Isolation and Characterization of Shiga Toxin–Producing Escherichia coli (STEC) in Retail Edible Beef By-products

Abstract

The prevalence of Shiga toxin–producing Escherichia coli (STEC) was investigated in 350 edible beef intestinal samples, including omasum (n=110), abomasum (n=120), and large intestines (n=120), collected from traditional beef markets in Seoul, Korea. A total of 23 STEC strains were isolated from 15 samples (four strains from three omasa, 10 from five abomasa, and nine from seven large intestines). The O serotypes and toxin gene types of all STEC isolates were identified, and antimicrobial resistance was assessed using the disk diffusion method. The isolation rates of STEC from edible beef intestines were 2.8% in omasum, 4.2% in abomasums, and 5.9% in large intestines. All STEC isolates harbored either stx1, or both stx1 and stx2 genes simultaneously. Among the 23 isolates, 13 strains were identified as 11 different O serogroups, and 10 strains were untypable. However, enterohemorrhagic Esherichia coli O157, O26, and O111 strains were not isolated. The highest resistance rate observed was against tetracycline (39%), followed by streptomycin (35%) and ampicillin (22%). Of the 23 isolates, 12 isolates (52%) were resistant to at least one antibiotic, nine (39%) isolates were resistant to two or more antibiotics, and one isolate from an abmasum carried resistance against nine antibiotics, including beta-lactam/beta-lactamase inhibitor in combination and cephalosporins. This study shows that edible beef by-products, which are often consumed as raw food in many countries, including Korea, can be potential vehicles for transmission of antimicrobial-resistant pathogenic E. coli to humans.

Introduction

M ost Shiga toxin–producing Escherichia coli (STEC) outbreaks are associated with the consumption of undercooked ground beef, raw milk, and fresh produce, or water contaminated by cattle feces (Hussein, 2007; Varela-Hernandez et al., 2007). Although various STEC strains have been isolated from animals such as pigs and chickens, cattle are considered the main reservoir of STEC (Barlow et al., 2006; Auvray et al., 2007; Varela-Hernandez et al., 2007).

Several studies have been carried out around the world to determine the prevalence and characterization of STEC, mainly O157 STEC, in ground beef, on carcasses after slaughter, and in cattle feces (Hornitzky et al., 2001; Hussein, 2007; Mora et al., 2007a,b; Roopnarine et al., 2007; Oporto et al., 2008). STEC strains are often found in the intestines of cattle and on beef carcasses contaminated during slaughter operations (i.e., hide removal and evisceration) (Auvray et al., 2007; Hussein, 2007; Varela-Hernandez et al., 2007). In addition, STEC O157 was recently isolated along the entire cattle gastrointestinal tract (GIT), including the rumen, omasum, abomasum, and intestines (Keen et al., 2010). Although in many countries including Korea, most cattle GIT are consumed and some of them are eaten raw, there are only a few reports on the prevalence of STEC in edible beef by-products in retail markets. Beef by-products are important in the production of a variety of edible and inedible products, and there is additional potential for expanded uses of beef by-products in industrial, pharmaceutical, food manufacturing, leather, and animal feed applications. Edible beef by-products are often consumed as raw food in delicatessen restaurants in many countries, including Korea. Beef by-products have a higher possibility of being contaminated with enteric pathogens in cattle feces than other beef products during the slaughtering process. Therefore, they can be great potential vehicles for transmission of antimicrobial-resistant pathogens to humans.

In recent years, the occurrence of antibiotic-resistant strains of various pathogenic bacteria has been an increasing threat to animal and human health (Lee, 2009). Enterohemorrhagic Escherichia coli (EHEC) was considered sensitive to multiple classes of antibiotics, but recent studies have reported an increase in antibiotic resistance in human EHEC isolates (You et al., 2006; Lee, 2009). Therefore, monitoring the emergence of resistant bacterial strains in foods is a risk management strategy that can prevent the development and spread of antimicrobial resistance in microorganisms.

The purposes of this study were (i) to estimate the prevalence of STEC in retail beef by-products (omasum, abomasum, and large intestines) at the point of sale, and (ii) to determine O serotype, toxin type, and the frequency of resistance against several antimicrobial agents.

