Anisakis simplex sensu stricto and Anisakis pegreffii : Biological Characteristics and Pathogenetic Potential in Human Anisakiasis

Abstract

Anisakiasis is one of the most common fishborne helminthic diseases in Japan, which is contracted by ingesting the larvae of the nematode Anisakis spp. carried by marine fish. Anisakis simplex sensu stricto (s.s.) and A. pegreffii are the dominant species in fish caught offshore Japan. The present study aimed to identify the anisakid species infecting Japanese patients and determine whether there is any difference in the pathogenetic potential of A. simplex (s.s.) and A. pegreffii. In total, 41 and 301 Anisakis larvae were isolated from Japanese patients and chub mackerel (Scomber japonicus), respectively; these were subjected to molecular identification using polymerase chain reaction targeted at a ribosomal DNA internal transcribed spacer region. Chub mackerel larvae were further examined for survival in artificial gastric juice (pH 1.8) for 7 days and for invasiveness on 0.75% solid agar over a 24-h interval. All clinical isolates, including those of asymptomatic, acute, and chronic infections as well as those from the stomach, small intestine, colon, and stool, were identified as A. simplex (s.s.). Chub mackerel harbored A. simplex (s.s.) and A. pegreffii larvae, together with a few larvae of other anisakid species. A. simplex (s.s.) larvae from chub mackerel tolerated the artificial gastric juice better than A. pegreffii, with 50% mortality in 2.6 and 1.4 days, respectively. In addition, A. simplex (s.s.) penetrated the agar at significantly higher rates than A. pegreffii. These results show that A. simplex (s.s.) larvae have the potential to survive acidic gastric juice to some extent and penetrate the stomach, small intestine, or colon in infected humans.

Introduction

A nisakiasis, one of the most common foodborne helminthic diseases in Japan, is acquired through the consumption of raw or undercooked marine fish or squid contaminated with Anisakis larvae. The majority of anisakiasis cases have been reported in Japan, where the consumption of raw fish is popular, with approximately 2000 cases annually compared with only approximately 70 cases in the United States and approximately 500 cases in Europe (Ishikura, 2003; Chai et al., 2005). In addition to gastric and intestinal anisakiasis caused by anisakid larvae penetrating the gut mucosa, the discovery of hypersensitivity reactions to thermostable Anisakis allergens has further emphasized the need to consider the etiologic factors in fish consumption-related urticaria (Kasuya et al., 1990; Audicana and Kennedy, 2008).

The majority of clinical isolates have been identified morphologically as Anisakis type I larvae according to the classification by Berland (1961), but molecular studies in the last 20 years have revealed that Anisakis type I comprises several species, including Anisakis simplex sensu stricto (s.s.), A. pegreffii, A. simplex C, A. typica, and A. ziphidarum (Mattiucci and Nascetti, 2008). Morphological comparison of A. simplex (s.s.) and A. pegreffii larvae showed a significant difference in ventricular length (Quiazon et al., 2008), although comparative studies with other type I larvae have not been performed. In addition, a few cases of Anisakis type II larval infections corresponding to A. physeteris have been reported from the southern islands of Japan (Kagei et al., 1978; Asato et al., 1991).

Recent molecular studies of clinical isolates have shown that, in Japan, anisakiasis is caused almost exclusively by A. simplex (s.s.) larvae (99 of 100 isolates examined), with only one isolate identified as A. pegreffii despite the abundance of larvae of the latter species in fish caught offshore (Umehara et al., 2007). In Italy, where A. pegreffii is the dominant species, three clinical cases have been attributed to A. pegreffii, but not one due to A. simplex (s.s.) has been reported to date (D'Amelio et al., 1999; Fumarola et al., 2009). So far, human A. pegrefii infection has not been reported in other countries. The dominance of A. simplex (s.s.) over A. pegreffii as the causative agent of human anisakiasis in Japan suggests that there may be pathogenetic differences between Anisakis species.

