Characterization and Antimicrobial Resistance of Listeria monocytogenes Isolated from Retail Beef Meat in Poland

Abstract

Four hundred seventeen retail beef meat samples purchased in the eastern part of Poland during October 2009 to January 2011 were tested for the presence of Listeria monocytogenes. It was found that 81 (19.4%) of them were positive for this microorganism as identified by the culture and polymerase chain reaction (PCR) methods. Molecular serotyping performed by PCR revealed that the majority of the isolates (50 strains; 61.7%) were of 1/2a serotype. Furthermore, 26 (32.1%) L. monocytogenes strains were classified as 1/2c serotype, and only five strains belonged to serotypes 1/2b or 4b (four and one isolates, respectively). All the isolates were positive for the inlA, inlC, inlJ, and lmo2672 sequences, whereas two L. monocytogenes (both of 4b serotype) had another virulence marker gene—llsX. The results of the antimicrobial resistance revealed that the strains were sensitive to most of the antimicrobials used in the study except oxacillin (62.7% resistant strains). Several isolates (17.3%) were also resistant to ceftriaxone. Our results indicate that L. monocytogenes identified in raw beef meat possessed virulence markers that make them potentially pathogenic for humans. Therefore, this kind of food may create a public health concern.

Introduction

L isteria monocytogenes is a Gram-positive intracellular, ubiquitous microorganism that is widespread in the environment, especially in soil, grass, water, sewage, and wild animal feces, as well as in food processing facilities (Todd and Notermans, 2011). The bacteria may contaminate food of animal origin, especially smoked fish, soft cheeses, unpasteurized dairy products, and meat (Rhoades et al., 2009). One of the main animal reservoirs of this pathogen is cattle, where bacteria are present in gastrointestinal track and do not cause any clinical symptoms. Contamination of bovine carcasses during dressing processes in abattoirs may be a concern for food producers and consequently for consumers (Todd and Notermans, 2011). Recently, we have shown that 2.5% of such carcasses in Poland were positive for L. monocytogenes (Wieczorek et al., 2012). Taking into account a relatively long survival of this pathogen in food, it is very likely that the bacteria may be present in beef meat and beef meat products subjected to consumption, although research on this is rare (Rhoades et al., 2009; Todd and Notermans, 2011).

Listeriosis has a low incidence rate; 1,645 reported cases in 2009 were described in the European Union Member States (Anonymous, 2011). However, foodborne listeriosis is associated with a high mortality rate (Swaminathan and Gerner-Smidt, 2007; Todd and Notermans, 2011). It has been estimated that 270 persons died in 2009 due to listeriosis, and the mortality rate was 16.6% (Anonymous, 2011).

Identification of L. monocytogenes in food is usually performed by classical microbiological methods, followed by biochemical and serological confirmation. However, such detection and typing analysis are time- and cost-limited; therefore, it is increasingly being replaced by molecular serotyping techniques, mainly polymerase chain reaction (PCR). Doumith et al. (2004a) developed PCR to differentiate important foodborne L. monocytogenes serovars and to distinguish four main serogroups of genetic lineages I and II—1/2a, 1/2b, 1/2c, and 4b—which represent over 95% isolates recovered from food and clinical samples (Orsi et al., 2011). Several putative virulence factors of L. monocytogenes and their encoding genes have been described in strains recovered from human listeriosis cases (Kreft and Vazquez-Boland, 2001; Liu et al., 2003; Doumith et al., 2004b). Most of these isolates were positive for the inlA, inlC, and inlJ (lmo2821) genes (which encode different internalin-like proteins); lmo2672 (which is responsible for expression of transcriptional regulator); and llsX (which encodes listeriolysin S) (Kreft and Vazquez-Boland, 2001; Liu et al., 2003; Doumith et al. 2004b; Bierne et al., 2007; Clayton et al., 2011). Moreover, several other putative virulence marker genes have been identified, although their role in the pathogenesis of human L. monocytogenes infections is not well understood (Vazquez-Boland et al., 2001; Stavru et al., 2011).

