Genetic Diversity of Shigella spp. and Their Integron Content

Abstract

Objectives:

The aim of this study was to investigate the occurrence and resistance gene content of class 1 and 2 integrons among Shigella spp. and to study the genetic diversity of isolates using the pulsed-field gel electrophoresis (PFGE) method.

Methods and Results:

A total of 32 Shigella spp. were identified from 700 stool samples of patients with diarrhea from two provinces in Iran. S. sonnei (70.8%) and S. flexneri (62.5%) were the most frequent serogroups in Tehran and Razavi Khorasan provinces, respectively. Class 2 integrons were more frequent among Shigella spp. in comparison with class 1 integrons. Three different resistance gene arrays were identified among class 1 integrons. Dihydrofolate reductase (dfrA) gene cassette was detected in 78.9% of total integrons (class 1 and 2). PFGE analysis revealed clonal dissemination (62.5%) of a single clone with identical class 2 resistance gene content in Tehran province. Comparison of our Shigella pulsotypes with those published from other countries showed similar pulsotypes in India and Korea, with identical resistance profiles, which suggests dissemination of this (these) clone(s) in Asian countries.

Conclusions:

Class 2 integrons were found to be predominant among our Shigella spp. This reflects the need to monitor the acquisition and dissemination of different resistant gene cassettes among integrons. Comparison of PFGE pattern through standard procedures promoted the molecular epidemiological surveys and identification of clonal isolates in Iran and other Asian countries.

Introduction

B acillary dysentery caused by Shigella species is an important cause of diarrheal disease in both developing and industrialized countries, and it is estimated that shigellosis causes over one million deaths per year, with most of the patients being children under 5 years old (Kotloff et al., 1999).

Four serogroups of Shigella including serogroup A (S. dysenteriae), serogroup B (S. flexneri), serogroup C (S. boydii), and serogroup D (S. sonnei) are responsible for shigellosis, all of which except S. sonnei are further divided into subserogroups. Prevalence of different serogroups is variable worldwide.

The main virulence factors of Shigella are carried by the inv plasmid (a 200-kb virulence plasmid that contains the essential genetic information for invasion). The ipaH gene that is involved in Shigella invasion is encoded on both the inv plasmid and bacterial chromosome. This would make it possible to detect Shigella spp. through polymerase chain reaction (PCR) amplification of the ipaH genetic marker (Antoine et al., 2010).

Spread of antimicrobial resistance has increased since the 1960s and is a major problem in global public health. Shigella was the first organism that has been shown to harbor transferable antimicrobial resistance factors (Tsutomu, 1963). Mobile genetic elements such as plasmids and transposons are reported in Shigella spp. (Terajima et al., 2004). Integrons that are also reported in Shigella spp. are not mobile but can exchange exogenous DNA, known as gene cassettes, by site-specific recombination mechanisms. The most gene cassettes that have been identified inside integrons are those conferring resistance to antimicrobials (Ahmed et al., 2006).

Typing of Shigella has been achieved by both phenotypic and genotypic methods. The methodology in the first step is based on conventional phenotypic methods such as serotyping and antimicrobial susceptibility, but their low discriminatory power has promoted the development of various genotyping methods (Navia et al., 2005). Several genotyping methods have been developed for Shigella spp., among which pulsed-field gel electrophoresis (PFGE) has been recognized to be a powerful tool for discriminating the clonal relationship among Shigella strains in different laboratories (Ribot et al., 2006).

The aim of this study was to determine the serogroup distribution and resistance gene content of two classes of integrons among Shigella isolates and to investigate the genetic diversity of integron harboring isolates using the PFGE genotyping method.

Materials and Methods

Bacterial strains

Thirty-two strains of Shigella spp. from Tehran (24) (Iran Central) and Razavi Khorasan (8) (Northeast of Iran) were obtained from 700 patients with acute diarrhea from two provinces in Iran (Tehran=500, Razavi Khorasan=200) during an 18-month period from April 2009 to November 2010 with no evidence of outbreak. The prevalence of shigellosis was 4.8% and 4% during the study period in two provinces, respectively. Biochemical screening tests were done to characterize the Shigella spp. isolates from selective agar plates including MacConkey agar, Salmonella-Shigella agar and XLD agar (Merck, Hamburg, Germany). The identity of isolates was confirmed using a genus-specific primer set that amplifies within the ipaH regions. Serogrouping of isolates was performed using monospecific antisera (Baharafshan Institute of Research & Development, Tehran, Iran). S. flexneri ATCC 9290 and S. sonnei ATCC 1202 were used as controls in each assay. S. boydii and S. dysenteriae control strains were kindly provided by the World Health Organization.

