Development of a High-Resolution Melting–Based Approach for Efficient Differentiation Among Bacillus cereus Group Isolates

Abstract

Strains belonging to Bacillus cereus Group include six different species, among which are Bacillus thuringiensis, Bacillus weihenstephanensis, and Bacillus cereus sensu stricto, a causative agent of food poisoning. Sequence of the panC-housekeeping gene is used for B. cereus Group affiliation to seven major phylogenetic groups (I–VII) with different ecological niches and variations in thermal growth range and spore heat resistance of B. cereus Group microorganisms varies among phylogenetic groups. We assigned a selection of B. cereus sensu stricto strains related to food poisoning from the Spanish cultivar Collection (Valencia) to Group IV strains based on panC gene sequence. Thermal inactivation assays revealed variability of spore heat resistance within these Group IV strains. Adequate food sanitizing treatments therefore require fast and reliable identification of particular strains. In the present study, feasibility of genotyping via high-resolution melting (HRM) analysis was examined. HRM analysis of amplified polymorphic 16S-23 intergenic spacer region (ISR) region proved to be discriminatory for B. cereus sensu stricto strain typing, while two other polymorphic regions within the bacterial rRNA operon allowed differentiation between Bacillus species, demonstrating its applicability for discrimination on the species and strain level within B. cereus Group.

Introduction

T he Bacillus cereus Group is comprised of six species: B. cereus (sensu stricto), Bacillus mycoides, Bacillus pseudomycoides, Bacillus thuringiensis, Bacillus weihenstephanensis, and Bacillus anthracis. Some strains cause human disease and food spoilage (Candelón et al., 2004).

Guinebretière et al. (2008) reported on an “ecotypic” structure of populations in the B. cereus Group with a differentiation into seven phylogenetic groups based on phenotypic and genetic criteria. Every group shows a specific “thermotype” and virulence potential with implications for the food industry. B. cereus sensu stricto strains are affiliated to groups II, III, IV, and V, making differentiation at the strain level an important issue, since toxins produced by Bacillus species were reported as causative agent in 124 outbreaks affecting 1,132 people and causing 93 hospitalizations during 2009 (EFSA, 2011).

All members of the B. cereus Group show a very high similarity level (from 99.5% to 100%) of the 16S and 23S rRNA sequences (Daffonchio et al., 1998) and a variable intergenic spacer region (ISR) due to nucleotide substitutions, insertions, deletions, and presence of tRNA genes (Cherif et al., 2003). The 16S-23S ISR usually shows significant polymorphisms at genus and species level, and intra-species variations on rRNA operon genes can be detected in some cases by conventional polymerase chain reaction (PCR) in combination with agarose gel electophoresis (Daffonchio et al., 1998).

Differentiation of closely related species and strains of the B. cereus Group remains a challenge which could be addressed using high-resolution melting (HRM) analysis, an extension of previous DNA dissociation (or “melting”) analyses based on highly controlled temperature transitions and DNA binding dyes with improved saturation properties, allowing the detection of single base sequence variations. HRM has been reported to obtain successful results in specific species identification of clinically relevant bacterial species (Yang et al., 2009) and in medical diagnosis applications (Reed et al., 2007; Montgomery et al., 2007; Erali et al., 2008; Van Ert et al., 2007).

The aim of this investigation was to assign thermal niches to five selected B. cereus sensu stricto strains from the Spanish Type Culture Collection (CECT), based on partial panC gene sequencing and heat resistance. They were classified by Martínez-Blanch et al. (2009) into three groups with different virulence factors. Our results showed that the bacterial isolates analyzed belonged to B. cereus Group IV but with variations in heat resistance. We therefore investigated the feasibility of HRM analysis to discriminate B. cereus at the strain and species level. As proof of concept, we analyzed B. cereus CECT131, CECT148, CECT193, CECT4014, and CECT4094, B. weihenstephanensis, and B. thuringiensis strains amplifying a 16S-23S ISR region as well as two other polymorphic areas within the rRNA gene operon.

Our study is a combined approach that includes strain and species identification with phylogenetic affiliation of isolates and characterization of their spore heat resistance.

Methods

Bacterial strains and growth conditions

B. cereus sensu stricto strains used in this study were selected from the Spanish Type Culture Collection (CECT, Valencia, Spain). B. weihenstephanensis (KBAB4) and B. thuringiensis (Bt407) strains were provided by INRA (Avignon, France) (Table 1).

Table 1.