Little information is available on the antimicrobial susceptibility of L. monocytogenes, particularly on strains isolated from food; however, most isolates were susceptible to a wide range of antibiotics (Lyon et al., 2008; Conter et al., 2009; Mammina et al., 2009; Morvan et al., 2010; Pesavento et al., 2010; Granier et al., 2011). On the other hand, an increasing number of resistant strains may cause failure of therapeutic treatment and create a public health problem (Conter et al., 2009; Morvan et al., 2010; Granier et al., 2011).

The aim of the present study was to determine the prevalence of L. monocytogenes in beef meat subjected to consumption. Furthermore, the obtained isolates were characterized by the molecular serotyping, identification of putative virulence genes, and their antimicrobial resistance patterns.

Methods

Sample collection

A total of 417 bovine ground beef meat samples purchased in local retail shops in the eastern part of Poland during October 2009 to January 2011 were used for detection of L. monocytogenes. The strains were isolated in accordance to the International Organization for Standardization (ISO) 11290-1:2004 standard. The suspected L. monocytogenes colonies were identified using API^® Listeria (bioMerieux, Marcy l'Etoile, France). The confirmed isolates were stored at −80°C until further analysis.

Characterization of L. monocytogenes isolates

Multiplex PCR for identification of the main L. monocytogenes serotypes was done as described previously by Doumith et al. (2004a). PCR was carried out in a thermal cycler (Biometra, Göttingen, Germany) under the following conditions: initial DNA denaturation at 95°C for 5 min followed by 30 cycles of 94°C for 1 min, 55°C for 1 min, and 72°C for 2 min. The final cycle was performed at 55°C for 2 min and 72°C for 5 min. Furthermore, three PCRs were done to determine the presence of L. monocytogenes virulence genes. The multiplex PCR assay (mPCR1) was designed to identify the inlA, inlC, and inlJ genes, whereas two other PCRs were used for the detection of the lmo2672 and llsX markers, respectively (Table 1) (Liu et al., 2003; 2007, Clayton et al., 2011). The oligonucleotide primers used in the PCR tests are shown in Table 1.

Table 1.

Polymerase Chain Reaction (PCR) Primers Used for Determination of Listeria monocytogenes Virulence Marker Genes

PCR test	Primer name	Sequence (5′→3′)	Primer final concentration (μM)	Target gene	Size of PCR amplicon (bp)	Reference
mPCR1	inlAF	ACGAGTAACGGGACAAATGC	0.25	inlA	800	Liu et al., 2007
	inlAR	CCCGACAGTGGTGCTAGATT	0.25
	inlCF	AATTCCCACAGGACACAACC	0.15	inlC	517
	inlCR	CGGGAATGCAATTTTTCACTA	0.15
	inlJF	TGTAACCCCGCTTACACACAGTT	0.05	inlJ	238
	inlJR	AGCGGCTTGGCAGTCTAATA	0.05
PCR2	lmo2672F	CGGCACACTTGGATTCTCAT	0.3	lmo2672	481	Liu et al., 2003
	lmo2672R	AGGGCTAGTGACGGATGCTA	0.3
PCR3	llsXF	TTATTGCATCAATTGTTCTAGGG	0.2	llsX	200	Clayton et al., 2011
	llsXR	CCCCTATAAACATCATGCTAGTG	0.2

Determination of antimicrobial resistance

The antimicrobial susceptibility test for the L. monocytogenes isolates was performed by the minimal inhibitory concentration (MIC) method (Trek Diagnostic Systems USA, Cleveland, OH) with the GPN3F plate (Trek) containing the panel of 17 antimicrobials used in veterinary and human therapy of listeriosis (Lyon et al., 2008). The ranges of the antimicrobials tested and the values of the MIC breakpoints are shown in Table 2. The plates were read using the Vision^® system (Trek), and the antimicrobial susceptibility of the isolates was determined by the Clinical and Laboratory Standards Institute (CLSI) guidelines (Collignon et al., 2009).

Table 2.

