Antimicrobial Susceptibility Testing and Genotypic Characterization of Staphylococcus aureus from Food and Food Animals

Abstract

Staphylococcus aureus is commonly present in humans and animals. The aim of this study was to investigate antimicrobial resistance and genetic characteristics of S. aureus from food and food animals in Shaanxi Province in China. A total of 332 nasal swabs, breast skin swabs, raw milk, and pork samples were collected from local pig, dairy farms, or local grocery stores and screened for the presence of S. aureus. S. aureus isolates were characterized using antimicrobial susceptibility, pulsed-field gel electrophoresis (PFGE) analysis, and polymerase chain reaction for detecting pvl and mecA genes. Methicillin-resistant S. aureus (MRSA) strains were additionally tested for SCCmec type and exfoliative toxin genes. The prevalence of S. aureus was 30.6% in pig nasal swabs, 32.5% in pork, 25.7% in cow nasal swabs, 30.8% in cow breast skin swabs, and 29.3% in milk samples. Resistances were common among isolates tested against erythromycin (65.7%), tetracycline (65.7%), ciprofloxacin (52.7%), followed by gentamicin (36.7%), chloramphenicol (23.1%), cefoxitin (8.3%), and oxacillin (7.7%), but no isolate was resistant to vancomycin, amikacin, or cefoperazone. pvl gene was found in the isolates from all types of samples except from cow nasal swabs. Fourteen isolates from pig nasal swabs contained mecA gene and were considered as MRSA. PFGE analysis showed that nasal isolates differed from food isolates, but isolates from the same animal source appeared to cluster closely. The PFGE patterns of MRSA isolates were different from other S. aureus isolates from pig nasal cavity even though they were from the same source. All the MRSA isolates belonged to SCCmec type IV_b. No isolates contained exfoliative toxin genes. These findings indicated that S. aureus, including multidrug-resistant S. aureus, are widely spread in food animals and animal-derived foods in Shaanxi Province, China. MRSA isolates from pigs may pose potential health risks for workers in swine farms and the community at large.

Introduction

S taphylococcus aureus frequently colonizes on the skin and mucous membranes of humans and animals. It is an opportunistic pathogen and could cause a wide range of infections including dermatitis, pneumonia, septicemia, osteomyelitis, and meningitis in humans and pigs, and mastitis in cattle (Hasman et al., 2010). S. aureus is also commonly found in various food (especially of animal origin), and is an important foodborne pathogen worldwide (Normanno et al., 2005, 2007). Important virulence factors implicated in the pathogenesis of S. aureus include enterotoxins, exfoliative toxins, toxic shock syndrome toxin-1, and Panton-Valentine Leucocidin, and other exoproteins are also responsible for particular clinical manifestations (Vancraeynest et al., 2006).

Antimicrobial resistance has been an important public health concern and frequently reported in S. aureus (Lowy, 2003). Among resistant S. aureus, methicillin-resistant S. aureus (MRSA) is the most significant as it represents a leading cause of hospital-associated (HA) infections and has also emerged as an important cause of community infection (Ho et al., 2008). The methicillin resistance of MRSA is mediated by the mecA gene that encodes a penicillin-binding protein with a low affinity for β-lactams (Pinho et al., 2001). The gene resides in a mobile genetic element called staphylococcal cassette chromosome mec (SCCmec). Community-associated (CA) MRSA strains mainly harbor SCCmec IV or V, whereas HA MRSA strains tend to carry SCCmec I, II, and III (Kluytmans-VandenBergh and Kluytmans, 2006). In recent years, MRSA has been identified in food animals including pig, cattle, chicken, and foods of animal origin (Cuny et al., 2010; Kluytmans, 2010). Therefore, livestock and foods of animal origin may become an important reservoir and source of community-acquired MRSA.

Several genotypic typing methods, such as multilocus sequence typing (MLST), ribotyping, pulsed-field gel electrophoresis (PFGE), and staphylococcal protein A (spa) typing, have been applied in the epidemiological investigation of S. aureus from different sources (Grundmann et al., 2002). The MLST is thought to provide information about the phylogenetic clustering of S. aureus isolates and has been widely used in typing MRSA strains from animals and humans (Feil et al., 2003). But it is relatively expensive for sequencing several house-keeping genes and has a lower discriminatory power compared with other typing methods. Although some strains are not typeable by restriction enzyme digestion possibly due to modification of restriction sites, PFGE is considered as the gold standard for typing S. aureus due to its discriminatory power (Struelens et al., 2009). The single locus–based spa typing has a similar discriminatory power as PFGE and is extensively used currently, and it can be used together with PFGE for typing those isolates that are nontypeable by standard PFGE (Mellmann et al., 2007).