Anisakiasis has a broad spectrum of clinical manifestations. In approximately 95% of clinical cases, larvae penetrate the stomach mucosa, whereas in the remaining cases, larvae have been found in the mucosa of the small intestine, particularly the ileum, and less commonly in the colonic mucosa (Ishikura, 2003). Moreover, extraintestinal anisakiasis, in which larvae migrate into the abdominal cavity, has been reported. Anisakiasis can be asymptomatic, acute (or subacute) symptomatic, or chronic symptomatic. In the majority of cases, the larvae penetrate the mucosa with their anterior extremity only; however, in some cases, the larvae burrow their entire body into the gastrointestinal wall, resulting in an eosinophilic abscess or fibrous granuloma in chronic cases (Oshima, 1972). However, it remains uncertain whether A. simplex (s.s.) larvae are responsible for any of the various clinicopathological forms of anisakiasis in Japan and whether there is any difference in the pathogenicity among Anisakis species. Anisakis worms parasitize cetaceans as their natural final host and do not survive for long in humans. In this respect, the survivability of Anisakis larvae in humans is one of the most fundamental determinants of their pathogenicity.

Thus, to determine whether there was any difference in the Anisakis species between the specimens retrieved from different tissues of the gastrointestinal tracts, we first performed the molecular identification of Anisakis isolates retrieved from various sites in the human gastrointestinal tract. We then determined whether there was any difference between Anisakis species in term of their survivability in acidic gastric juice. Thus, we tested the acid tolerance and penetrative behavior of A. simplex (s.s.) and A. pegreffii larvae obtained from chub mackerel by conducting experiments in vitro, which simulated the physiological environment of the human stomach.

Materials and Methods

Anisakis larvae from humans

In total, 41 anisakid larvae were obtained from 23 patients 20–72 years old (19 males, 20 females, and 2 subjects for whom information on gender was unavailable) between 2006 and 2010 (Table 1). All patients were Japanese, living in Kyoto or Nara Prefecture in the central part of Honshu Island. All cases were those of sporadic occurrence, including no outbreak cases. The numbers of anisakid larvae extracted from these individuals ranged from 1 to 10 (average, 2.1; median, 1.0). The isolates were fixed in formalin for several days and then preserved in 70% alcohol until DNA extraction. The majority of larvae were morphologically identified as Anisakis type I (sensu Berland), whereas the morphotypes of some larvae were undetermined because of the damage caused by endoscopic forceps.

Table 1.

Anisakis Larvae from Japanese Patients

			Developmental stage
Location of larvae	Number of patients	No. of larvae	L3	L4	ND
Stomach^a	19	35	22	6	7
Stomach^b	1	1	—	—	1
Small intestine^c	1	2	—	2	—
Colon^a	1	1	1	—	—
Stool^d	1	2	2	—	—
Total	23	41	25	8	8

Larvae extracted by endoscopy.

Larvae in the submucosal granuloma in partially resected stomach.

Larvae extracted by partial resection of small intestine.

Larvae passed in a patient's stool.

ND, not determined.

Anisakis larvae from fish

In total, 41 fresh, ungutted chub mackerel (Scomber japonicus) stored on ice were purchased from local fish markets in Kyoto during 2010 and 2011. Of these, 26 mackerel were from the Pacific coast of Honshu Island (Pacific stock), and 15 were from the coast of Kyushu Island facing the southern Sea of Japan and the eastern part of the East China Sea (Tsushima Current stock). Larvae were collected either from the body cavity or from the musculature by slicing the muscle at a thickness of 3–5 mm. The majority of larvae were identified as Anisakis type I, although Anisakis type II, Raphidascaris spp., and Contracaecum spp. were found occasionally. The collected larvae were immediately subjected to in vitro experiments or immersed in 70% alcohol and stored at −20°C until DNA extraction.