Breakpoints for Antimicrobials Used in the Study

			MIC breakpoints (mg/L)
Antimicrobial classes	Antimicrobials	Range tested (mg/L)	Susceptible	Intermediate	Resistant
Aminoglycosides	Gentamycin (GEN)	2–16	≤4	8	≥16
	Streptomycin (STR)	1,000	≤512	NEB	≥1,024
Ansamycin	Rifampin (RIF)	0.5–4	≤1	2	≥4
Cephalosporins	Ceftriaxone (AXO)	8–64	≤8	16	≥32
Glycopeptides	Vancomycin (VAN)	1–128	≤4	8–16	≥32
Lincosamides	Clindamycin (CLI)	0.12–2	≤0.5	1–2	≥4
Macrolides	Erythromycin (ERY)	0.25–4	≤0.5	1–4	≥8
Oxazolidinones	Linezolid (LZD)	0.5–8	≤2	4	≥8
Penicillins	Ampicillin (AMP)	0.12–16	≤2	NEB	NEB
	Penicillin (PEN)	0.06–8	≤2	NEB	NEB
	Oxacillin (OXA)	0.25–8	≤2	NEB	≥4
Fluoroquinolones	Ciprofloxacin (CIP)	0.5–2	≤1	2	≥4
	Gatifloxacin (GAT)	1–8	≤2	4	≥8
	Levofloxacin (LEVO)	0.25–8	≤2	4	≥8
Streptogramins	Quinupristin/dalfopristin (SYN)	0.12–4	≤1	2	≥4
Potentiated sulfonamides	Trimethoprim/sulfamethoxazole (SXT)	0.5/9.5–4/76	≤0.5/9.5	1/19–2/38	≥4/76
Tetracyclines	Tetracycline (TET)	2–16	≤4	8	≥16

MIC, minimal inhibitory concentration; NEB, no established breakpoint (Lyon et al., 2008).

Reference strains

The following positive and negative reference strains were used in the study: L. monocytogenes 05CEB424LM (1/2a), 06CEB406LM (1/2b), 06CEB405LM (1/2c) 06CEB422LM (4b), L. innocua ATCC 33090, L. ivanovii ATCC 19119, and Staphylococcus aureus ATCC 29213. The L. monocytogenes were obtained from the European Union Reference Laboratory (ANSES, Maisons-Alfort Cedex, France).

Results and Discussion

The presence of L. monocytogenes in raw meat may be due to either fecal contamination during evisceration or contamination of meat by the handlers (Swaminathan and Gerner-Smidt, 2007; Rhoades et al., 2009; Todd and Notermans, 2011). In the present study, it was found that 81 out of 417 (19.4%) beef meat samples were positive for L. monocytogenes. All these isolates harbored the prs gene as shown by the presence of the 370-bp PCR amplicon, confirming that they belonged to Listeria genus, including L. monocytogenes. Molecular serotyping performed by the PCR method revealed that the majority of the isolates (50 stains; 61.7%) were of 1/2a serotype. All of them were positive for the lmo0737 sequence (Table 3). Furthermore, 26 (32.1%) L. monocytogenes strains were classified as 1/2c serotype since they possessed both lmo0737 and lmo1118 markers (Table 3). Only five strains belonged to serotypes 1/2b or 4b (four and one isolates, respectively). They were differentiated on the basis of the PCR results (i.e., strains of serotype 1/2b were positive for the ORF2819 gene whereas the isolate belonging to serotype 4b amplified both ORF markers) (Table 3). All 81 strains were positive for the inlA, inlC, inlJ, and lmo2672 sequences as shown by the presence of the respective PCR amplicons (Table 3). It was also found that two L. monocytogenes (both of 4b serotype) tested had another virulence marker gene—llsX. Our results showed that most strains isolated from raw beef meat belonged to potential serotypes 1/2a and 1/2c, which is in agreement with several other studies concerning the identification of L. monocytogenes in food samples (Liu et al., 2007; Anonymous, 2011; Pesavento et al., 2010; Yan et al., 2010). A study of Mammina et al. (2009) on 54 human L. monocytogenes isolates recovered from listeriosis in Italy revealed that the inlA, inlC, and inlJ internalin genes were present in all investigated strains that belonged to either of the three serotypes linked to lineages I (serotypes 4b and 1/2b) or II (serotype 1/2a), which are responsible for the majority of human listeriosis cases (Orsi et al., 2011). Another study of Liu et al. (2003) showed that the internalin J gene was detected in 19 out of 29 L. monocytogenes strain and the lmo2672 marker was identified in 17 out of 29 strains. The isolates identified during this study may potentially be pathogenic for consumers because they were positive for several putative virulence marker genes, especially those responsible for expression of internalin-like proteins and listeriolysin S. As was shown in the present study, all 81 strains isolated from beef meat were positive for the internalin and lmo2672 genes; thus, they may be potentially virulent for the consumers.