Bacterial Strains Used in This Study

Abbreviation	Strain	Source	Reference
CECT131	Bacillus cereus CECT 131	CECT	Frankland and Frankland, 1887
CECT148	Bacillus cereus CECT 148^T (type strain)	CECT	Frankland and Frankland, 1887
CECT193	Bacillus cereus CECT 193	CECT	Frankland and Frankland, 1887
CECT4014	Bacillus cereus CECT 4014	CECT	Frankland and Frankland, 1887
CECT4094	Bacillus cereus CECT 4094	CECT	Frankland and Frankland, 1887
Bt407	Bacillus thuringiensis Bt407	INRA	Lereclus et al., 1989
KBAB4	Bacillus weihenstephanensis KBAB4	INRA	Lapidus et al., 2008

CECT, Spanish Type Culture Collection; INRA, National Institute of Agronomy Research, France.

Following CECT indications, CECT131, CECT148, CECT193, and CECT4094 strains were grown at 30°C and CECT4014 strain at 37°C in nutrient broth for 18 h and stored with 20% (v/v) glycerol at −80°C. For DNA extraction, depending on the strains, cultures were grown in brain-heart infusion (BHI) broth at 30°C and 37°C, as described above, for 18 h with agitation at 200 rpm. Strains were sporulated in Fortified Nutrient agar at 30°C (Mazas et al., 1995) and stored at −20°C until use. Spores were heated at 80°C for 10 min prior to use (Fernández et al., 2001).

DNA extraction

Genomic DNA for panC gene sequence analysis was extracted from pure cultures of each B. cereus strain. Cells were lysed in 400 μL of extraction buffer (2% Triton X-100, 1% sodium dodecyl sulfate [SDS], 100mM NaCl, 10mM Tris pH 8, and 1mM ethylenediaminetetraacetic acid [EDTA] pH 8.5, 0.5 mg μL⁻¹ lysozyme, 0.023 mg μL⁻¹ proteinase K) (Manzano et al., 2003; Candelon et al., 2004), during 30 min at 37°C, and after adding SDS (1% final concentration), for further 30 min at 65°C. DNA purification included phenol-chloroform-isoamyl alcohol (25:24:1) extraction, followed by isopropanol precipitation; then DNA was finally resuspended in 40 μL of sterile distilled water. Genomic DNA for real time–polymerase chain reaction (RT-PCR) and HRM-PCR was isolated using the DNeasy Blood and Tissue kit (Qiagen, Germantown, MD).

PanC amplification and sequencing

Primers for the amplification of panC gene of the B. cereus Group species were designed with Primer3 (version 0.4.0) software available at http://frodo.wi.mit.edu/ (Rozen and Skaletsky, 2000) on the basis of the panC gene sequence of B. cereus ATCC 14579 (accession number NP_831320.1) retrieved from GenBank (Benson et al., 2004). Sequences, expected amplicon size, and T_m are listed in Table 2. PCR for panC gene amplification of CECT 131, CECT 148, CECT 193, and CECT 4094 strains was carried out in 25 μL of reaction mixtures containing 5 μL of 5× Colorless GoTaq^® Flexi buffer (Promega, Mannheim, Germany), 20 μM of each deoxyribonucleotide triphosphate (dNTP; Sigma-Aldrich, Steinheim, Germany), 0.4 μM of the forward and the reverse primer, 2 mM MgCl₂ (Promega, Mannheim, Germany), 0.2 μL of Taq polymerase (GoTaq^®DNA Polymerase [5 μ/μL], Promega), and template DNA (50–100 ng/μL). The amplification conditions were as follows: initial denaturation for 5 min (94°C), 35 cycles of denaturation at 94°C (15 s), annealing at 55°C (30 s) and extension at 72°C (30 s), and final extension at 72°C (7 min). Because of poor amplification of strain CECT 4014, PCR was optimized using Herculase^®II Fusion Enzyme kit (Stratagene, La Jolla, CA) following manufacturer's instructions. Amplicons were visualized on 1% agarose gels, stained with ethidiumbromide. Automated sequencing of PCR products was performed by Savia Biotech (Almería, Spain) using panCfor and panCrev primers.

Table 2.

Polymerase Chain Reaction Primers Used in This Study

Target	Primer	Primer sequence (5′→3′)	Product size (bp)	T_m (°C)
panC gene	panCfor	CGTAAGGCAAGAGAAGAAAA	651	50/55
	panCrev	TCCTTCGACTTTCTCTACCA
16S rRNA gene-23S rRNA gene ISR	16S-23SISRfor	CGAAGCATATCGGCGTTAGT	560	55/57
	16S-23SISRrev	CCCTTATGACCTGGGCTACA
5S rRNA gene and glutamiltransferase	5S-GTfor	GAGAGTAGGACGTCGCCAAG	206	58
	5S-GTrev	TGAAACAGATTGGTGGTATGACTT
16S rRNA gene and 16S-23S ISR	16S-ISRfor	AATAAGCGTCGTCAGGAACG	185	58
	16S-ISRrev	AGCCAGGATCAAACTCTCCA

Phylogenetic analysis and affiliation to B. cereus Group

Nucleotide sequence alignement and phylogenetic analysis of panC gene between microorganisms of the B. cereus Group was performed with the ClustalX 2.1 program applying the Neighbor-Joining method (Saitou and Nei, 1987). The analyzed data set also included panC gene sequences of Bacillus species and strains available from GenBank (Benson et al., 2004).