Antimicrobial susceptibility

Antimicrobial susceptibility testing was performed using the disc diffusion method according to CLSI guidelines (Wikler, 2006) for ampicillin (10 μg), co-trimoxasol (25 μg), tetracycline (30 μg), chloramphenicol (30 μg), ciprofloxacin (5 μg), trimethoprim (5 μg), and streptomycin (10 μg) (Wikler, 2006). Escherichia coli ATCC 25922 was used as a control in antimicrobial susceptibility testing.

Integron characterization and sequencing of resistance-encoding gene cassettes

The total DNA was extracted by boiling and used as a template in PCR assays for ipaH gene, class1 and 2 integrons. The primer sequences used in this study are shown in Table 1.

Table 1.

Primer Sequences Used in This Study

Primer target	Sequence (5' to 3')	Amplicon size (bp)	Reference
ipaH-F	GTTCCTTGACCGCCTTTCCGTTACCGTC	620	(Sethabutr et al., 1993)
ipaH-R	GCCGGTCAGCCACCCTCTGAGAGTAC
int1-F	TGCGTGTAAATCATCGTCGT	900	(Adabi et al., 2009)
int1-R	CAAGGTTCTGGACAGTTGC
in-F (5'CS)	GGCATCCAAGCAGCAAGC	Variable	(Collis and Hall, 1992)
in-R (5'CS)	AAGCAGACTTGACCTGAT
hep-F	CGGGATCCCGGACGGCATGCACGATTTGT	Variable	(White et al., 2001)
hep-R	GATGCCATCGCAAGTACGAG

PCR was performed in a reaction mixture with total volume of 25 μL, containing 2.5 μL 10x Taq polymerase buffer, 0.3 μL dNTPs (10 mmol L⁻¹), 1 U Taq DNA polymerase, 0.6 μL MgCl₂ (50 mmol L⁻¹) and 0.3 mol L⁻¹ from each primer. PCR was done as follows: initial denaturation step at 94°C for 5 min followed by 30 cycles consisting of denaturation (94°C for 1 min), annealing (56°C for 1 min), and extension (72°C for 1 min), followed by a final extension step at 72°C for 3 min. PCR products were purified using QIAquick Gel Extraction Kit (Qiagen), and direct sequencing of internal variable regions (gene cassettes) of class1 and 2 integrons was done using ABI 3730X capillary sequencer (Genfanavaran, Macrogen, Seoul, Korea).

GenBank accession numbers

One representative of each resistance gene cassette array inside class 1 integrons was deposited in the GenBank database. The assigned GenBank accession numbers are JX035724, JX035725, JX035726, and JX035727.

Pulsed-field gel electrophoresis (PFGE)

PulseNet standardized protocol was used for subtyping of Shigella spp. isolates (Ribot et al., 2006). In brief, bacteria from culture plates were adjusted to absorbance values of 0.8–1.0 at a wavelength of 610 nm in a cell suspension buffer (100 mmol L⁻¹ Tris: 100 mmol l⁻¹ EDTA, pH 8.0) after which agarose plugs were prepared using SeaKem Gold agarose (Lonza, Rockland, ME) and proteinase K. Cells in the agarose plugs were lysed by treatment with a lysis solution 50 mmol L⁻¹ Tris, 50 mmol L⁻¹ EDTA (pH 8.0), 1% sarcosine, and 0.5 mg of proteinase K for 1 h at 54°C. Six stages of washing steps were performed, twice with sterile ultrapure water and four times with Tris-EDTA (TE) buffer (10 mmol L⁻¹ Tris, 1 mmol L⁻¹ EDTA, pH 8.0). Forty units of XbaI restriction enzyme (Roche Diagnostic GmbH, Mannheim, Germany) was applied for plugs in a freshly prepared buffer and incubated for 4 h. XbaI digested Salmonella enterica serotype Braenderup H9812 plugs were used as DNA molecular weight size marker. The electrophoresis was performed with CHEF Mapper XA System (Bio-Rad) and consisted of 200 V at 14°C for 18 h with the increasing pulsed time from 2.16 s to 54.17 s. PFGE patterns were analyzed by Gel Compare II version 4.0 software (Applied Maths, Sint-Matenslatem, Belgium) and the patterns were compared by using the Dice coefficient and UPGMA (unweighted pair group method with arithmetic averages) clustering. A dendrogram was constructed using an optimization value of 0.50% and a position tolerance of 1.0%. Isolates with 80% similarity were considered as a single cluster. Assigning the types and interpretation of PFGE generated patterns was performed according to the guidelines set by Tenover and colleagues (Tenover et al., 1995).