Table 3.

Relationship Between Serotype and Virulence Marker Genes Among Isolated Listeria monocytogenes strains

		Serotype marker genes				Virulence marker genes
Serotype	Number of strains	lmo0737	lmo1118	ORF2819	ORF2110	inlA	inlC	inlJ	lmo2672
1/2a	50	+				+	+	+	+
1/2b	4			+		+	+	+	+
1/2c	26	+	+			+	+	+	+
4b	1			+	+	+	+	+	+

The results of the antimicrobial resistance of the L. monocytogenes strains investigated in the present study are shown in Table 4. All isolates were susceptible to ampicillin, erythromycin, gatifloxacin, gentamycin, levofloxacin, penicillin, rifampin, streptomycin, tetracycline, trimethoprim/sulfamethoxazole, and vancomycin. Furthermore, the vast majority of the strains were sensitive to some other antimicrobials used in the study (e.g., linezolid, quinupristin/dalfopristin, and ciprofloxacin) (Table 4). On the other hand, many isolates were resistant to oxacillin (62.7% strains), which belongs to the highly important group of antimicrobials according to World Health Organization classification (Collignon et al., 2009). Several L. monocytogenes isolates (17.3%) were also resistant to ceftriaxone.

Table 4.

Antimicrobial Resistance of Listeria monocytogenes Isolates Tested in the Study

			No (%) of isolates
Antimicrobial classes	Antimicrobials	Antimicrobial class according to WHO	Susceptible	Intermediate	Resistant
Aminoglycosides	Gentamycin (GEN)	C.I.	81 (100%)	0	0
	Streptomycin (STR)	C.I.	81 (100%)	0	0
Ansamycin	Rifampin (RIF)	C.I.	81 (100%)	0	0
Cephalosporins	Ceftriaxone (AXO)	C.I.	38 (46.9%)	29 (35.8%)	14 (17.3%)
Glycopeptides	Vancomycin (VAN)	C.I.	81 (100%)	0	0
Lincosamides	Clindamycin (CLI)	I.	53 (65.4%)	28 (34.6%)	0
Macrolides	Erythromycin (ERY)	C.I.	81 (100%)	0	0
Oxazolidinones	Linezolid (LZD)	C.I.	77 (95.1%)	4 (4.9%)	0
Penicillins	Ampicillin (AMP)	C.I.	81 (100%)	0	0
	Penicillin (PEN)	C.I.	81 (100%)	0	0
	Oxacillin (OXA)	H.I.	22 (37.3%)	0	59 (62.7%)
Fluoroquinolones	Ciprofloxacin (CIP)	C.I.	66 (81.5%)	12 (14.8%)	3 (3.7%)
	Gatifloxacin (GAT)	C.I.	81 (100%)	0	0
	Levofloxacin (LEVO)	C.I.	81 (100%)	0	0
Streptogramins	Quinupristin/dalfopristin (SYN)	C.I.	78 (96.3%)	0	3 (3.7%)
Potentiated sulfonamides	Trimethoprim/sulfamethoxazole (SXT)	H.I.	81 (100%)	0	0
Tetracyclines	Tetracycline (TET)	H.I.	81 (100%)	0	0

C.I., critically important; I., important; H.I., highly important (Collignon et al., 2009).