Materials and Methods

Sample collection

A total of 350 edible beef by-product samples, including 110 omasa, 120 abomasa, and 120 large intestines, were purchased between July 2008 and June 2009 from traditional retail beef markets in Seoul, Korea. Samples were aseptically placed in ice container immediately after purchase and transported to the laboratory within 1 h for immediate processing.

Presumptive screening for STEC using real-time polymerase chain reaction (PCR) assay

Samples (50 g) were obtained from each food specimen, placed in a sterile bag, diluted 1:9 (wt/vol) in modified EC broth (mEC; Difco, Detroit, MI) supplemented with novobiocin (20 mg/L; Dallynn, Calgary, Canada), homogenized in a laboratory stomacher for 30 s, and incubated at 37°C for 24 h. The overnight enrichment cultures were presumptively screened for the presence of stx1 and stx2 genes according to the real-time PCR assay described next.

Real-time PCR for stx genes and toxin typing

For presumptive screening of the presence of stx genes, 1 mL of the overnight enrichment broth samples was centrifuged at 16,000×g for 3 min. The cell pellets were resuspended in 200 μL of PrepMan Ultra reagent (Applied Biosystems, Foster City, CA) and boiled for 10 min at 100°C. The boiled cell suspensions were cooled for 2 min at room temperature and centrifuged. DNA templates in the supernatants (200 μL) were transferred to clean tubes and stored at −20°C until use.

For confirmation of stx-positive isolates, suspect colonies sub-cultured to nutrient agar (Difco) were resuspended in 1 mL of PBS in centrifuge tubes and centrifuged at 16,000×g for 3 min. The supernatants were aspirated and discarded. The cell pellets were resuspended in 200 μL of DW. Samples were boiled for 10 min and cooled at room temperature for 2 min. After centrifugation at 16,000×g for 3 min, the supernatants were collected in new tubes for use as DNA templates.

The DNA templates (0.5 μL) were transferred to 24.5 μL of PCR reaction mix consisting of TaqMan Universal PCR mastermix (12.5 μL; Applied Biosystems), stx1 forward primer (2.5 μL), stx1 reverse primer (2.5 μL), stx1 probe (1 μL), stx2 forward primer (2.5 μL), stx2 reverse primer (2.5 μL), and stx2 probe (1 μL) in a 96-microwell plate. Primer and probe sequences are illustrated in Table 1 (Jinneman et al., 2003). The microwell plates were sealed and placed in an ABI-Prism 7500 (Applied Biosystems). The reaction was run at 50°C for 2 min and at 95°C for 10 min, followed by 40 cycles at 95°C for 15 s and at 60°C for 60 s. An E. coli strain of O157:H7, used as a positive control for the analysis of the stx1 and stx2 genes by real-time PCR, was obtained from the U.S. Food and Drug Administration (FDA, College Park, MD).

Table 1.

Real-Time Polymerase Chain Reaction (PCR) Oligonucleotide Primers and Probe Used in This Study

Toxin	Primers/probe	Sequence	Reference
stx1	Forward	GTGGCATTAATACTGAATTGTCATCA
	Reverse	GCGTAATCCCACGGACTCTTC
	Probe	FAM-TGATGAGTTTCCTTCTATGTGTCCGGCAGAT-BHQ1	(Jinneman et al., 2003)
stx2	Forward	GATGTTTATGGCGGTTTTATTTGC
	Reverse	TGGAAAACTCAATTTTACCTTTAGCA
	Probe	CY3-TCTGTTAATGCAATGGCGGCGGATT-BHQ2

Isolation of STEC strains using culture method

Stx genes–positive samples from real-time PCR assay were streaked onto sorbitol MacConkey agar (SMAC; Difco) and incubated at 37°C for 24 h for isolation of STEC strains. Five presumptive E. coli colonies per sample representing ether pink or white were randomly picked and then transferred onto nutrient agar, followed by incubation at 37°C for 24 h. The colonies with stx genes identified by real-time PCR were confirmed as E. coli with API 20E test strips (BioMérieux, Marcy l'Etoile, France). Isolates from the same sample with the same antibiotic susceptibility pattern were regarded as identical. All confirmed isolates were stored on protect beads (CryoCare™, Key Scientific Products, Round Rock, TX) and were frozen at −70°C for serotyping.