Results

Serogrouping

Serogrouping testing was done for all 32 strains, and the results showed the predominance of S. sonnei (70.8%) and S. flexneri (20%) in Tehran, while in Razavi Khorasan S. flexneri was 62.5%. S. boydii constituted 8.3% and 12.5% of total Shigella strains in two provinces, respectively, while no S. dysenteriae was detected in any of the two provinces (Table 2).

Table 2.

Shigella Isolates Used in This Study

City	Serogroup A (S. dysenteriae)	Serogroup B (S. flexneri)	Serogroup C (S. boydii)	Serogroup D (S. sonnei)	Total number
Tehran	0 (0%)	5 (20 %)	2 (8.3%)	17 (70.83%)	24 (100%)
Khorasan	0 (0%)	5 (62.5%)	1 (12.5%)	2 (25%)	8 (100%)
Total	0 (0%)	10 (31.25%)	3 (9.37%)	19 (59.37%)	32 (100%)
Controls	S. dysenteriae (WHO)	S. flexneri ATCC 9290	S. boydii (WHO)	S. sonnei ATCC 1202

WHO, World Health Organization; ATCC, American Type Culture Collection.

Antimicrobial susceptibility analysis

Forty-five percent of isolates were multidrug resistant (resistant to three classes of antimicrobial agents or more). The foremost resistance profile was SXT/TE/TMP (34.5%) (Table 3). The most prevalent resistance was seen to trimethoprim and co-trimoxazol (93.7%) and tetracycline (87.5%), while only one isolate (3.1%) was resistant to ciprofloxacin. Resistance to streptomycin, ampicillin, and chloramphenicol was 43.7%, 37.5%, and 21.8%, respectively.

Table 3.

Antimicrobial Resistance Profile of Isolates

No.	Antimicrobial resistance profile	Percent of isolates	MDR
1	SXT/TE/TMP	34.5%	+
2	SXT/TE/TMP/STR	12.5%	+
3	SXT/AMP/TE/TMP/STR	12.5%	+
4	SXT/AMP/TE/TMP/CHL/STR	9.3%	+
5	SXT/AMP/TE/TMP/CHL	6.2%	+
6	SXT/AMP/TE/TMP	6.2%	+
7	SXT/TMP	6.2%	−
8	SXT/TE/TMP/CIP	3.1%	+
9	SXT/TMP/STR	3.1%	+
10	AMP/TE/CHL	3.1%	+
11	STR	3.1%	−

Antimicrobials were classified as aminoglycosides including Streptomycin (STR) and Ampicillin (AMP), tetracyclines including Tetracycline (TE), amphenicols including Chloramphenicol (CHL), fluoroquinolones including Ciprofloxacin (CIP), trimethoprim alone (TMP), or in combination with sulfametoxazol (SXT).

MDR, multidrug-resistant to ≥3 classes of antimicrobial agents.