Among L. monocytogenes isolates recovered from patients and food, the most frequently resistance observed was directed to tetracycline (Lyon et al., 2008; Conter et al., 2009; Morvan et al., 2010; Pesavento et al., 2010; Granier et al., 2011; Ruiz-Bolivar et al., 2011). However, in the present study, no such strains were identified. On the other hand, many L. monocytogenes were resistant to oxacillin (62.7% isolates), which belongs to the major classes of antibiotics used in veterinary and human medicine and is a highly important class of antimicrobials (Collingnon et al., 2009). Furthermore, this antibiotic, together with gentamycin and a combination of trimethoprim/sulfamethoxazole are the drugs of choice for treatment of human listeriosis. However, among 81 isolates tested in the present study, no strain resistant to potentiated sulfonamides and aminoglycosides was identified. The resistance of L. monocytogenes to antimicrobials currently used in human therapy was also investigated by other authors (Lyon et al., 2008; Conter et al., 2009; Mammina et al., 2009; Morvan et al., 2010; Pesavento et al., 2010; Granier et al., 2011; Ruiz-Bolivar et al., 2011). Most of the strains isolated from raw meat, food, or a food-processing environment were susceptible to antimicrobials except oxacillin; some isolates were also resistant to ampicillin, clindamycin, gentamycin, tetracyclines, and penicillin. These results are in agreement with the antimicrobial resistance pattern obtained in the present study.

Considering that L. monocytogenes is slowly becoming resistant due to the acquiring of antibiotic resistance genes from other Gram-positive microorganisms, especially Enterococcus spp. and Streptococcus spp., a further surveillance of emerging antimicrobial resistance of this pathogen is needed to ensure an effective treatment of human listeriosis. The results obtained in the present study can be helpful in improving background information on virulence properties of L. monocytogenes and on antimicrobial resistance of such strains isolated from beef. Furthermore, these data may be useful for epidemiological and public health studies on this pathogen.

In conclusion, L. monocytogenes isolated and characterized in the present study possessed genes that were previously described as putative virulence factors playing a role in human listeriosis; thus, such isolates may be potentially pathogenic for consumers. Therefore, our results indicate that this kind of food may create a public health concern.

Footnotes

Acknowledgments

This work was financially supported by the EU FP6 ProSafeBeef Project (grant FOOD-CT-2006-36241).

Disclosure Statement

No competing financial interests exist.

References

Anonymous. The European Union summary report on trends and sources of zoonoses, zoonotic agents and foodborne outbreaks in 2009. EFSA J, 2011; 9:2090.

Bierne

, Sabet

, Personnic

, Cossart

. Internalins: A complex family of leucine-rich repeat-containing proteins in Listeria monocytogenes. Microbes Infect, 2007; 9:1156–1166.

Clayton

, Hill

, Cotter

, Ross

. Real-time PCR assay to differentiate listeriolysin S-positive and -negative strains of Listeria monocytogenes. Appl Environ Microbiol, 2011; 77:163–171.

Collignon

, Powers

, Chiller

, Aidara-Kane

, Aarestrup

. World Health Organization ranking of antimicrobials according to their importance in human medicine: A critical step for developing risk management strategies for the use of antimicrobials in food production animals. Food Safety, 2009; 49:132–141.

Conter

, Paludi

, Zanardi

, Ghidini

, Vergara

, Ianieri

. Characterization of antimicrobial resistance of foodborne Listeria monocytogenes. Int J Food Microbiol, 2009; 128:497–500.

Doumith

, Buchrieser

, Glaser

, Jacquet

, Martin

. Differentiation of the major Listeria monocytogenes serovars by multiplex PCR. J Clin Microbiol, 2004a. 42:3819–3822.

Doumith

, Cazalet

, Simoes

, Frangeul

, Jacquet

, Kunst

, Martin

, Cossart

, Glaser

, Buchrieser

. New aspects regarding evolution and virulence of Listeria monocytogenes revealed by comparative genomics and DNA arrays. Infect Immun, 2004b. 72:1072–1083.