Applying the classification system proposed by Guinebretière et al. (2008), panC gene sequences were used to assign the strains to phylogenetic groups I–VII performing the homology search algorithm offered at www.tools.symprevius.org/Bcereus/english.php (Guinebretière, 2011).

Heat resistance determination of B. cereus sensu stricto spores

Heat resistance determination of B. cereus sporulated cells at 90°C, 95°C, and 100°C on sterile distilled water was carried out using a Mastia thermoresistometer (Conesa et al., 2009). Samples were collected into sterile tubes, diluted, plated onto BHI agar, and incubated at 37°C for 24 h. Survival curves were fitted using GInaFIT (Geeraerd et al., 2005). Maximum inactivation rate and specific inactivation rate (1/min), both designed as K_max, and shoulder length (min) were obtained when appropriate. Root mean sum of squared errors (RMSSE) (Ratkowsky, 2003) was selected as a measure of goodness-of-fit.

Identification of highly polymorphic genomic regions and primer design

Genome sequences of B. cereus strains with the following accession numbers were obtained from GenBank database and used for primer design: NC 004722 B. cereus ATCC 14579 and NC 0011772 B. cereus G98421. Both sequences were aligned using the multiple sequence alignment algorithm MUSCLE, version 3.8 (www.drive5.com/muscle) (Edgar, 2004). Conserved genome fragments flanking hypervariable nucleotide regions were selected between both strains. The selected polymorphic nucleotide sequences were analyzed using Blast-N (http://blast.ncbi.nlm.nih.gov/Blast.cgi) (Altschul et al., 1990). Primer3, version 0.4.0 software was used to design and pre-evaluate primers. Autofolding was studied using Oligo Calc, version 3.6 (www.basic.northwestern.edu/biotools/oligocalc.html) (Kibbe, 2007) and probability of secondary fold using Quikfold tool available at DINAMelt Web server (http://mfold.rna.albany.edu/?q=dinamelt) (Markham and Zuker, 2005). In silico PCR using In-silico PCR Experiment Simulation System (Ipcress) (Slater and Birney, 2005) was performed in order to assess the number of amplicons generated by the designed primer. Primer names, primer sequences, expected size of amplification products, and T _m are presented in Table 2.

Amplification of polymorphic region by conventional and real-time PCR

The highly polymorphic 16S-23S ISR regions were amplified by conventional PCR using primers 16S-23SISRfor and 16S-23SISRrev (Table 2) from CECT 131, CECT 148, CECT 193, CECT 4014, CECT 4094, Bt407, and KBAB4. The PCR was performed with Herculase^®II Fusion Enzyme kit according to manufacturer's instructions. PCR amplicons were analyzed on 2% agarose gels.

Real-time PCR for the region 16S-23S ISR and for polymorphic regions flanking 5S and 16S rRNA genes was performed for the B. cereus Group strains described above, as well as for Bt407 and KBAB4. The 25-μL PCR reaction contained 12.5 μL of Brilliant II SYBR Green QPCR master mix (Stratagene), 0.3μM of forward and reverse primers 16S-23SISR, 5S-GT, and 16S-ISR (Table 2) and template DNA (50–150 ng). Amplifications were performed in triplicate using Rotor-gene Q thermal cycler (Qiagen). PCR conditions consisted of one cycle at 95°C for 10 min, followed by 40 cycles at 95°C for 30 s, 57°C (ISR) or 58°C (5S-GT and 16S-ISR) for 30s and 72°C for 1 min. Melting curve analysis was performed from 57°C to 95°C increasing by 0.1°C each step. Data were analyzed using the software Rotor-Gene 2.02.4.

HRM of polymorphic regions

For the detection of sequence polymorphisms, we performed HRM of 16S-23S ISR region and of polymorphic regions flanking 5S and 16S rRNA genes from CECT 131, CECT 148, CECT 193, CECT4014, CECT 4094, Bt407, and KBAB4 using Type-it^® HRM kit (Qiagen) according to the manufacturer's instructions. PCR runs prior to HRM analysis were performed in triplicate using Rotor-gene Q thermal cycler and repeated three times. PCR conditions consisted in one cycle at 95°C for 10 min, followed by 40 cycles at 95°C for 30 s, 57°C (ISR) or 58°C (5S-GT and 16S-ISR) for 30s, and 72°C for 1 min. HRM curve analysis was performed in a temperature range from 57°C (ISR) or 58°C (5S-GT and 16S-ISR) to 95°C increasing 0.1°C each step. Rotor-Gene 2.02.4 software was used to run HRM-PCRs and analyze results. Raw data of HRM analysis were normalized by setting the same start and ending fluorescent signal level for all the curves through adjusting two normalization regions, one region for the start (trailing range) and the other for the end (leading range). Threshold values for genotyping confidence percentages were set. Genotypes were determined automatically by the software, establishing confidence values as an integrity check of obtained results. Samples below 90% threshold value were considered as a genotypic variant.