Antimicrobial susceptibility test

The antibiotic susceptibility of STEC isolates was determined by the disk diffusion method according to the recommendation of the Clinical and Laboratory Standards Institute (CLSI, 2006), formerly National Committee for Clinical Laboratory Standards (NCCLS), using the Muller-Hinton agar and 17 antimicrobial agents. Antimicrobial Susceptibility Test Disc (Oxoid, Hampshire, UK) was used with the antibiotic concentrations as follows: 10 μg ampicillin, 30 μg amoxicillin/clavulanic acid, 30 μg cefazolin, 30 μg cephalothin, 10 μg gentamicin, 10 μg streptomycin, 30 μg amikacin, 30 μg cefepime, 30 μg cefoxitin, 30 μg cefotaxim, 5 μg ciprofloxacin, 5 μg enrofloxacin, 10 μg norfloxacin, 10 μg imipenem, 25 μg sulfamethoxazole/trimethoprim, 30 μg chloramphenicol, and 30 μg tetracycline. The results were recorded by measuring the inhibition zones and were scored as sensitive, intermediate, and resistant according to the recommendation of the CLSI. E. coli ATCC 25922 was used as the reference strain.

O serotyping

The 23 STEC isolates identified with the real-time PCR and confirmed as E. coli with the API 20E test were serotyped at the Korea Centers for Disease Control and Prevention (KCDC, Cheongwon-gun, Chungbuk, Korea). Serotyping of O (lipopolysaccharide) antigen was performed with O specific rabbit antisera (Laboratorio de Referencia de E. coli [LREC], Lugo, Spain). Antigens O1 to O181 were investigated as follows. The identified STEC strains were streak-plated onto tryptic soy agar (Difco) and incubated at 37°C for 24 h. A single colony of the strains was carefully harvested by a loop and suspended in 2 mL of 0.85% saline. After boiling at 100°C for 1 h, the suspension was cooled down in ice for 15 min and centrifuged at 13000 rpm for 2 min. The suspension was transferred into 2 mL of crystal violet and used as O-antigen solution. All antisera were tested against the O-antigens to confirm whether agglutination reaction occurred.

Results

Prevalence of STEC in edible beef by-products

During this study, a total of 350 edible beef by-product samples were screened for the presence of stx1and stx2 genes using real-time PCR. The number of samples that contained at least one positive stx gene from the omasum, abomasums, and large intestines was 16/110 (14.5%), 11/120 (9.2%), and 8/120 (6.7%), respectively (Table 2). Among the PCR-positive samples, three (2.8%) of omasa, five (4.2%) of abomasa, and seven (5.9%) of large intestines were confirmed to be STEC culture positive. A total of 23 STEC strains were isolated, including multiple strains from the same STEC culture–positive samples: four from three omasa, 10 from five abomasa, and nine from seven large intestines (Table 2).

Table 2.

Number of Shiga Toxin–Producing Escherichia coli (STEC) from Omasum, Abomasum, and Large Intestines

Samples	No. of samples	No. of stx-positive samples (%)	No. of STEC culture–positive samples (%)	No. of STEC isolates
Omasum	110	16 (14.5%)	3 (2.8%)	4
Abomasum	120	11 (9.2%)	5 (4.2%)	10
Large intestines	120	8 (6.7%)	7 (5.9%)	9
Total	350	35 (10%)	15 (4.3%)	23

O serotypes and toxin types

The 23 STEC strains isolated from beef by-products belonged to 11 E. coli serogroups O (i.e., O21 and O23 from omasa; O18, O75, O84, and O117 from abomasa; and O5, O36, O110, O113, and O150 from large intestines) (Table 3). Ten of the STEC strains (43.5%) showed non-typeable (OUT) O-antigens distinct from O1 to O181 (Table 3).

Table 3.

Serotype and Toxin Type of Shiga Toxin–Producing Escherichia coli (STEC) Isolated in This Study

Sample	Serotype	Toxin type
Omasum	O21	stx1
	O23	stx1
	OUT^a	stx1, stx2
	OUT	stx1
Abomasum	O18	stx1
	O75	stx1
	O84	stx1, stx2
	O84	stx1
	O117	stx1, stx2
	OUT	stx1, stx2
	OUT	stx1
	OUT	stx1
	OUT	stx1
	OUT	stx1
Large intestines	O5	stx1
	O36	stx1
	O110	stx1
	O113	stx1, stx2
	O150	stx1
	O150	stx1, stx2
	OUT	stx1
	OUT	stx1
	OUT	stx1, stx2

^*O serotype was non-typeable.