There was a paucity of data regarding characteristics of S. aureus, especially MRSA, in food animals and foods of animal origin in China. The aim of this study was to determine the antimicrobial susceptibility and genetic characteristics of S. aureus in pig, cow, raw milk, and pork samples in Shaanxi Province in China. S. aureus isolated from these samples were analyzed by antimicrobial susceptibility testing and detection of mecA and pvl genes. The genetic relatedness among S. aureus isolates from different origin was evaluated by PFGE. In addition, MRSA isolates were further tested for SCCmec type and exfoliative toxin genes.

Materials and Methods

Isolation and identification of S. aureus

From January to August 2009, 332 samples including 173 pig nasal swabs, 35 cow nasal swabs, 26 cow breast skin swabs, and 58 raw milk samples from 10 farms, and 40 pork samples from five retail grocery stores were collected in Shaanxi Province, China. All swabs were incubated in trypticase soy broth (TSB) (Beijing Land Bridge Technology Co. Ltd., Beijing, China) containing 7.5% NaCl. A 50 mL aliquot of milk sample or pork rinse was enriched in an equal volume of double-strength TSB supplemented with 15% NaCl (Beijing Land Bridge Technology Co. Ltd.). After incubation at 35°C for 18–24 h with shaking, a loopful of the culture was inoculated onto Baird-Parker agar plates (Beijing Land Bridge Technology Co. Ltd.). Following incubation for 48 h, one to two colonies showing typical appearance (black colonies surrounded by 2 to 5 mm clear zones) of coagulase-positive staphylococci per sample were taken and confirmed as S. aureus by Gram staining, catalase test, coagulase test, and DNase production test on DNase Agar. All isolates were stored at −80°C in TSB plus 20% (v/v) glycerol for further use.

Polymerase chain reaction assays

Following the DNA extraction described previously (Xia et al., 2010), presumptive S. aureus isolates were identified to the species level by polymerase chain reaction (PCR) detection of thermonuclease gene (nuc, S. aureus specific) (Brakstad et al., 1992). S. aureus isolates were further tested by PCR for PVL-encoding gene (pvl) and methicillin resistance gene (mecA) (Zhang et al., 2004; Wang et al., 2009). All MRSA isolates were further examined by PCR for the presence of exfoliative toxin genes (eta and etb genes) as previously described (Noguchi et al., 2006). SCCmec typing was performed by PCR as described previously (Zhang et al., 2005). Primers for the PCR assays were listed in Table 1. The PCR products were resolved in 1.5% (w/v) agarose gel electrophoresis in 1×TBE buffer.

Table 1.

Oligonucleotide Primers Used in Polymerase Chain Reaction

Gene	Forward primer sequence (5′-3′)	Reverse primer sequence (5′-3′)	Product size (bp)	Reference
nuc	GCGATTGATGGTGATACGGTT	AGCCAAGCCTTGACGAACTAAAGC	279	Brakstad et al. (1992)
mecA	GTAGAAATGACTGAACGTCCGATAA	CCAATTCCACATTGTTTCGGTCTAA	310	Zhang et al. (2004)
SCCmec I	GCTTTAAAGAGTGTCGTTACAGG	GTTCTCTCATAGTATGACGTCC	613	Zhang et al. (2005)
SCCmec II	CGTTGAAGATGATGAAGCG	CGAAATCAATGGTTAATGGACC	398	Zhang et al. (2005)
SCCmec III	CCATATTGTGTACGATGCG	CCTTAGTTGTCGTAACAGATCG	280	Zhang et al. (2005)
SCCmec IVa	GCCTTATTCGAAGAAACCG	CTACTCTTCTGAAAAGCGTCG	776	Zhang et al. (2005)
SCCmec IVb	TCTGGAATTACTTCAGCTGC	AAACAATATTGCTCTCCCTC	493	Zhang et al. (2005)
SCCmec IVc	ACAATATTTGTATTATCGGAGAGC	TTGGTATGAGGTATTGCTGG	200	Zhang et al. (2005)
SCCmec IVd	CTCAAAATACGGACCCCAATACA	TGCTCCAGTAATTGCTAAAG	881	Zhang et al. (2005)
SCCmec V	GAACATTGTTACTTAAATGAGCG	TGAAAGTTGTACCCTTGACACC	325	Zhang et al. (2005)
pvl	ATCATTAGGTAAAATGTCTGGACATGATCCA	GCATCAAGTGTATTGGATAGCAAAAGC	433	Wang et al. (2009)
eta	ATATCAACGTGAGGGCTCTAGTAC	ATGCAGTCAGCTTCTTACTGCTA	1155	Noguchi et al. (2006)
etb	CACACATTACGGATAATGCAAG	TCAACCGAATAGAGTGAACTTATCT	604	Noguchi et al. (2006)