Results

PanC gene sequence affiliation and phylogenetic analysis of panC gene

Affiliation of B. cereus strains CECT131, CECT148, CECT193, CECT4014, and CECT4094 to the phylogenetic B. cereus Groups I–VII was performed by amplification and sequencing of the panC gene (Candelon et al., 2004; Guinebretière et al., 2008). Results indicated that all tested strains belong to group IV with a 100% homology score. Phylogenetic analysis with tree construction (Fig. 1) for B. cereus CECT strains with those available at the NCBI GenBank is consistent with results of Guinebretière et al. (2008). Results revealed that CECT B. cereus strains are closely related to other strains of the same species as well as B. thuringiensis and B. weihenstephanensis strains.

FIG. 1.

Genetic relationship among Bacillus cereus Group strains based on panC gene. Neighbor-Joining method (Saitou and Nei, 1987) was used for inferring the topology. Bootstrap values (10000 bootstrap replicates) are shown in the major nodes. Strains' affiliation into major phylogenetic groups is designated by VII, VI, IV, and III, which correspond to phylogenetic groups VII, VI, IV, and III, respectively.

Heat inactivation of B. cereus strains affiliated to group IV

We characterized the heat resistance of strains CECT 131, CECT 148, CECT 193, CECT 4014, and CECT 4094 under isothermal conditions. Results include shoulder length, K _max values, and RMSSE for non-linear models (Table 3). Strain CECT 4094 was the most heat resistant, followed by CECT 131 and CECT 148, whereas strains CECT 193 and CECT 4014 are the most heat-sensitive ones (Fig. 2A).

FIG. 2.

Survival curves at 90°C of Bacillus cereus Spanish Type Culture Collection (CECT) 131 (•), B. cereus CECT 148 (▪), B. cereus CECT 193 (▴), B. cereus CECT 4014 (x) and B. cereus CECT 4094 (+) (A); and of B. cereus CECT 131 at 90°C (▪), 95°C (•), and 100°C (▴) (B).

Table 3.

Effect of Heat Treatments on B. cereus sensu stricto Strains Modeled by Log Linear Model with Shoulder (Geeraerd et al., 2005)

	90°C			95°C			100°C
Strain	Sl (min)	k_max (1/min)	RMSSE	Sl (min)	k_max (1/min)	RMSSE	Sl (min)	k_max (1/min)	RMSSE
CECT 131	9.35	0.23	0.15	3.34	0.73	0.25	0.75	0.78	0.48
	10.93	0.24	0.11	4.85	0.81	0.14	0.00	0.78	0.33
	10.22	0.23	0.10	4.13	0.73	0.13	0.00	0.74	0.21
CECT 148	0.00	0.30	0.19	0.00	1.30	0.10	0.00	1.99	0.29
	0.00	0.28	0.17	0.00	1.37	0.12	0.19	2.14	0.18
	0.00	0.30	0.27	0.45	1.39	0.08	0.00	2.08	0.11
CECT 193	0.00	0.42	0.18	0.13	1.48	0.29	0.00	2.14	0.32
	0.00	0.47	0.17	0.47	1.51	0.27	0.00	2.05	0.20
	0.00	0.49	0.19	0.51	1.77	0.25	0.00	2.08	0.19
CECT 4014	3.30	0.43	0.12	0.00	2.12	0.26	0.00	1.94	0.31
	3.51	0.45	0.05	0.00	2.02	0.20	0.00	1.45	0.39
	2.68	0.45	0.11	0.00	2.07	0.22	0.46	1.21	0.29
CECT 4094	28.61	0.13	0.26	7.08	0.36	0.19	9.06	0.37	0.31
	23.88	0.09	0.06	7.67	0.37	0.16	9.95	0.38	0.29
	32.19	0.11	0.09	8.66	0.35	0.25	10.19	0.39	0.26

Sl, shoulder length; K _max, maximum inactivation rate or specific inactivation rate; RMSSE, root mean sum of squared errors.

Shoulder phenomena lower than 0.5 min were considered not significant. At 90°C, strain CECT 4094 presented a shoulder phenomenon with values of 23.88–31.19 min, strain CECT 131 of 9.35–10.93 min, and strain CECT 4014 of 2.68–3.51 min. Shoulder length diminished at higher temperatures in a range of 2.4–4 times for strain CECT 4094 at 95°C and 100°C, whereas for strains CECT 131 and CECT 4014, shoulder phenomenon was not significant (Fig. 2B). Shoulder phenomena are widely described (van Zuijlen et al., 2010).