Real-time PCR assay showed that 16 (69.6%) STEC isolates carried only the stx1 gene, none of the isolates carried only stx2, and seven(30.4%) STEC isolates carried both stx1 and stx2 genes (Table 3).

Antimicrobial susceptibility of STEC isolates

The antibiotic susceptibility of the 23 STEC isolates is summarized in Table 4. For 17 antimicrobial agents tested, the highest resistance rate observed was against tetracycline (39%), followed by streptomycin (35%), ampicillin (22%), ciprofloxacin, enrofloxacin, norfloxacin, sulfamethoxazole/trimethoprim, and chloramphenicol (13%). In this study, 12 isolates (52%) were resistant to at least one antibiotic and nine (39%) isolates were resistant to two or more antibiotics. Among these nine isolates, four STEC isolates exhibited resistance against ampicillin-streptomycin-tetracycline, and three STEC isolates exhibited resistance against ciprofloxacin-enrofloxacin-norfloxacin-tetracycline (data not shown). An isolate from the abomasum carried resistance against nine antibiotics, including beta-lactam/beta-lactamase inhibitor combination (amoxicillin/clavulanic acid) and cephalosporins (cephalothin, cefazolin, and cefoxitin), and another isolate from abomasum carried resistance against eight antibiotics, including quinolones (ciprofloxacin, norfloxacin, and enrofloxacin) (data not shown).

Table 4.

Antimicrobial Resistance Among 23 Shiga Toxin–Producing Escherichia coli (STEC) Isolated in This Study

Antimicrobial drug	No. of resistant strains	Resistance (%)
Ampicillin 10 μg	5	22
Amoxicillin/clavulanic acid 30 μg	1	4
Cefazolin 30 μg	1	4
Cephalothin 30 μg	1	4
Gentamicin 10 μg	2	9
Streptomycin 10 μg	8	35
Amikacin 30 μg	1	4
Cefepime 30 μg	0	0
Cefoxitin 30 μg	1	4
Cefotaxim 30 μg	0	0
Ciprofloxacin 5 μg	3	13
Enrofloxacin 5 μg	3	13
Norfloxacin 10 μg	3	13
Imipenem 10 μg	0	0
Sulfamethoxazole/trimethoprim 25 μg	3	13
Chloramphenicol 30 μg	3	13
Tetracycline 30 μg	9	39

Discussion

STEC are known to cause symptoms ranging from mild diarrhea to life-threatening clinical manifestations in humans (Hussein, 2007). To our knowledge, this is the first report on the isolation and characterization of STEC in edible beef by-products in Korea. In this study, the prevalence of STEC in retail edible beef by-products omasum, abomasum, and large intestines was evaluated at the point of sale. The prevalence of STEC in beef by-products was 10% in overnight enrichment culture using real-time PCR, but 4.3% was confirmed using the culture method. This could be due to interference with culture isolation by numerous microflora in the intestinal samples. In addition, numerous STEC surveillance studies of beef cattle and their products have been conducted in many countries, where the prevalence of STEC in ground beef has been higher than in this study, 14∼40% (Elder et al., 2000; Kobayashi et al., 2001; Barlow et al., 2006; Dhanashree and Mallya, 2008). Our results suggested that the potential for beef by-products being contaminated with STEC is significant, but less than for meat or other meat products. This difference may be caused by different processing methods such as an extra washing procedure following slaughter, which could lead to a substantial reduction of bacterial load. Typically, the beef by-products are thoroughly rinsed to remove intestinal contents after evisceration and stored in a designated container for the edible product only at refrigeration temperature.

The major components of the pathogenicity of STEC are stx1 and stx2. Although it is not necessary for a STEC strain to express stx1 and/or stx2 to cause illness in humans, among human conditions associated with the STEC strains those producing stx2 appear to be more frequently responsible for serious complications, such as Hemolytic Uremic Syndrome (HUS), than those producing only Shiga toxin type 1 (stx1) (Jo et al., 2004; Jeon et al., 2006). Several studies reported that various STEC serotypes have been isolated from ground beef and cattle feces, including the O157 serotype. The five main pathogenic STEC O serotypes (O26, O103, O111, O145, and O157) were not isolated from the beef by-products evaluated in this study. According to a classification of STEC serotypes reported by Karmali et al. (2003), all STEC serotypes in this study are characterized as isolates capable of causing low incidence of human disease, are rarely associated with outbreaks, and do not cause severe illnesses in human. Because of the relatively low prevalence of the EHEC strains in Korean cattle (Jeon et al., 2006; Lee et al., 2008), extensive prevalence research would be required in future study to estimate the exact prevalence of STEC in retail beef by-products.