Granier

, Moubareck

, Colaneri

, Lemire

, Roussel

, Dao

, Courvalin

, Brisabois

. Antimicrobial resistance of Listeria monocytogenes isolates from food and the environment in France over a 10-year period. Appl Environ Microbiol, 2011; 77:2788–2790.

Kreft

, Vazquez-Boland

. Regulation of virulence genes in Listeria. Int J Microbiol, 2001; 291:145–157.

10.

Liu

, Ainsworth

, Austin

, Lawrence

. Characterization of virulent and avirulent Listeria monocytogenes strains by PCR amplification of putative transcriptional regulator and internalin genes. J Med Microbiol, 2003; 52:1065–1070.

11.

Liu

, Lawrence

, Austin

, Ainsworth

. A multiplex PCR for species- and virulence-specific determination of Listeria monocytogenes. J Microbiol Methods, 2007; 71:133–140.

12.

Lyon

, Berrang

, Fedorka-Cray

, Fletcher

, Meinersmann

. Antimicrobial resistance of Listeria monocytogenes isolated from a poultry further processing plant. Foodborne Pathog Dis, 2008; 5:253–259.

13.

Mammina

, Aleo

, Romani

, Pellissier

, Nicoletti

, Pecile

, Nastasi

, Pontello

. Characterization of Listeria monocytogenes isolates from human listeriosis cases in Italy. J Clin Microbiol, 2009; 47:2925–2930.

14.

Morvan

, Moubareck

, Leclercq

, Hervé-Bazin

, Bremont

, Lecuit

, Courvalin

, Le Monnier

. Antimicrobial resistance of Listeria monocytogenes strains isolated from humans in France. Antimicrob Agents Chemother, 2010; 54:2728–2731.

15.

Orsi

, den Bakker

, Wiedermann

. Listeria monocytogenes lineages: Genomics, evolution, and phenotypic characteristics. Int J Med Microbiol, 2011; 301:79–96.

16.

Pesavento

, Ducci

, Nieri

, Comodo

, Lo Nostro

. Prevalence and antibiotic susceptibility of Listeria spp. isolated from raw meat and retail foods. Food Control, 2010; 21:708–713.

17.

Rhoades

, Duffy

, Koutsoumanis

. Prevalence and concentration of verocytotoxigenic Escherichia coli, Salmonella enterica and Listeria monocytogenes in the beef production chain: A review. Food Microbiol, 2009; 26:357–376.

18.

Ruiz-Bolivar

, Neuque-Rico

, Poutou-Pinales

, Carrascal-Comacho

, Mattar

. Antimicrobial susceptibility of Listeria monocytogenes food isolates from different cities in Colombia. Foodborne Pathog Dis, 2011; 8:913–919.

19.

Stavru

, Archambaud

, Cossart

. Cell biology and immunology of Listeria monocytogenes infections: Novel insights. Immunol Rev, 2011; 240:160–184.

20.

Swaminathan

, Gerner-Smidt

. The epidemiology of human listeriosis. Microbes Infect, 2007; 9:1236–1243.

21.

Todd

ECD

, Notermans

. Surveillance of listeriosis and its causative pathogen, Listeria monocytogenes. Food Control, 2011; 22:1284–1490.

22.

Vazquez-Boland

, Kuhn

, Berche

, Chakraborty

, Dominguez-Bernal

, Goebel

, Gonzalez-Zorn

, Wehland

, Kreft

. Listeria pathogenesis and molecular virulence determinants. Clin Microbiol Rev, 2001; 14:584–640.

23.

Wieczorek

, Dmowska

, Osek

. Prevalence, characterization and antimicrobial resistance of Listeria monocytogenes isolated from bovine hides and carcasses. Appl Environ Microbiol, 2012; 78:2043–2045.

24.

Yan

, Neogi

, Mo

, Guan

, Shen

, Zhang

, Li

, Yamasaki

, Shi

, Zhong

. Prevalence and characterization of antimicrobial resistance of foodborne Listeria monocytogenes isolates in Hebei province of Northern China, 2005-2007. Int J Food Microiol, 2010; 144:310–316.