16S-23S ISR PCR and T_m profiles for strain and species discrimination

Amplification of 16S-23S ISR in B. cereus CECT131, CECT148, CECT193, CECT4014, CECT4094, B. weihenstephanensis KBAB4, and B. thuringiensis Bt407 by conventional PCR resulted in identical and reproducible patterns in all strains tested (Fig. 3A).

FIG. 3.

Amplification of 16S-23S intergenic spacer region (ISR) of Bacillus cereus Group strains with primers 16S-23SISRfor and 16S-23SISRrev. (A) Agarose gel–polymerase chain reaction (PCR) profiles. (B) Major melting peaks obtained by real-time PCR.

We therefore applied melting peak analysis to 16S-23S ISR, as well as to 5S-GT and16S-ISR and observed two main peaks for 16S-23S ISR PCR product and one peak for 5S-GT and 16S-ISR PCR products, respectively. T_m values were very similar and did not allow consistent differentiation among species and strains. Figure 3B shows the major melting peak of 16S-23S ISR PCR product for all B. cereus sensu stricto strains, B. thuringiensis, and B. weihenstephaniensis.

Evaluation of HRM analysis for species genotyping

B. cereus CECT 148, B. thuringiensis Bt407, and B. weihenstephanensis KBAB4 strains were used to test species discrimination by HRM analysis, following the amplification of polymorphic regions 16S-23S ISR, 5S-GT, and 16S-ISR (Table 2). 5S-GT and 16S-ISR amplicons gave derivative melting curves with a single peak (Fig. 4A,B). 16S-23S ISR PCR products showed two melting peaks. Normalized plots for genotyping were generated by selecting appropriate areas from the melting curves (Fig. 4C,D). Figure 4E,F shows difference plots that were generated by defining representative genotypes followed by subtraction of average plots of the different genotypes from one selected genotype. HRM results indicate that amplicons for regions 5S-GT and 16S-ISR but not for 16S-23S ISR (data not shown) can be applied for discrimination between B. cereus CECT 148, B. thuringiensis Bt407, and B. weihenstephanensis KBAB4 (Fig. 4A–F).

FIG. 4.

Fluorescence derivative high-resolution melting (HRM) curves of Bacillus cereus Spanish Type Culture Collection (CECT) 148 (black lines), B. thuringiensis Bt407 (gray lines), and B. weihenstephanensis KBAB4 (dashed lines) are shown in (A) for polymerase chain reaction (PCR) product 5S-GTfor and 5S-GTrev and in (B) for PCR product 16S-ISRfor and 16S-ISRrev. Genotyping of the PCR products by HRM analysis was performed after establishing regions of normalization. Normalized regions were determined, establishing a leading range from 71.23 to 73.13 and a trailing range from 78.68±20 to 80.72±20 for 5S-GT primers. For 16S-ISR primers, leading range values were 71.23 to 73.13 and trailing range values were 79.19 to 81.09. HRM curves of these regions are represented in (C) for 5S-GT and in (D) for 16S-ISR. To obtain difference plot representatives, genotypes were defined in (E) for 5S-GT and in (F) for 16S-ISR.

Evaluation of HRM analysis for strain genotyping

We evaluated the potential to discriminate among B. cereus strains based on polymorphism detection through HRM analysis of amplicons 16S-23S ISR, 5S-GT, and 16S-ISR. Melting curves of the 16S-23S ISR region for all the strains tested were characterized by two variant domains, corresponding to the two melting peaks observable in the derivative plot (Fig. 5A). For genotyping with 16S-23S ISR amplicons, a combinatory approach was applied, analyzing the two melting domains separately as well as in combination, because successful genotyping for a given domain varied among the biological replica. Figure 5B,C shows the normalized HRM curve and the difference plot generated for the upper domain 1. PCR products 5S-GT and 16S-ISR did not discriminate between B. cereus strains, and these polymorphic regions were rejected for strain genotyping by HRM analysis.

FIG. 5.

(A) Fluorescence derivative high-resolution melting (HRM) curve of Bacillus cereus Spanish Type Culture Collection (CECT) 131 (dashed black lines), CECT 148 (black lines), CECT 193 (gray lines), CECT 4014 (dashed gray lines), and CECT 4094 (dotted black lines) was obtained by real-time amplification with 16S-23SISRfor and 16S-23SISRrev. Two peaks, peaks 1 and 2, were selected for genotyping of single nucleotide polymorphisms by HRM. (B) Normalized regions were determined, establishing a leading range from 80.75 to 83.6 and a trailing range from 88.42 to 90.32. Normalized HRM curves of B. cereus strains were obtained from normalization of peak region 1. (C) Difference plot minus CECT 131.