High variability in the prevalence of antimicrobial resistance was observed among 23 STEC isolates from beef offal showing no differences between toxin types or serotypes in this study. Lee (2009) reported that, among 37 O26 and 25 O111 STEC strains isolated from the fecal specimens of cattle in Korea, respectively, 26 (70%) and 15 (60%) were resistant to at least one antibiotic, showing a higher resistance rate than that (54%) reported in the current study. You et al. (2006) also found that 32 (71%) of 45 E. coli O157 isolates from cattle were resistant to at least one of 22 antibiotics tested in Korea. In contrast to a previous study (Lee, 2009), where E. coli O26 strains from beef cattle were most resistant to ampicillin, STEC strains from beef offal in this study were most resistant to streptomycin, followed by tetracycline. However, our results are consistent with the highest prevalence of antimicrobial resistance against tetracycline in O111 and streptomycin in O157 reported by previous studies (You et al., 2006; Lee, 2009). An isolate from the abomasum in this study carried resistance against nine antibiotics, including beta-lactam/beta-lactamase inhibitor combination and cephalosporins, and another isolate from abomasum carried resistance against eight antibiotics, including quinolones. The investigators of those studies attributed the high prevalence of antimicrobial-resistant STEC strains in Korea to the abusive use of antibiotics, including uncontrolled addition of antimicrobial agents to animal feeds or water for therapeutic or prophylactic purpose, and use of antibiotics without veterinary prescription.

Conclusion

In conclusion, we evaluated the prevalence of STEC in the retail beef by-products omasum, abomasum, and large intestines, at the point of sale, and determined O serotype, toxin type, and the frequency of resistance against several antimicrobial agents. Although the most common pathogenic serotypes of STEC strains were not found in beef by-products, our data clearly show that the edible beef by-products, which are often consumed as raw food in delicatessen restaurants in Korea, could be potential vehicles for transmission of antimicrobial-resistant pathogenic E. coli to humans.

Footnotes

Acknowledgments

We gratefully acknowledge the assistance of Chang-Hyun Seong and Dong-Hyeon Kim. This work was carried out with the support of Cooperative Research Program for Agriculture Science and Technology Development (project PJ007195), Rural Development Administration, Republic of Korea. Jae-Hoon Lee, Ji-Yeon Hyeon, Yun-Gyeong Kim, Jung-Whan Chon, and Jun-Ho Park were also partially supported by the Brain Korean 21 (BK21) Project from the Ministry of Education and Human Resources Development.

Disclosure Statement

No competing financial interests exist.

References

Auvray

, Lecureuil

, Tache

, Leclerc

, Deperrois

, Lombard

. Detection, isolation and characterization of Shiga toxin–producing Escherichia coli in retail-minced beef using PCR-based techniques, immunoassays and colony hybridization. Lett Appl Microbiol, 2007; 45:646–651.

Barlow

, Gobius

, Desmarchelier

. Shiga toxin–producing Escherichia coli in ground beef and lamb cuts: results of a one-year study. Int J Food Microbiol, 2006; 111:1–5.

[CLSI] Clinical and Laboratory Standards Institute. Methods for Antimicrobial Dilution and Disk Susceptibility Testing of Infrequently Isolated or Fastidious Bacteria. Approved Standard M45-A. Wayne, PA: Clinical and Laboratory Standards Institute, 2006.

Dhanashree

, Mallya

. Detection of shiga-toxigenic Escherichia coli (STEC) in diarrhoeagenic stool & meat samples in Mangalore, India. Indian J Med Res, 2008; 128:271–277.

Elder

, Keen

, Siragusa

, Barkocy-Gallagher

, Koohmaraie

, Laegreid

. Correlation of enterohemorrhagic Escherichia coli O157 prevalence in feces, hides, and carcasses of beef cattle during processing. Proc Natl Acad Sci U S A, 2000; 97:2999–3003.

Hornitzky

, Bettelheim

, Djordjevic

. The detection of Shiga toxin–producing Escherichia coli in diagnostic bovine faecal samples using vancomycin-cefixime-cefsulodin blood agar and PCR. FEMS Microbiol Lett, 2001; 198:17–22.