PCR assay and sequencing analysis of integrons

All of the isolates produced positive results in ipaH amplification. Among the total 32 strains, 13 (40.6%) carried class 1 integron (int ⁺) using primers int1-F, int1-R (5'-conserved region) with DNA bands of 900 bp. PCR amplification of internal variable region using in-F, in-R primers produced three different products of approximately 750, 1500, and 1600 sizes in two (15.4%), one (7.7%), and three (23.1%) of int ⁺ isolates, respectively. No product was obtained for seven (54%) of the int ⁺ isolates, indicative of an empty integron with no resistance gene cassette. Sequence analysis of variable region indicated the presence of dihydrofolate reductase type I (dfrA7), aminoglycoside adenyl transferase-chloramphenicol acetyltransferase (aadB-catB3), and dihydrofolate reductase-aminoglycoside adenyltransferase (dfrA17-aadA5) resistance gene cassettes among the isolates, which correspond to 750, 1500, and 1600 bp PCR products, respectively.

Among the total 32 isolates, 25 (78.12%) harbored class 2 integron using primers hep-F, hep-R, which produced two PCR products of 1500 and 2300 bp in 9 (36%) and 16 (64%) of isolates, respectively. Sequence analysis showed that these two amplification bands corresponded to dihydrofolate reductase-streptothricin acetyltransferase (dfrA1-sat1) and dihydrofolate reductase-streptothricin acetyltransferase-aminoglycoside adenyltransferase (dfrA1-sat1-aadA1) genes, respectively.

PFGE analysis

The PFGE patterns were compared using Dice coefficient and UPGMA analysis and 11 major clusters were obtained that differed by more than three bands and further divided to 21 subclusters according to criteria described earlier (Tenover et al., 1995). Cluster analysis of the isolates revealed a single major cluster (subtypes B1–B4) constituting 46.8% of the total isolates. Although all of these strains belonged to serogroup D and were isolated from Tehran province, they showed different antimicrobial resistance profiles and resistance gene cassettes of class 1 and 2 integrons. One isolate from Razavi Khorasan province fell to this cluster with strains from Tehran (Fig. 1).

FIG. 1.

Unweighted pair group method with arithmetic averages dendrogram showing banding patterns of XbaI digested 36 Shigella isolates. The isolates are presented in comparison with their phenotypic resistance profile and integron resistance gene content. Main clusters are labeled to the right of the dendrogram.

Discussion

Previous studies have shown the prevalence of shigellosis to be 11.4%, 8.8%, and 14% during 2001–2006 in different provinces of Shiraz (central), Golestan, and Mazandaran (north), respectively (Farshad et al., 2006; Ghaemi et al., 2007; Savadkoohi et al., 2007; Pourakbari et al., 2010). In this study, the prevalence of shigellosis was shown to be 4% and 4.8% in Tehran and Razavi Khorasan, respectively. Furthermore, S. sonnei and S. flexneri were identified to be predominant species in these two provinces. These studies were conducted from 2006 to 2008, and they identified S. sonnei and S. flexneri as the dominant isolates at different time intervals (Farshad et al., 2006; Rahbar et al., 2007). The reasons for the fluctuation between S. sonnei or S. flexneri could be due to (1) travelers from neighboring countries and/or (2) overall antimicrobial use inside the country. Similar serogroups have been reported from neighboring countries such as Saudi Arabia (44%), Pakistan (58%), and Jordan (65%) (Kagalwalla et al., 1992; Rawashdeh et al., 1994; Zafar et al., 2009). On the other hand, S. sonnei was continuously reported to be the predominant strain in the United States, Canada, and the developed countries (Farshad et al., 2006).

Multidrug-resistant phenotype was seen in 45% of total isolates, with the SXT^r/TE^r/TMP^r being the foremost resistance pattern. Many other reports also indicated the dominance of resistance to streptomycin, sulfamethoxazole, and trimethoprim among Shigella spp. (Seol et al., 2006; Vrints et al., 2009).

From 32 strains in this study, 13 (S. sonnei and S. flexneri) were positive for class 1 integron (int1⁺), while the dfrA gene cassette was detected in 78.9% of total integrons. The results suggest the stability of this gene cassette in two classes of integrins, which may reflect the selective pressure, exerted over a long period, by the use of trimethoprim in clinics. The gene cassette arrays of aadA-dfrA detected in 31.6% of integrons may reflect co-transfer of resistance genes due to the genetic linkage of dfrA and aadA cassettes. Our previous published data indicated the predominance of this gene cassette arrays among both EPEC and non-EPEC isolates, which provide evidence of interspecies transfer of integrons through horizontal gene transfer (Najibi et al., 2012). Our data are also consistent with the previous reports worldwide on the predominance of dfrA and aadA gene cassettes among Enterobacteriaceae (Chang et al., 2007; Ajiboye et al., 2009; Scaletsky et al., 2010).