Discussion

Heat resistance values of B. cereus strains connected to diarrheal foodborne outbreaks, food, and environment, and affiliated to group IV, have been reported (Carlin et al., 2006) and were higher than those obtained in this study, indicating variability among group IV strains. Furthermore, K _max and shoulder length values obtained also indicate variations within B. cereus CECT strains. Therefore, accurate identification of B. cereus strains could be a valuable tool for food processing.

Phylogenetic analysis of the panC gene sequences showed that CECT B. cereus strains tested are closely related to other strains of the same species as well as B. thuringiensis and B. weihenstephanensis strains. This phylogenetic assessment is consistent with others previously performed (Schmidt et al., 2011).

Genotyping of the 16S-23S ISR has been widely used for differentiation of closely related bacterial species, such as Bacillus genus isolates, based on its high degree of sequence polymorphism (Jensen et al., 1993; Wunschel et al., 1994; Nagpal et al., 1998; Shaver et al., 2002; Cherif et al., 2003). In accordance with Daffonchio et al. (1998, 2000), we observed identical and reproducible amplification patterns in all strains tested, suggesting that the length of 16S-23S ISR is conserved among B. cereus isolates and that different techniques should be used to discriminate between closely related isolates (Martínez-Blanch et al., 2010).

We were not able to distinguish on the species or strain level based on melting peak analysis of 16S-23S ISR using SYBR Green I, probably due to the fact that T _m differences of 1°C are not valuable for genotyping and identification (Odell et al., 2005).

On the basis of these results, two primers closely related with rRNA genes and amplifying polymorphic regions, 5S-GT and16S-ISR, were designed for genotyping. Melting peak analysis did not allow to discriminate between B. cereus CECT strains and those from B. weihenstephanensis and B. thuringiensis.

In contrast, genotyping by one-step post-PCR HRM analysis for amplicons 5S-GT and 16S-ISR had a high discriminatory power between B. cereus CECT 148, B. thuringiensis Bt407, and B. weihenstephanensis KBAB4 and an excellent typeability, whereas the selected 16S-23S ISR region was not valuable for species differentiation. Conversely, strain typing using 16S-23S ISR region was shown to be an appropriate method for B. cereus CECT strains discrimination. HRM analysis detected polymorphisms in both melting domains, and we propose a combinatory approach considering both melting domains for genotyping. Our findings led us to consider HRM analysis for genotyping as a valuable tool for B. cereus Group typing; however, additional experiments with a major number of species and strains are required to address this issue.

Conclusion

Heat resistance assays revealed significant differences in thermal inactivation of spores from B. cereus sensu stricto strains assigned to group IV. Thermal processing depends on rapid and reliable identification of strains or species. HRM analysis for genotyping detection proved to be discriminatory among B. cereus species and strains. Our results demonstrate that HRM is a fast and sensitive genotyping technique, capable of detecting sequence changes in only a single base. This finding opens up the possibility of implementing HRM analysis as a rapid discrimination method for B. cereus Group isolates.

Footnotes

Acknowledgments

We thank Luis Pedro García González of SEDIC UPCT service for the excellent technical assistance, José Saura for his help in performing heat resistance assays, and Izaskun Mallona for her invaluable assistance to the present work. This project was funded by Ministerio de Educación y Ciencia Español (AGL 2006-13320C03-02/ALI). V. Antolinos is the recipient of a Ph.D. fellowship from the Ministerio de Ciencia e Innovación Español.

Disclosure Statement

No competing financial interests exist.

References

Altschul

, Gish

, Miller

, Myers

, Lipman

. Basic local alignment search tool. J Mol Biol, 1990; 215:403–410. http://blast.ncbi.nlm.nih.gov/Blast.cgi. 2011 June 7.

Benson

, Karsch-Mizrachi

, Lipman

, Ostell

, Wheeler

. GenBank: Update. Nucleic Acids Res, 2004; 32:D23–D26.

Candelon

, Guilloux

, Ehrlich

, Sorokin

. Two distinct types of rRNA operons in the Bacillus cereus Group. Microbiology, 2004; 150:601–611.

Carlin

, Fricker

, Pielaat

, Heisterkamp

, Shaheen

, Salonen

, Svensson

, Nguyen-the

, Ehling-Schulz

. Emetic toxin-producing strains of Bacillus cereus show distinct characteristics within the Bacillus cereus Group. Int J Food Microbiol, 2006; 109:132–138.

Cherif

, Borin

, Rizzi

, Ouzari

, Boudabous

, Daffonchio

. Bacillus anthracis diverges from related clades of the Bacillus cereus Group in 16S-23S ribosomal DNA intergenic transcribed spacers containing tRNa genes. Appl Environ Microbiol, 2003; 69:33–40.