Molecular identification of Anisakis species

Anisakis type I larvae obtained from humans and fish were subjected to molecular identification by real-time polymerase chain reaction (PCR), using species-specific primers for A. simplex (s.s.), A. pegreffii, and A. simplex C. In brief, DNA was extracted using a QIAamp^® DNA Mini Kit (Qiagen GmbH, Hilden, Germany). Appropriately diluted DNA was mixed with SYBR^® Green PCR master mix (Applied Biosystems, Foster City, CA) together with one of the three primer sets (AsF and AspR, ApF and AspR, or ACF and ACR) (0.1 μM) (Table 2), and amplification was performed using a real-time PCR system 7300 (Applied Biosystems) for 30 cycles. Thus, for a given sample, three PCR tubes, each containing one of the three primer sets, were assayed simultaneously, and Anisakis species was determined by comparing the three amplification plots. Except for one Anisakis type I specimen, real-time PCR resulted in discrete amplification by one of the three primer sets, showing Ct values that were smaller by 7–10 compared with those of the two other primer sets, allowing unambiguous species identification. The validity of these results was confirmed in 43 samples by direct sequencing of the ribosomal RNA (rDNA) internal transcribed spacer (ITS) 1–5.8S rRNA–ITS2 region, which was obtained by conventional PCR using the primers 5'-TGAACCTGCGGAAGGATCA-3' and 5'-CGGGTAATCACGACTGAGCT-3'. For one Anisakis type I specimen, for which no amplification was achieved with any of the primer sets, identification as A. typica was made by sequencing the rDNA ITS1–5.8S rRNA–ITS2 region. One Anisakis type II larva was identified as A. physeteris by sequencing the rDNA ITS1–5.8S rRNA–ITS2 region.

Table 2.

Primers Used for Real-Time Polymerase Chain Reaction for the Internal Transcribed Spacer Region of Anisakis Ssp.

Primer	Sequence	Complementary to (accession number, position)
AsF	AGTAGCTTAAGGCAGAGTTG	A. simplex (s.s.) (AY826723, 303–322)
ApF	AGCAGCTTAAGGCAGAGTCG	A. pegreffii (AY826720, 302–321)
ACF	AGCAGCTTAAGGCAGAGTTG	A. simplex C (AY826722, 302–321)
AspR	GCTTCACAGTCCAGAAAAAC	A. simplex (s.s.) (AY826723, 596–615) and A. pegreffii (AY826720, 595–614)
ACR	GCTTCACAGTCCAGAAAGAC	A. simplex C (AY826722, 595–614)

Primers were used in three combinations: AsF+AspR, ApF+AspR, and ACF+ACR, which are complementary to the sequences of A. simplex sensu stricto (s.s.), A. pegreffii, and A. simplex C, respectively.

Acid tolerance test

Either artificial gastric juice (pH 1.8) or control medium (pH 6.8) was prepared according to a published method (O'Gara et al., 2008). The medium consisted of 0.1% pepsin (Wako Chemicals, Osaka, Japan), 0.1% porcine stomach mucin (Sigma-Aldrich, St. Louis, MO), 0.12% NaCl, and 0.02% KCl. We added 1 M HCl to a final level of 2%, and the pH was further adjusted to 1.8 with 1 M HCl or to 6.8 using 1 M NaOH as a control medium. Twelve to 16 actively moving larvae collected from the body cavity of chub mackerel were incubated in 20 mL of artificial gastric juice or in the control medium in a 90-mm-diameter plastic dish at 37°C under a 5% CO₂ atmosphere. The medium was exchanged every 24 hours. Dead larvae were removed from the medium every 24 hours and stored in 70% alcohol until DNA extraction. After 7 days in vitro, all larvae were subjected to molecular identification at the species level using the real-time PCR method.

Agar penetration test

Anisakis larvae were collected as described above. Eight to 13 actively moving larvae were immersed in 10 mL of artificial gastric juice (pH 1.8); these larvae were immediately placed on top of a solid agar with a depth of 3 cm (0.75% agar and 0.9% NaCl), which had been prepared in a 125-mL screw-capped bottle. The bottles were incubated at 37°C under a 5% CO₂ atmosphere. After 24 hours, we counted the number of larvae present in the upper artificial gastric juice and those that had migrated to the lower solid agar layer. All larvae in the bottle were recovered and subjected to molecular identification using real-time PCR.

Results

Species of Anisakis larvae recovered from humans and fish

All 41 Anisakis larvae recovered from Japanese patients, including those from the stomach, small intestine, colon, and stool, were molecularly identified as A. simplex (s.s.) (Table 3). In contrast, chub mackerel harbored heterogeneous anisakid species, including A. simplex (s.s.), A. pegreffii, A. simplex C, A. typica, and A. physeteris. However, the Anisakis species structure in mackerel differed markedly between fish stocks captured off the Pacific coast of Honshu Island (Pacific stock) and those captured in the southern Sea of Japan or the eastern part of the East China Sea (Tsushima Current stock). In other words, the dominant species was A. simplex (s.s.) in the former, whereas it was A. pegreffii in the latter (Table 3).