Among 32 isolates of Shigella spp., 25 isolates (S. sonnei, S. flexneri, S. boydii) carried class 2 integrons. Two different class 2 integrons (1.5 and 2.3 kb in sizes) were identified among our isolates. These two arrays (dfrA1-sat1 and dfrA1-sat1-aadA1) are identical to those reported elsewhere, although the occurrence of a 1.5-kb cassette array among our collection was less than the 2.3-kb gene cassette. This is in contrast to the previous reports from Iran, Japan, Belgium, and Korea (Ahmed et al., 2006; Seol et al., 2006; Ranjbar et al., 2007; Vrints et al., 2009).

All streptomycin-resistant isolates contained one member of aadA/B gene cassette in class 1 or 2 integron, which emphasizes the significance of integrons in spread of aadA/B resistance gene family. The occurrence of class 1 integron was less than class 2 and showed three different gene cassette arrays. Since past years, several other reports have indicated the elevated occurrence of class 2 integrons in Shigella in comparison to class 1 (McIver et al., 2002; Oh et al., 2003; Mammina et al., 2005).

Some of our Shigella isolates (6.2%) harbored both class 1 and 2 integrons simultaneously, which reveals the capability of these species in acquiring additional resistance gene cassettes.

Several typing methods have been developed to assess the clonal relatedness of bacterial species; however, PFGE has been selected as a method of choice for Shigella spp. typing (Woodward et al., 2005). The results of PFGE analysis showed a single major cluster (cluster B) with 15 members constituting 46.8% of total isolates, all of which (except three isolates) uniformly showed identical class 2 integron resistance gene content. All of the isolates in this cluster were isolated from Tehran province (except 1 isolate from Razavi Khorasan), which suggests the clonal dissemination of a single clone throughout this province. Isolates from Razavi Khorasan showed more dispersed pulsotypes, which may be due to pilgrimage ceremonies and passenger trafficking to Afghanistan in this province. One interesting finding, however, was the absence of class 1 integron in the isolate.

Comparing the S. sonnei PFGE patterns of this study with the patterns in Korea and India has shown high pulsotype similarity and identical antimicrobial patterns, which suggests (1) dissemination or importation of the same clones in Asian countries, probably through human travel and/or migration; and (2) appearance of similar genotypes in different countries through genomic rearrangement events (Oh et al., 2003; Pazhani et al., 2008). Our previously published data have shown identical clonal isolates of other enteric pathogens (i.e., Vibrio cholerae in Iran and other Asian countries including India, Nepal, and Pakistan) (Bakhshi and Pourshafie, 2009).

Shigella standard strains fell into separate pulsotypes with no integrons within their genome.

Conclusion

In conclusion, our study focused on the analysis of class 1 and class 2 integron gene cassettes, while class 2 integrons were found to be predominant among our Shigella spp. No clear relationship was defined between specific pulsotypes and integron content of isolates. The isolates with identical pulsotypes showed different resistance profile and integron content. Global comparison of PFGE patterns through PulseNet standard procedures promoted the epidemiological investigations that have led to identification of clonal isolates in Iran and other Asian countries.

Footnotes

Acknowledgments

We thank the Research Council of Tarbiat Modares University for supporting the project. Many thanks to the World Health Organization for providing Shigella standard strains.

Disclosure Statement

No competing financial interests exist.

References

Adabi

, Bakhshi

, Goudarzi

, Zahraei

, Pourshafie

. Distribution of class I integron and sulfamethoxazole trimethoprim constin in Vibrio cholerae isolated from patients in Iran. Microb Drug Resist, 2009; 15:179–184.

Ahmed

, Furuta

, Shimomura

, Kasama

, Shimamoto

. Genetic characterization of multidrug resistance in Shigella spp. from Japan. J Med Microbiol, 2006; 55:1685–1691.

Ajiboye

, Solberg

, Lee

, Raphael

, Debroy

, Riley

. Global spread of mobile antimicrobial drug resistance determinants in human and animal Escherichia coli and Salmonella strains causing community-acquired infections. Clin Infect Dis, 2009; 49:365–371.