Conesa

, Andreu

, Fernández

, Esnoz

, Palop

. Nonisothermal heat resistance determinations with the thermoresistometer Mastia. J Appl Microbiol, 2009; 107:506–513.

Daffonchio

, Borin

, Frova

, Manachini

, Sorlini

. PCR fingerprinting of whole genomes: The spacers between the 16S and 23S rRNA genes and of intergenic tRNA gene regions reveal a different intraspecific genomic variability of Bacillus cereus and Bacillus licheniformis. Int J Syst Bacteriol, 1998; 48:107–116.

Daffonchio

, Cherif

, Borin

. Homoduplex and heteroduplex polymorphisms of the amplified ribosomal 16S-23S internal transcribed spacers describe genetic relationships in the Bacillus cereus Group. Appl Environ Microbiol, 2000; 66:5460–5468.

Edgar

. MUSCLE: A multiple sequence alignment method with reduced time and space complexity. BMC Bioinformatics, 2004; 113:1–19. www.drive5.com/muscleLast access 06/07/20112012 July 1.

10.

[EFSA] European Food Safety Authority. The European Union Summary Report on Trends and Sources of Zoonoses, Zoonotic Agents and Food-Borne Outbreaks in 2009. EFSA J, 2011; 9:2090.

11.

Erali

, Voelkerding

, Wittwer

. High resolution melting applications for clinical laboratory medicine. Exp Mol Pathol, 2008; 85:50–58.

12.

Fernández

, Ocio

, Fernández

, Martínez

. Effect of heat activation and inactivation conditions on germination and thermal resistance parameters of Bacillus cereus spores. Int J Food Microbiol, 2001; 63:257–264.

13.

Frankland

, Frankland

. B. cereus. Phil Trans R Soc Lond B Biol Sci, 1887; 178:257–287.

14.

Geeraerd

, Valdramidis

, Van Impe

. GInaFiT, a freeware tool to assess non-log-linear microbial survivor curves. Int J Food Microbiol, 2005; 102:95–105.

15.

Guinebretière

. Affiliation to phylogenetic groups (I to VII) into the Bacillus cereus Group. 2011. www.tools.symprevius.org/Bcereus/english.php. 2011 June 7.

16.

Guinebretière

, Thompson

, Sorokin

, Normand

, Dawyndt

, Ehling-Schulz

, Svensson

, Sanchis

, Nguyen-The

, Heyndrickx

, De Vos

. Ecological diversification in the Bacillus cereus Group. Environ Microbiol, 2008; 10:851–865.

17.

Jensen

, Webster

, Straus

. Rapid identification of bacteria on the basis of polymerase chain reaction–amplified ribosomal DNA spacer polymorphisms. Appl Environ Microbiol, 1993; 59:945–952.

18.

Kibbe

. OligoCalc: An online oligonucleotide properties calculator. Nucleic Acids Res, 2007; 35 May 25 www.basic.northwestern.edu/biotools/oligocalc.html. 2012 March 3.

19.

Lapidus

, Goltsman

, Auger

, Galleron

, Segurens

, Dossat

, Land

, Broussolle

, Brillard

, Guinebretiere

, Sanchis

, Nguen-The

, Lereclus

, Richardson

, Wincker

, Weissenbach

, Ehrlich

, Sorokin

. Extending the Bacillus cereus Group genomics to putative food-borne pathogens of different toxicity. Chem Biol Interact, 2008; 171:236–249.

20.

Lereclus

, Arantes

, Chaufaux

, Lecadet

M-M

. Transformation and expression of a cloned d-endotoxin gene in Bacillus thuringiensis. FEMS Microbiol Lett, 1989; 60:211–218.

21.

Manzano

, Cocolin

, Cantoni

, Comi

. Bacillus cereus, Bacillus thuringiensis and Bacillus mycoides differentiation using PCR-RE technique. Int J Food Microbiol, 2003; 81:249–254.

22.

Markham

, Zuker

. DINAMelt web server for nucleic acid melting prediction. Nucleic Acids Res, 2005; 33:W577–W581. http://mfold.rna.albany.edu/?q=dinamelt. 2012 March 18.

23.

Martínez-Blanch

, Sánchez

, Garay

, Aznar

. Development of a real-time PCR assay for detection and quantification of enterotoxigenic members of Bacillus cereus Group in food samples. Int J Food Microbiol, 2009; 135:15–21.

24.

Martínez-Blanch

, Sánchez

, Garay

, Aznar

. Evaluation of phenotypic and PCR-based approaches for routine analysis of Bacillus cereus Group foodborne isolates. Antonie Van Leeuwenhoek, 2010; 99:697–709.

25.