Table 3.

Anisakis Species Found in Clinical and Fish Isolates

	No. of isolates (no. of hosts)
		Chub mackerel
Species	Human (23)	Pacific stock (26)	Tsushima Current stock (15)
A. simplex (s.s.)	41	146	5
A. pegreffii	0	14	131
A. simplex C	0	3	0
A. typica	0	1	0
A. physeteris	0	1	0
Total	41	165	136

A. simplex (s.s.), A. simplex sensu stricto.

Acid tolerance of A. simplex (s.s.) and A. pegreffii

Larvae of A. simplex (s.s.) and A. pegreffii were obtained from the chub mackerel derived from the Pacific stock and the Tsushima Current stock, respectively, and the mortality of larvae was tested in artificial gastric juice (pH 1.8) at 37°C under a 5% CO₂ atmosphere. The species of individual larvae subjected to these experiments was confirmed using real-time PCR after the experiments. Because we were unable to obtain chub mackerel from both stocks on the same day, six experiments (three for the larvae from Pacific stock and three for the larvae from Tsushima Current stock) were conducted independently on different days. Anisakis larvae died progressively in the artificial gastric juice with 50% mortality in 2.6 and 1.4 days in vitro for A. simplex (s.s.) and A. pegreffii, respectively (Fig. 1). The overall mean survival time was 3.2 and 2.3 days for a total of 44 A. simplex (s.s.) and 40 A. pegreffii larvae, respectively (p=0.036 by Wilcoxon–Mann–Whitney test). No larvae of either species died in the control medium (pH 6.8) for at least 7 days, with a molt of cuticle from the L3 to L4 stage occurring around Day 4 in vitro.

FIG. 1.

Tolerance of Anisakis simplex sensu stricto (s.s.) larvae and A. pegreffii larvae to artificial gastric juice (pH 1.8). Twelve to 16 larvae were incubated in artificial gastric juice (pH 1.8) at 37°C under a 5% CO₂ atmosphere. Results shown are those of six independent experiments, three for A. simplex (s.s.) and three for A. pegreffii. Short horizontal bars represent averages of three experiments for each species. Numbers in parentheses are p values (t test) between A. simplex (s.s.) and A. pegreffii at each time point. In control cultures at pH 6.8, no larvae died for 7 days.

Penetration of A. simplex (s.s.) and A. pegreffii larvae into agar

To determine the differences between A. simplex (s.s.) and A. pegreffii in the ability to penetrate mucosal tissue, Anisakis larvae obtained from the two stocks of chub mackerel were placed on solid agar overlaid with artificial gastric juice and incubated at 37°C under a 5% CO₂ atmosphere for 24 hours. Some A. simplex (s.s.) larvae penetrated the solid agar within 1 hour after the start of incubation. After 24 hours, significantly higher numbers of A. simplex (s.s.) than A. pegreffii had burrowed into the solid agar (Table 4). In contrast to the results of the acid tolerance tests described above, neither A. simplex (s.s.) nor A. pegreffii larvae died within 24 hours in agar penetration experiments, probably because of the gradual diffusion of artificial gastric juice into the solid agar that may have made the artificial gastric juice less acidic.

Table 4.

Penetration by Anisakis Larvae of Solid Agar

	No. of larvae that penetrated agar/total no. of larvae incubated ^a
Species	Ex 1	Ex 2	Ex 3	Ex 4	Ex 5	Larvae (%) that penetrated (mean±SD)	p value
A. simplex (s.s.)	9/12	2/11	9/13	8/11	6/11	57.9±23.6	0.004^b
A. pegreffii	3/13	2/12	2/11	0/8	1/12	13.3±9.1	0.021^c

Anisakis larvae in 10 mL of artificial gastric juice (pH 1.8) were placed on a 0.75% agar layer 3 cm deep and incubated at 37°C under a 5% CO₂ atmosphere for 24 hours. The species of individual larvae subjected to these experiments was confirmed by the real-time polymerase chain reaction method after experiments.