Antimicrobial susceptibility testing

Antimicrobial susceptibility tests were performed using agar dilution method (CLSI, 2006). The isolates were tested with a panel of 10 antimicrobials: oxacillin (OXA), cefoperazone (CPZ), cefoxitin (FOX), erythromycin (ERY), gentamicin (GEN), chloramphenicol (CHL), ciprofloxacin (CIP), tetracycline (TET), amikacin (AMK), and vancomycin (VAN) according to the guidelines of the Clinical Laboratory Standards Institute (CLSI, 2006). Escherichia coli ATCC 25922 and S. aureus ATCC 29213 were included as quality control strains in each run.

Genomic DNA fingerprinting using PFGE

Genomic DNA fingerprints of S. aureus were determined using PFGE according to a standard protocol developed by PulseNet for S. aureus (McDougal et al., 2003). Briefly, agarose-embedded DNA was digested with 50 U of SmaI for 4 h in a water bath at 30°C. DNA fragments were separated by electrophoresis in 0.5×TBE buffer at 14°C for 18 h on a CHEF-III Mapper electrophoresis system with pulse time of 5–40 s. The gels were stained with ethidium bromide and images were taken under UV transillumination. The images were analyzed with BioNumerics Software (Applied Maths, Kortrijk, Belgium) by using Dice coefficients and unweighted pair group method with arithmetic averages to achieve dendrograms with a 1.5% band position tolerance. Salmonella serotype Branderup strain H9812 digested with XbaI was used as a molecular size marker.

Results

Isolation and identification of S. aureus

Of the 332 samples, 100 (30.1%) samples were positive for S. aureus, including 53 (30.6%) of the 173 pig nasal swabs, 13 (32.5%) of the 40 pork samples, 9 (25.7%) of the 35 cow nasal swabs, 8 (30.8%) of the 26 cow breast skin swabs, and 17 (29.3%) of the 58 raw milk samples (Table 2). A total of 169 S. aureus isolates were recovered from the 100 S. aureus–positive samples (1–2 isolates per sample), including 83 isolates from pig nasal swabs, 26 isolates from pork, 22 isolates from cow nasal swabs, 18 isolates from cow breast skin swabs, and 20 isolates from raw milk (Table 2).

Table 2.

Prevalence and Detection of mecA and pvl of Staphylococcus aureus from Food and Animals

Source	No. of samples	No. (%) of samples positive for Staphylococcus aureus	No. of S. aureus isolates recovered ^a	No. (%) of pvl-positive isolates	No. (%) of mecA-positive isolates
Pig nasal swabs	173	53 (30.6%)	83	38 (45.8%)	14 (16.7%)
Pork	40	13 (32.5%)	26	23 (88.5%)	0 (0%)
Raw milk	58	17 (29.3%)	20	0 (0%)	0 (0%)
Cow breast skin swabs	26	8 (30.8%)	18	17 (94.4%)	0 (0%)
Cow nasal swabs	35	9 (25.7%)	22	18 (90%)	0 (0%)
Total	332	100 (30.1%)	169	96 (56.8%)	14 (8.3%)

One to two S. aureus isolates were collected from each positive sample.

pvl and mecA detection

Fourteen S. aureus isolates from pig swab samples showed positive for mecA gene, whereas none of the isolates from other samples were positive for mecA. Ninety-six pvl-positive S. aureus (56.8%) were identified among the 169 S. aureus isolates, including 23 (88.5%) pvl-positive S. aureus from pork, 18 (90%) from raw milk, 17 (94.4%) from cow breast skin swabs, and 38 (45.8%) from pig nasal swabs. No isolates from cow nasal swabs were tested positive for pvl gene (Table 2).