Antoine

, Adjehi

, Nathalie

, Valerie

, Etienne

, Marcellin

DJE

, Mireille

. Virulence factors and resistance profile of Shigella isolated during infectious diarrhea in Abidjan, Côte D'Ivoire. J Appl Sci Res, 2010; 6:594–599.

Bakhshi

, Pourshafie

. Assessing clonality of Vibrio cholerae strains isolated during four consecutive years (2004–2007) in Iran. Scand J Infect Dis, 2009; 41:256–262.

Chang

, Chang

. Variable gene cassette patterns of class 1 integron-associated drug-resistant Escherichia coli in Taiwan. Kaohsiung J Med Sci, 2007; 23:273–280.

Collis

, Hall

. Site-specific deletion and rearrangement of integron insert genes catalyzed by the integron DNA integrase. J Bacteriol, 1992; 174:1574–1585.

Farshad

, Sheikhi

, Japoni

, Basiri

, Alborzi

. Characterization of Shigella strains in Iran by plasmid profile analysis and PCR amplification of ipa genes. J Clin Microbiol, 2006; 44:2879–2883.

Ghaemi

, Aslani

, Moradi

, Dadgar

, Livani

, Mansourian

, Nosrat

, Ahmadi

. Epidemiology of Shigella-associated diarrhea in Gorgan, north of Iran. Saudi J Gastroenterol, 2007; 13:129–132.

10.

Kagalwalla

, Khan

, Kagalwalla

, Alola

, Yaish

. Childhood shigellosis in Saudi Arabia. Pediatr Infect Dis J, 1992; 11:215–219.

11.

Kotloff

, Winickoff

, Ivanoff

, Clemens

, Swerdlow

, Sansonetti

, Adak

, Levine

. Global burden of Shigella infections: Implications for vaccine development and implementation of control strategies. Bull World Health Organ, 1999; 77:651–666.

12.

Lee

, Oh

, Cho

, Park

, Kim

, Seol

, Cho

. The prevalence of trimethoprim-resistance-conferring dihydrofolate reductase genes in urinary isolates of Escherichia coli in Korea. J Antimicrob Chemother, 2001; 47:599–604.

13.

Mammina

, Pontello

, Dal Vecchio

, Nastasi

. Identification of Shigella sonnei biotype g isolates carrying class 2 integrons in Italy (2001 to 2003) J Clin Microbiol, 2005; 43:2467–2470.

14.

McIver

, White

, Jones

, Karagiannis

, Harkness

, Marriott

, Rawlinson

. Epidemic strains of Shigella sonnei biotype g carrying integrons. J Clin Microbiol, 2002; 40:1538–1540.

15.

Najibi

, Bakhshi

, Fallahzad

, Pourshafie

, Katouli

, Sattari

, Alebouyeh

, Tajbakhsh

. Distribution of class 1 integrons among enteropathogenic Escherichia coli. Can J Microbiol, 2012; 58:637–643.

16.

Navia

, Gascón

, Vila

. Genetic diversity of Shigella species from different intercontinental sources. Infect Genet Evolution, 2005; 5:349–353.

17.

, Yu

, Kim

, Seol

, Cho

, Lee

. Changes in patterns of antimicrobial susceptibility and integron carriage among Shigella sonnei isolates from southwestern Korea during epidemic periods. J Clin Microbiol, 2003; 41:421–423.

18.

Pazhani

, Niyogi

, Singh

, Sen

, Taneja

, Kundu

, Yamasaki

, Ramamurthy

. Molecular characterization of multidrug-resistant Shigella species isolated from epidemic and endemic cases of shigellosis in India. J Med Microbiol, 2008; 57:856–863.

19.

Pourakbari

, Mamishi

, Mashoori

, Mahboobi

, Ashtiani

, Afsharpaiman

, Abedini

. Frequency and antimicrobial susceptibility of Shigella species isolated in Children Medical Center Hospital, Tehran, Iran, 2001–2006. Braz J Infect Dis, 2010; 14:153–157.

20.

Rahbar

, Deldari

, Hajia

. Changing prevalence and antibiotic susceptibility patterns of different shigella species in Tehran, Iran. Int J Microbiol, 2007; 3. 10.5580/1761.