Five independent experiments were performed for each species.

By t test.

By Wilcoxon rank-sum test.

Discussion

Anisakiasis has a broad range of clinicopathological manifestations. The location of larvae also varies (that is, stomach, small intestine, colon, and abdominal cavity), although the majority of anisakiasis cases in Japan are of the acute-gastric type (Ishikura, 2003). The present results showed that all clinical isolates were A. simplex (s.s.), irrespective of whether they were isolated from the stomach, small intestine, or colon. Although clinical information was limited in most cases, at least one case was asymptomatic, with a larva found by gastroscopy during a routine health check. Approximately one-fourth of the present specimens were L4 larvae, indicating that they had parasitized the gastrointestinal tract for at least 3 or 4 days. These results show that A. simplex (s.s.) larvae have the potential to invade the mucosa of the stomach, small intestine, or colon.

Japanese anisakiasis patients often report the consumption of chub mackerel several hours or days before the onset of illness. However, chub mackerel harbors two dominant Anisakis species [that is, A. simplex (s.s.) in Pacific stocks and A. pegreffii in Tsushima Current stocks]. This difference has been well documented (Suzuki et al., 2010), although different distribution of relevant definitive hosts between the two sea areas has not been investigated to date. In large Japanese cities, fresh, unfrozen chub mackerel from both stocks is available all year round. Thus, it is uncertain why A. simplex (s.s.), and not A. pegreffii, larvae are the major cause of anisakiasis.

Previous studies have shown that A. simplex (s.s.) larvae in fish were found in the musculature as frequently as in the body cavity, whereas A. pegreffii larvae were rarely found in the former (Suzuki et al., 2010). Furthermore, experimental infections of fish with A. simplex (s.s.) larvae resulted in larval invasion of the musculature, whereas infections with A. pegreffii larvae did not (Quiazon et al., 2010). These reports indicate that accessibility (that is, the location of larvae in fish musculature that is prepared for sushi and sashimi) is likely to account for the dominance of A. simplex (s.s.) as the causative agent of anisakiasis in Japan.

However, other factors such as the adaptability (physiological tolerance) of the parasite may also contribute to the dominance of A. simplex (s.s.) as the causative agent of anisakiasis. A. simplex (sensu lato) parasitizes cetaceans such as whales and dolphins as its natural final host and generally, but not exclusively, parasitizes the nonglandular stomach (forestomach), which does not secrete acidic gastric juice (Herreras et al., 2004; Mead, 2007). Thus, the highly acidic human stomach may be a harsh environment for Anisakis larvae. Indeed, the present results indicated that Anisakis larvae were highly vulnerable to acidic artificial gastric juice compared with the control medium. However, A. simplex (s.s.) larvae survived the acidic artificial gastric juice for approximately 1 day more than A. pegreffii larvae. Furthermore, A. simplex (s.s.) had a significantly higher rate of agar penetration than A. pegreffii. The latter results are consistent with those of agar penetration experiments conducted at room temperature (Suzuki et al., 2010), and they show that A. simplex (s.s.) larvae possess a strong tissue-invasive trait relevant not only to fish musculature (Quiazon et al., 2011) but also to the human body. However, we cannot completely exclude the possibility that fish storage conditions affected the experimental result, and more comparative studies [for example, those using A. simplex (s.s.) and A. pegreffii larvae recovered from the same individual fish] are needed.

Moreover, A. pegreffii is irrefutably pathogenic to humans, and it has been responsible for at least three clinical cases in Italy, where it is the most dominant species in fish and squid (D'Amelio et al., 1999; Mattiucci and Nascetti, 2008; Fumarola et al., 2009). However, further study is needed to determine whether A. pegreffii larvae are as invasive and resistant to the human gastrointestinal tract as A. simplex (s.s.) larvae. In addition to Anisakis species-specific physiological traits, human physiological and immunological factors may play important roles in the evolution of anisakiasis. In this respect, it is relevant that an earlier study conducted in Japan found that more than 60% of the patients with gastric anisakiasis exhibited achlorhydria or hypoacidity of gastric juice (Oshima, 1972).