Antimicrobial susceptibility tests

The 169 S. aureus isolates were tested for susceptibility against 10 antimicrobials. The overall resistance to these antimicrobials was 65.7% to erythromycin, 65.7% to tetracycline, 52.7% to ciprofloxacin, 36.7% to gentamicin, 23.1% to chloramphenicol, 8.3% to cefoxitin, and 7.7% to oxacillin (Table 3). All S. aureus isolates were susceptible to vancomycin, amikacin, and cefoperazone. In addition, multidrug-resistant S. aureus isolates (resistant to ≥3 antimicrobials) were observed in 100% of the pig nasal isolates, 30.8% of the pork isolates, and 15% of the milk isolates, respectively. Resistance to β-lactam antimicrobials was most common among the pig nasal swab isolates, and oxacillin resistance (15.7%) and cefoxitin resistance (16.9%) were only observed among the pig nasal swab isolates. In general, S. aureus isolated from pig and pork showed a higher resistance rate than those from milk and cow.

Table 3.

Antimicrobial Resistance Phenotypes of Staphylococcus aureus Isolates Recovered from Food and Animals

		% Resistance
Antimicrobial agent	Resistance break point (μg/mL) ^a	Pig nasal swab (n=83)	Pork (n=26)	Cow nasal swab (n=22)	Cow breast swab (n=18)	Milk (n=20)	Total (n=169)
Oxacillin	≥4	15.7	0	0	0	0	7.7
Amikacin	≥32	0	0	0	0	0	0
Cefoperazone	≥64	0	0	0	0	0	0
Cefoxitin^b	≥8	16.9	0	0	0	0	8.3
Chloramphenicol	≥32	42.2	0	0	0	25	23.7
Ciprofloxacin	≥4	92.8	42.3	0	0	5	52.7
Erythromycin	≥8	100	100	0	0	10	65.7
Gentamicin	≥8	67.5	7.7	0	0	20	36.7
Tetracycline	≥16	100	100	0	0	10	65.7
Vancomycin	≥16	0	0	0	0	0	0
Multiresistance		100	100	0	0	35	68.6

Minimum inhibitory concentrations (μg/mL) determined via agar dilution in accordance with CLSI.

No CLSI breakpoint, the breakpoint as stated by Perez et al. (2008) was used.

CLSI, Clinical and Laboratory Standards Institute.

Characteristics of MRSA isolates

All of the 14 MRSA isolates harbored SCCmec IV_b. None of the isolates were positive for exfoliative toxins genes (eta and etb). They were all resistant to erythromycin, cefoxitin, tetracycline, chloramphenicol, gentamicin, trimethoprim, and ciprofloxacin. All isolates except one were resistant to oxacillin. Eight PFGE types were identified using SmaI digestion among the MRSA isolates, which formed three clusters.

PFGE analysis of S. aureus isolates

There was a great genetic diversity among isolates from different sources (Fig. 1). Pig nasal isolates were generally different from pork isolates, except a few isolates (isolate Nos. 139, 138, 134, 131, and 132) showing a similarity of more than 80%. Most (9/12) of the isolates from milk samples tested were closely related (similarity of more than 80%) to cow breast skin isolates, and they were both separated from cow nasal isolates. However, the MRSA isolates clustered (similarity of 80%) together and differed from other nasal isolates and the pork isolates.

FIG. 1.

Dendrogram of pulsed-field gel electrophoresis patterns of Staphylococcus aureus isolates from animals and food. The columns on the right show the identification number, the source, and mecA status of the isolates. Due to unavailability of some isolates during the experiment, only 139 out of 169 isolates were included in this part of study.

Discussion

Livestocks can carry S. aureus in nasal cavity and on skin. Foods derived from these animals can be contaminated during and after slaughtering, and processing. Studies on the prevalence and characteristics of S. aureus, especially MRSA from farm animals and foods derived from these animals in China, are very scarce. In addition, information on the relationship between food isolates and animal isolates is limited. Our findings showed that the contamination rate of S. aureus in the animal and food samples was between ∼25% and 32%, which was similar to the studies conducted in other countries. For example, S. aureus was detected in 24.2% of pork samples in Korea (Lee, 2003), and 39.2% in United States (Kluytmans, 2010), and 29.6% in raw milk in Korea (Lee, 2003), and 38.4% in Italy (Normanno et al., 2005). Higher S. aureus contamination rates in pork samples were reported in the Netherlands (46%) (Kluytmans, 2010) and in Germany (57.7%) (Atanassova et al., 2001). In Norway, 75% of tank milk samples were contaminated with S. aureus (Jorgensen et al., 2005). Even though there are differences in hygienic control and processing on farms in different countries, the common presence of the pathogen in food indicates its ubiquitousness and the difficulty to control this pathogen.