Hussein

. Prevalence and pathogenicity of Shiga toxin–producing Escherichia coli in beef cattle and their products. J Anim Sci, 2007; 85:E63–E72.

Jeon

, Jeong

, Won

, Park

, Eo

, Kang

, Hur

, Lee

. Prevalence and characteristics of Escherichia coli O26 and O111 from cattle in Korea. Int J Food Microbiol, 2006; 110:123–126.

Jinneman

, Yoshitomi

, Weagant

. Multiplex real-time PCR method to identify Shiga toxin genes stx1 and stx2 and Escherichia coli O157:H7/H- serotype. Appl Environ Microbiol, 2003; 69:6327–6333.

10.

, Kim

, Lim

, Kang

, Koh

, Park

, Yoon

, Chae

, Eo

, Lee

. Prevalence and characteristics of Escherichia coli O157 from major food animals in Korea. Int J Food Microbiol, 2004; 95:41–49.

11.

Karmali

, Mascarenhas

, Shen

, Ziebell

, Johnson

, Reid-Smith

, Isaac-Renton

, Clark

, Rahn

, Kaper

. Association of genomic O island 122 of Escherichia coli EDL 933 with verocytotoxin-producing Escherichia coli seropathotypes that are linked to epidemic and/or serious disease. J Clin Microbiol, 2003; 41:4930–4940.

12.

Keen

, Laegreid

, Chitko-McKown

, Durso

, Bono

. Distribution of Shiga-toxigenic Escherichia coli O157 in the gastrointestinal tract of naturally O157-shedding cattle at necropsy. Appl Environ Microbiol, 2010; 76:5278–5281.

13.

Kobayashi

, Shimada

, Nakazawa

, Morozumi

, Pohjanvirta

, Pelkonen

, Yamamoto

. Prevalence and characteristics of shiga toxin–producing Escherichia coli from healthy cattle in Japan. Appl Environ Microbiol, 2001; 67:484–489.

14.

Lee

. Antimicrobial resistance of Escherichia coli O26 and O111 isolates from cattle and their characteristics. Vet Microbiol, 2009; 135:401–405.

15.

Lee

, Hur

, Stein

. Occurrence and characteristics of enterohemorrhagic Escherichia coli O26 and O111 in calves associated with diarrhea. Vet J, 2008; 176:205–209.

16.

Mora

, Blanco

, Dahbi

, Lopez

, Justel

, Alonso

, Echeita

, Bernardez

, Gonzalez

, Blanco

. Serotypes, virulence genes and intimin types of Shiga toxin (verocytotoxin)–producing Escherichia coli isolates from minced beef in Lugo (Spain) from 1995 through 2003. BMC Microbiol, 2007a. 7:13.

17.

Mora

, Leon

, Blanco

, Lopez

, Dahbi

, Echeita

, Gonzalez

, Blanco

. Phage types, virulence genes and PFGE profiles of Shiga toxin–producing Escherichia coli O157:H7 isolated from raw beef, soft cheese and vegetables in Lima (Peru) Int J Food Microbiol, 2007b. 114:204–210.

18.

Oporto

, Esteban

, Aduriz

, Juste

, Hurtado

. Escherichia coli O157:H7 and non-O157 Shiga toxin–producing E. coli in healthy cattle, sheep and swine herds in Northern Spain. Zoonoses Public Health, 2008; 55:73–81.

19.

Roopnarine

, Ammons

, Rampersad

, Adesiyun

. Occurrence and characterization of verocytotoxigenic Escherichia coli (VTEC) strains from dairy farms in Trinidad. Zoonoses Public Health, 2007; 54:78–85.

20.

Varela-Hernandez

, Cabrera-Diaz

, Cardona-Lopez

, Ibarra-Velazquez

, Rangel-Villalobos

, Castillo

, Torres-Vitela

, Ramirez-Alvarez

. Isolation and characterization of Shiga toxin–producing Escherichia coli O157:H7 and non-O157 from beef carcasses at a slaughter plant in Mexico. Int J Food Microbiol, 2007; 113:237–241.

21.

You

, Moon

, Oh

, Baek

, Li

, Kim

, Stein

, Lee

. Antimicrobial resistance of Escherichia coli O157 from cattle in Korea. Int J Food Microbiol, 2006; 106:74–78.