21.

Ranjbar

, Aleo

, Giammanco

, Dionisi

, Sadeghifard

, Mammina

. Genetic relatedness among isolates of Shigella sonnei carrying class 2 integrons in Tehran, Iran, 2002–2003. BMC Infect Dis, 2007; 7:62.

22.

Rawashdeh

, Ababneh

, Shurman

. Shigellosis in Jordanian children: A clinico-epidemiologic prospective study and susceptibility to antibiotics. J Trop Pediatr, 1994; 40:355–359.

23.

Ribot

, Fair

, Gautom

, Cameron

, Hunter

, Swaminathan

, Barrett

. Standardization of pulsed-field gel electrophoresis protocols for the subtyping of Escherichia coli O157:H7, Salmonella, and Shigella for PulseNet. Foodborne Pathog Dis, 2006; 3:59–67.

24.

Savadkoohi

, Ahmadpour-Kacho

. Prevalence of Shigella species and their antimicrobial resistance patterns at Amirkola Children's Hospital, north of Iran. Iran J Ped, 2007; 17:118–122.

25.

Scaletsky

, Souza

, Aranda

, Okeke

. Genetic elements associated with antimicrobial resistance in enteropathogenic Escherichia coli (EPEC) from Brazil. BMC Microbiol, 2010; 10:25.

26.

Seol

, Kim

, Jeong

, Oh

, Kang

, Moon

, Kim

, Lee

, Cho

, Lee

. Molecular characterization of antimicrobial resistance in Shigella sonnei isolates in Korea. J Med Microbiol, 2006; 55:871–877.

27.

Sethabutr

, Venkatesan

, Murphy

, Eampokalap

, Hoge

, Echeverria

. Detection of Shigellae and enteroinvasive Escherichia coli by amplification of the invasion plasmid antigen H DNA sequence in patients with dysentery. J Infect Dis, 1993; 167:458–461.

28.

Tenover

, Arbeit

, Goering

, Mickelsen

, Murray

, Persing

, Swaminathan

. Interpreting chromosomal DNA restriction patterns produced by pulsed-field gel electrophoresis: Criteria for bacterial strain typing. J Clin Microbiol, 1995; 33:2233–2239.

29.

Terajima

, Tamura

, Hirose

, Izumiya

, Miyahara

, Konuma

, Watanabe

. A multi-prefectural outbreak of Shigella sonnei infections associated with eating oysters in Japan. Microbiol Immunol, 2004; 48:49.

30.

Tsutomu

. Infective heredity of multiple drug resistance in bacteria. Bacteriol Rev, 1963; 27:87–115.

31.

Vrints

, Mairiaux

, Van Meervenne

, Collard

, Bertrand

. Surveillance of antibiotic susceptibility patterns among Shigella sonnei strains isolated in Belgium during the 18-year period 1990 to 2007. J Clin Microbiol, 2009; 47:1379–1385.

32.

White

, McIver

, Rawlinson

. Integrons and gene cassettes in the Enterobacteriaceae. Antimicrob Agents Chemother, 2001; 45:2658–2661.

33.

Wikler

, Cockerill

, Craig

, Dudley

, Eliopoulos

, Hecht

et al. Performance standards for antimicrobial disk susceptibility testing. Approved standards. 9thed. V.26,1 Wayne, PA: Clinical and Laboratory Standards Institute, 2006; M2–A9.

34.

Woodward

, Clark

, Caldeira

, Ahmed

, Soule

, Bryden

, Tabor

, Melito

, Foster

, Walsh

, Ng

, Malcolm

, Strockbine

, Rodgers

. Identification and characterization of Shigella boydii 20 serovar nov., a new and emerging Shigella serotype. J Med Microbiol, 2005; 54:741–748.

35.

Zafar

, Hasan

, Nizami

, von Seidlein

, Soofi

, Ahsan

, Chandio

, Habib

, Bhutto

, Siddiqui

, Rizvi

, Clemens

, Bhutta

. Frequency of isolation of various subtypes and antimicrobial resistance of Shigella from urban slums of Karachi, Pakistan. Int J Infect Dis, 2009; 13:668–672.