Panton-Valentine Leukocydin is a leukotoxin associated with human clinical diseases (Chen et al., 2009) and also with bovine mastitis (Zecconi et al., 2006). pvl gene was identified at a high rate in S. aureus isolated from pork, cow breast skin, and milk, commonly found in pig nasal swab isolates, but not detected in isolates from cow nasal cavity. The rate of pvl in isolates from cow breast skin was high (94.4%) compared with the rate reported in another study (56% of bovine isolates) (Zecconi et al., 2006). For food samples, only 3 pvl-positive S. aureus were detected from 219 Staphylococcus sp. isolated from various food samples in Turkey (Sudagidan and Aydin, 2010). In contrast, no pvl-positive S. aureus was found from milk samples in Brazil (Aires-de-Sousa et al., 2007). In this study, pvl was commonly found in general S. aureus isolates as well as in MRSA isolates (13/14, 93%). The significance of the pvl-positive but methicillin-susceptible S. aureus and MRSA strains in foods and their contributions to infections in humans and animals need further elucidation.

There was a higher prevalence of antimicrobial resistance in pig isolates than in cattle isolates. These maybe due to the fact that a substantial amount of antimicrobials is used in pig farming for growth promotion and for prophylactic in addition to therapeutic purpose, while in cattle farm generally antimicrobials were mainly used for clinical purpose, such as treating mastitis. The high resistance (100%) to tetracycline in pig or pork isolates supported the selection effect of considerable use of this antimicrobial in pig farm, even though it has limited clinical significance today. These data underline the need for policies on the judicious use of antimicrobials on pig farms. Milk isolate differed from breast skin isolate with respect to resistance profiles, which, in contrast with similar PFGE patterns, indicates that sources other than cow breast might have contributed to the contamination of the milk samples. Swine nasal isolates showed greater resistance compared with pork isolates, together with different PFGE patterns, also suggesting that they were likely from different sources.

Oxacillin resistance was only detected in pig nasal isolate, which is consistent with another study by Cui et al. (2009) who reported that MRSA are only found in pig farm, but not in cattle farm in China. Among 14 mecA-positive isolates, only one isolate (isolate 61) was susceptible to oxacillin, but resistant to cefoxitin. It was suggested that cefoxitin has advantages over oxacillin for identifying low-level resistant MRSA (Witte et al., 2007). Thus this isolate was still considered as potential MRSA. All MRSA isolates in our study can be digested by SmaI enzyme. When compared with PFGE patterns of major MRSA clones in the United States (USA 100-900), none of the MRSA strains in this study matched with any U.S. types (data not shown), which indicates that MRSA in China was probably different from those in the United States and other countries, as suggested by MLST of pig MRSA strains in China (Cui et al., 2009). In addition, all MRSA contained pvl gene, while no pvl-positive MRSA was reported by Cui et al. (2009) in China, de Neeling et al. (2007) in the Netherlands, and Huber et al. (2010) in Switzerland. All MRSA strains in this study belonged to SCCmec type IV_b, while only SCCmec type III in pig MRSA was reported in other provinces of China (Cui et al., 2009). These differences demonstrated that different MRSA clones exist in various regions of China. In contrast to other studies that reported the presence of MRSA in pork (de Boer et al., 2009), no MRSA was identified in pork samples in this study, possibly due to a limited number of samples taken and different methods used.

PFGE analysis revealed that most pork S. aureus were distant from pig nasal isolates, with only a few pork isolates (e.g., isolate Nos. 134, 139, and 131) exhibited >80% similarity to nasal isolates. They may come from contact with intestinal content during slaughtering and processing or from other sources (equipment, handlers, etc.) during processing. Most of the S. aureus isolates from milk tested showed similar PFGE pattern to isolates from breast skin, confirming the general conception that milk contamination is more related to the pathogen on breast skin of cows, and less connected with nasal carriage in cow. In addition, most MRSA isolates clustered together and differed from other pig nasal isolates, indicating that they may originate from sources other than pig itself, and their sources need further determination.

