffuse outbreak of Salmonella Montevideo may have occurred between 2007 and 2008 in Osaka, as the PFGE type d and MLVA type D isolates appeared only at that time between 1991 and 2008.

Conclusions

We have described for the first time the epidemiological characteristics and genotypic diversities of Salmonella Montevideo isolates obtained from diarrhea patients, asymptomatic carriers, and food products between 1991 and 2008 in Osaka Prefecture, Japan. Our results indicate that a diffuse outbreak in Osaka between September 2007 and February 2008 was caused by nearly genetically identical Salmonella Montevideo strains. This study has reconfirmed that continuous epidemiological surveillance for bacterial intestinal infections such as salmonellosis may be useful to not only monitor changes in the genetic diversity of isolates, but to also detect diffuse outbreaks.

Footnotes

Acknowledgments

We are grateful to Dr. Kawamori of the Shizuoka Institute of Environment and Hygiene for valuable technical advice. This work was partially supported by a Grant-in-Aid for Young Scientists (Start-up, 21890317) in 2009–2010 from the Ministry of Education, Culture, Sports, Science and Technology, and by Grants-in-Aid from the Ministry of Health, Labour and Welfare of Japan (H21-Ippan-003 and H22-Ippan-003).

Disclosure Statement

No competing financial interests exist.

References

Benson

. Tandem repeats finder: a program to analyze DNA sequences. Nucleic Acids Res, 1999; 27:573–580.

Boxrud

, Pederson-Gulrud

, Wotton

et al. Comparison of multiple-locus variable-number tandem repeat analysis, pulsed-field gel electrophoresis, and phage typing for subtype analysis of Salmonella enterica serotype Enteritidis. J Clin Microbiol, 2007; 45:536–543.

[CDC] Centers for Disease Control and Prevention. Salmonella Montevideo infections associated with salami products made with contaminated imported black and red pepper—United States, July 2009–April 2010. MMWR Morb Mortal Wkly Rep, 2010; 59:1647–1650.

[CLSI] Clinical and Laboratory Standards Institute. Performance Standards for Antimicrobial Disk Susceptibility Test; approved standard-10^th ed, 2009CLSI document M2-A10.

Davis

, Baker

KNK

, Call

et al. Multilocus variable-number tandem-repeat method for typing Salmonella enterica serovar Newport. J Clin Microbiol, 2009; 47:1934–1938.

Hamada

, Tsuji

, Oshima

. Salmonella serovar Montevideo involved in a food poisoning outbreak at a club for elderly persons in April 2002 in Hyogo Prefecture. Jpn J Infect Dis, 2002; 55:176–177.

Hunter

, Gaston

. Numerical index of the discriminatory ability of typing systems: an application of Simpson's index of diversity. J Clin Microbiol, 1988; 26:2465–2466.

Kawamori

, Hiroi

, Harada

et al. Molecular typing of Japanese Escherichia coli O157: H7 isolates from clinical specimens by multilocus variable-number tandem repeat analysis and PFGE. J Med Microbiol, 2008; 57:58–63.

Lindstedt

, Heir

, Gjernes

, Kapperud

. DNA fingerprinting of Salmonella enterica subsp. enterica serovar Typhimurium with emphasis on phage type DT104 based on variable number of tandem repeat loci. J Clin Microbiol, 2003; 41:1469–1479.

10.

[NIID] National Institute of Infectious Diseases. 2011. Infectious Diseases Surveillance Center. Infectious Agents Surveillance Report. http://idsc.nih.go.jp/iasr/virus/bacteria-e.html. 2011 March 20(Online.)

11.

Patel

, Chen

, Pringle

et al. A prolonged outbreak of Salmonella Montevideo infections associated with multiple locations of a restaurant chain in Phoenix, Arizona, 2008. J Food Prot, 2010; 73:1858–1863.

12.

Ribot

, Fair

, Gautom

, Cameron

et al. Standardization of pulse-field gel electrophoresis protocols for the subtyping of Escherichia coli O157: H7, Salmonella, and Shigella for PulseNet. Foodborne Pathog Dis, 2006; 3:59–67.

13.

Ross

, Heuzenroeder

. A comparison of three molecular typing methods for the discrimination of Salmonella enterica serovar Infantis. FEMS Immunol Med Microbiol, 2008; 53:375–384.

14.

Rozen

, Skaletsy

. Primer3 on the WWW for general users and for biologist programmers. Methods Mol Biol, 2000; 132:365–386.

15.

Saito

, Hiratsuka

, Sugawara

et al. PFGE analysis of Salmonella Montevideo isolated from an outbreak of food poisoning and the case of sporadic salmonellosis. Jpn J Food Microbiol, 2006; 23:143–148.

16.

Swaminathan

, Barrett

, Hunter

et al. PulseNet: The molecular subtyping network for foodborne bacterial disease surveillance, United States. Emerg Infect Dis, 2001; 7:382–389.

17.

Unicomb

, Simmons

, Merritt

et al. Sesame seed products contaminated with Salmonella: three outbreaks associated with tahini. Epidemiol Infect, 2005; 133:1065–1072.

18.

Witonski

, Stefanova

, Ranganathan

et al. Variable-number tandem repeats that are useful in genotyping isolates of Salmonella enterica subsp. enterica serovars Typhimurium and Newport. J Clin Microbiol, 2006; 44:3849–3854.