Mazas

, González

, López

, González

, Martín-Sarmiento

. Effects of sporulation media and strain on thermal resistance of Bacillus cereus spores. Int J Food Sci Technol, 1995; 30:71–78.

26.

Montgomery

, Wittwer

, Palais

, Zhou

. Simultaneous mutation scanning and genotyping by high-resolution DNA melting analysis. Nat Protoc, 2007; 2:59–66.

27.

Nagpal

, Fox

. Utility of 16S–23S rRNA spacer region methodology: How similar are interspace regions within a genome and between strains for closely related organisms? J Micobiol Methods, 1998; 33:211–219.

28.

Odell

, Cloud

, Seipp

, Wittwer

. Rapid species identification within the Mycobacterium chelonae-abscessus group by high-resolution melting analysis of hsp65 PCR products. Am J Clin Pathol, 2005; 123:96–101.

29.

Ratkowsky

. Model fitting and uncertainty. Modeling Microbial Responses in Foods. McKellar

, Lu

. Boca Raton, FL: CRC Press, 2003; 151–196.

30.

Reed

, Kent

, Wittwer

. High-resolution DNA melting analysis for simple and efficient molecular diagnostics. Pharmacogenomics, 2007; 8:597–608.

31.

Rozen

, Skaletsky

. Primer3 on the WWW for general users and for biologist programmers. Bioinformatics Methods and Protocols: Methods in Molecular Biology. Krawetz

, Misener

. Totowa, NJ: Humana Press, 2000; 365–386. http://frodo.wi.mit.edu/. 2012 March 18.

32.

Saitou

, Nei

. The neighbor-joining method: A new method for reconstructing phylogenetic trees. Mol Biol Evol, 1987; 4:406–425.

33.

Schmidt

, Scott

, Dyer

. Whole-genome phylogenies of the family Bacillaceae and expansion of the sigma factor gene family in the Bacillus cereus species-group. BMC Genomics, 2011; 12:430.

34.

Shaver

, Nagpal

, Rudner

, Nakamura

, Fox

. Restriction fragment length polymorphism of rRNA operons for discrimination and intergenic spacer sequences for cataloging of Bacillus subtilis sub-groups. J Microbiol Methods, 2002; 50:215–223.

35.

Slater

GSC

, Birney

. Automated generation of heuristics for biological sequence comparison. BMC Bioinformatics, 2005; 6:31.

36.

Van Ert

, Easterday

, Simonson

, U'Ren

, Pearson

, Kenefic

, Busch

, Huynh

, Dukerich

, Trim

, Beaudry

, Welty-Bernard

, Read

, Fraser

, Ravel

, Keim

. Strain-specific single-nucleotide polymorphism assays for the Bacillus anthracis Ames strain. J Clin Microbiol, 2007; 45:47–53.

37.

van Zuijlen

, Periago

, Amézquita

, Palop

, Brul

, Fernández

. Characterization of Bacillus sporothermodurans IC4 spores; putative indicator microorganism for optimisation of thermal processes in food sterilization. Food Res Int, 2010; 43:1895–1901.

38.

Wehrle

, Didier

, Moravek

, Dietrich

, Märtlbauer

. Detection of Bacillus cereus with enteropathogenic potential by multiplex real-time PCR based on SYBR Green I. Mol Cell Probes, 2009; 24:124–130.

39.

Wunschel

, Fox

, Black

, Fox

. Discrimination among the B. cereus Group, in comparison to B. subtilis, by structural carbohydrate profiles and ribosomal RNA spacer region PCR. Syst Appl Microbiol, 1994; 17:625–635.

40.

Yang

, Ramachandran

, Rothman

, Hsieh

, Hardick

, Won

, Kecojevic

, Jackman

, Gaydos

. Rapid identification of biothreat and other clinically relevant bacterial species by use of universal PCR coupled with high-resolution melting analysis. J Clin Microbiol, 2009; 47:2252–2255.

Development of a High-Resolution Melting–Based Approach for Efficient Differentiation Among Bacillus cereus Group Isolates

Abstract

Introduction

Methods

Bacterial strains and growth conditions

DNA extraction

PanC amplification and sequencing

Phylogenetic analysis and affiliation to B. cereus Group

Heat resistance determination of B. cereus sensu stricto spores

Identification of highly polymorphic genomic regions and primer design

Amplification of polymorphic region by conventional and real-time PCR

HRM of polymorphic regions

Results

PanC gene sequence affiliation and phylogenetic analysis of panC gene

Heat inactivation of B. cereus strains affiliated to group IV

16S-23S ISR PCR and Tm profiles for strain and species discrimination

Evaluation of HRM analysis for species genotyping

Evaluation of HRM analysis for strain genotyping

Discussion

Conclusion

Footnotes

Acknowledgments

Disclosure Statement

References

16S-23S ISR PCR and T_m profiles for strain and species discrimination