In summary, pork and milk samples were contaminated with S. aureus at similar rates compared with the carriage rates in pig and cow. pvl was detected frequently in isolates from all types of samples except cow nasal isolates. Antimicrobial resistance in cow isolates was less pronounced than that in pig isolates. MRSA were only found in pig nasal isolates. Further research into the origin of these MRSA is highly needed, and the possibility of their transfer to humans and their role to CA MRSA infection should also be elucidated in the future.

Footnotes

Acknowledgments

This research was supported in part by Changjiang Scholar Program of China and Special Funds for Talents from Northwest A&F University (No. Z111021002).

Disclosure Statement

No competing financial interests exist.

References

Aires-de-Sousa

, Parente

, Vieira-da-Motta

et al. Characterization of Staphylococcus aureus isolates from buffalo, bovine, ovine, and caprine milk samples collected in Rio de Janeiro State, Brazil. Appl Environ Microbiol, 2007; 73:3845–3849.

Atanassova

, Meindl

, Ring

. Prevalence of Staphylococcus aureus and staphylococcal enterotoxins in raw pork and uncooked smoked ham—a comparison of classical culturing detection and RFLP-PCR. Int J Food Microbiol, 2001; 68:105–113.

Brakstad

, Aasbakk

, Maeland

. Detection of Staphylococcus aureus by polymerase chain reaction amplification of the nuc gene. J Clin Microbiol, 1992; 30:1654–1660.

Chen

, Hiramatsu

, Huang

et al. Panton-Valentine leukocidin (PVL)-positive methicillin-susceptible and resistant Staphylococcus aureus in Taiwan: identification of oxacillin-susceptible mecA-positive methicillin-resistant S. aureus. Diagn Microbiol Infect Dis, 2009; 65:351–357.

[CLSI] Clinical and Laboratory Standards Institute. Performance Standards for Antimicrobial Susceptibility Testing 2006, Sixteenth International M100–S16. PA: CLSI, 2006.

Cui

, Li

, Hu

et al. Isolation and characterization of methicillin-resistant Staphylococcus aureus from swine and workers in China. J Antimicrob Chemother, 2009; 64:680–683.

Cuny

, Friedrich

, Kozytska

et al. Emergence of methicillin-resistant Staphylococcus aureus (MRSA) in different animal species. Int J Med Microbiol, 2010; 300:109–117.

de Boer

, Zwartkruis-Nahuis

, Wit

et al. Prevalence of methicillin-resistant Staphylococcus aureus in meat. Int J Food Microbiol, 2009; 134:52–56.

de Neeling

, van den Broek

, Spalburg

et al. High prevalence of methicillin resistant Staphylococcus aureus in pigs. Vet Microbiol, 2007; 122:366–372.

10.

Feil

, Cooper

, Grundmann

et al.

How clonal is Staphylococcus aureus?

J Bacteriol, 2003; 185:3307–3316.

11.

Grundmann

, Hori

, Enright

et al. Determining the genetic structure of the natural population of Staphylococcus aureus: a comparison of multilocus sequence typing with pulsed-field gel electrophoresis, randomly amplified polymorphic DNA analysis, and phage typing. J Clin Microbiol, 2002; 40:4544–4546.

12.

Hasman

, Moodley

, Guardabassi

et al. Spa type distribution in Staphylococcus aureus originating from pigs, cattle and poultry. Vet Microbiol, 2010; 141:326–331.

13.

, Chuang

, Choi

et al. Community-associated methicillin-resistant and methicillin-sensitive Staphylococcus aureus: skin and soft tissue infections in Hong Kong. Diagn Microbiol Infect Dis, 2008; 61:245–250.

14.

Huber

, Koller

, Giezendanner

et al. Prevalence and characteristics of methicillin-resistant Staphylococcus aureus in humans in contact with farm animals, in livestock, and in food of animal origin, Switzerland, 2009. Euro Surveill, 2010; 15:7–10.

15.

Jorgensen

, Mork

, Hogasen

et al. Enterotoxigenic Staphylococcus aureus in bulk milk in Norway. J Appl Microbiol, 2005; 99:158–166.

16.

Kluytmans-VandenBergh

, Kluytmans

. Community-acquired methicillin-resistant Staphylococcus aureus: current perspectives. Clin Microbiol Infect, 2006; 12:9–15.

17.