Conclusions

The present study showed that A. simplex (s.s.) larvae have the potential to invade the mucosa of the stomach, small intestine, and colon. A. simplex (s.s.) larvae are more tolerant to acidic juice and more prone to invade agar compared with A. pegreffii larvae, at least in certain in vitro conditions.

Footnotes

Acknowledgments

This work was supported in part by grants-in-aid from the Ministry of Health, Labour and Welfare of Japan (H20-Shinko).

Disclosure Statement

No competing financial interests exist.

References

Asato

, Wakura

, Sueyoshi

. A case of human infection with Anisakis physeteris larvae in Okinawa, Japan. Jpn J Parasitol, 1991; 40:181–183.

Audicana

, Kennedy

. Anisakis simplex: from obscure infectious worm to inducer of immune hypersensitivity. Clin Microbiol Rev, 2008; 21:360–379.

Berland

. Nematodes from some Norwegian marine fishes. Sarsia, 1961; 2:1–50.

Chai

, Darwin Murrell

, Lymbery

. Fish-borne parasitic zoonoses: status and issues. Int J Parasitol, 2005; 35:1233–1254.

D'Amelio

, Mathiopoulos

, Brandonisio

et al. Diagnosis of a case of gastric anisakidosis by PCR-based restriction fragment length polymorphism analysis. Parassitologia, 1999; 41:591–593.

Fumarola

, Monno

, Ierardi

et al. Anisakis pegreffi etiological agent of gastric infections in two Italian women. Foodborne Pathog Dis, 2009; 6:1157–1159.

Herreras

, Balbuena

, Aznar

et al. Population structure of Anisakis simplex (Nematoda) in harbor porpoises Phocoena phocoena off Denmark. J Parasitol, 2004; 90:933–938.

Ishikura

. Anisakiasis. 2. Clinical pathology and epidemiology. Progress of Medical Parasitology in Japan, 8 Otsuru

, Kamegai

, Hayashi

. Tokyo: Meguro Parasitological Museum, 2003; 451–473.

Kagei

, Sano

, Takahashi

et al. A case of abdominal syndrome caused by Anisakis Type-II larva. Jpn J Parasitol, 1978; 27:427–431.

10.

Kasuya

, Hamano

, Izumi

. Mackerel-induced urticaria and Anisakis. Lancet, 1990; 335:665.

11.

Mattiucci

, Nascetti

. Advances and trends in the molecular systematics of anisakid nematodes, with implications for their evolutionary ecology and host-parasite co-evolutionary processes. Adv Parasitol, 2008; 66:47–148.

12.

Mead

. Stomach anatomy and use in defining systemic relationships of the Cetacean family Ziphiidae (beaked whales) Anat Rec (Hoboken), 2007; 290:581–595.

13.

O'Gara

, Maslin

, Nevill

et al. The effect of simulated gastric environments on the anti-Helicobacter activity of garlic oil. J Appl Microbiol, 2008; 104:1324–1331.

14.

Oshima

. Anisakis and anisakiasis in Japan and adjacent area. Progress of Medical Parasitology in Japan, 4 Morishita

, Komiya

, Matsubayashi

. Tokyo: Meguro Parasitological Museum, 1972; 301–393.

15.

Quiazon

KMA

, Yoshinaga

, Ogawa

. Experimental challenge of Anisakis simplex sensu stricto and Anisakis pegreffii (Nematoda: Anisakidae) in rainbow trout and olive flounder. Parasitol Int, 2011; 60:126–131.

16.

Quiazon

KMA

, Yoshinaga

, Ogawa

et al.

Morphological differences between larvae and in vitro-cultured adults of Anisakis simplex (sensu stricto) and Anisakis pegreffii (Nematoda: Anisakidae)

Parasitol Int, 2008; 57:483–489.

17.

Suzuki

, Murata

, Hosaka

et al. Risk factors for human Anisakis infection and association between the geographic origins of Scomber japonicus and anisakid nematodes. Int J Food Microbiol, 2010; 137:88–93.

18.

Umehara

, Kawakami

, Araki

et al. Molecular identification of the etiological agent of the human anisakiasis in Japan. Parasitol Int, 2007; 56:211–215.