Kluytmans

. Methicillin-resistant Staphylococcus aureus in food products: cause for concern or case for complacency? Clin Microbiol Infect, 2010; 16:11–15.

18.

Lee

. Methicillin (Oxacillin)-resistant Staphylococcus aureus strains isolated from major food animals and their potential transmission to humans. Appl Environ Microbiol, 2003; 69:6489–6494.

19.

Lowy

. Antimicrobial resistance: the example of Staphylococcus aureus. J Clin Invest, 2003; 111:1265–1273.

20.

McDougal

, Steward

, Killgore

et al. Pulsed-field gel electrophoresis typing of oxacillin-resistant Staphylococcus aureus isolates from the United States: establishing a national database. J Clin Microbiol, 2003; 41:5113–5120.

21.

Mellmann

, Weniger

, Berssenbrugge

et al. Based Upon Repeat Pattern (BURP): an algorithm to characterize the long-term evolution of Staphylococcus aureus populations based on spa polymorphisms. BMC Microbiol, 2007; 7:98.

22.

Noguchi

, Nakaminami

, Nishijima

et al. Antimicrobial agent of susceptibilities and antiseptic resistance gene distribution among methicillin-resistant Staphylococcus aureus isolates from patients with impetigo and staphylococcal scalded skin syndrome. J Clin Microbiol, 2006; 44:2119–2125.

23.

Normanno

, Firinu

, Virgilio

et al. Coagulase-positive Staphylococci and Staphylococcus aureus in food products marketed in Italy. Int J Food Microbiol, 2005; 98:73–79.

24.

Normanno

, La Salandra

, Dambrosio

et al. Occurrence, characterization and antimicrobial resistance of enterotoxigenic Staphylococcus aureus isolated from meat and dairy products. Int J Food Microbiol, 2007; 115:290–296.

25.

Perez

LRR

, Dias

, d'Azevedo

. Agar dilution and agar screen with cefoxitin and oxacillin: what is known and what Is unknown in detection of methicillin-resistant Staphylococcus aureus. J Med Microbiol, 2008; 57:954–956.

26.

Pinho

, de Lencastre

, Tomasz

. An acquired and a native penicillin-binding protein cooperate in building the cell wall of drug-resistant staphylococci. Proc Natl Acad Sci U S A, 2001; 98:10886–10891.

27.

Struelens

, Hawkey

, French

et al. Laboratory tools and strategies for methicillin-resistant Staphylococcus aureus screening, surveillance and typing: state of the art and unmet needs. Clin Microbiol Infect, 2009; 15:112–119.

28.

Sudagidan

, Aydin

. Virulence properties of methicillin-susceptible Staphylococcus aureus food isolates encoding Panton-Valentine Leukocidin gene. Int J Food Microbiol, 2010; 138:287–291.

29.

Vancraeynest

, Hermans

, Haesebrouck

. Prevalence of genes encoding exfoliative toxins, leucotoxins and superantigens among high and low virulence rabbit Staphylococcus aureus strains. Vet Microbiol, 2006; 117:211–218.

30.

Wang

, Yang

, Luo

et al. Antimicrobial resistance and detection of mecA, qacA/B and PVL genes in Staphylococcus aureus. China J Clin Infect, 2009; 2:102–105.

31.

Witte

, Strommenger

, Stanek

et al. Methicillin-resistant Staphylococcus aureus ST398 in humans and animals, Central Europe. Emerg Infect Dis, 2007; 13:255–258.

32.

Xia

, Meng

, McDermott

et al. Presence and characterization of shiga toxin-producing Escherichia coli and other potentially diarrheagenic E. coli strains in retail meats. Appl Environ Microbiol, 2010; 76:1709–1717.

33.

Zecconi

, Cesaris

, Liandris

et al. Role of several Staphylococcus aureus virulence factors on the inflammatory response in bovine mammary gland. Microb Pathog, 2006; 40:177–183.

34.

Zhang

, McClure

, Elsayed

et al. Novel multiplex PCR assay for characterization and concomitant subtyping of staphylococcal cassette chromosome mec types I to V in methicillin-resistant Staphylococcus aureus. J Clin Microbiol, 2005; 43:5026–5033.

35.

Zhang

, Sparling

, Chow

et al. New quadriplex PCR assay for detection of methicillin and mupirocin resistance and simultaneous discrimination of Staphylococcus aureus from coagulase-negative staphylococci. J Clin Microbiol, 2004; 42:4947–4955.