Characterization of Farm,Food,and Clinical Shiga Toxin–Producing Escherichia coli (STEC) O113

Abstract

Thirty-nine Shiga toxin–producing Escherichia coli (STEC) O113 Irish farm, abattoir, and clinical isolates were analyzed in conjunction with eight Australian, New Zealand, and Norwegian strains for H (flagellar) antigens, virulence gene profile (eaeA, hlyA, tir, espA, espB katP, espP, etpD, saa, sab, toxB, iha, lpfA _O157/OI-141, lpfA_O113, and lpfA_O157/OI-154), Shiga toxin gene variants (stx _1c, stx _1d , stx ₂, stx _2c, stx _2dact, stx _2e, stx _2f, and stx _2g) and were genotyped using pulsed-field gel electrophoresis (PFGE) and multilocus sequence typing (MLST). All of the Irish strains were O113:H4, regardless of source, while all non-Irish isolates carried the H21 flagellar antigen. The stx₁ gene was present in 30 O113:H4 strains only, whereas the stx_2d gene was common to all isolates regardless of source. In contrast, eaeA was absent, while hlyA was found in the Australian, New Zealand, Norwegian, and two of the Irish human clinical isolates. saa was present in the O113:H21 but not in the O113:H4 serotype. To the best of the author's knowledge, this is the first report of clinically significant STEC lacking both the eaeA and saa genes. PFGE analysis was inconclusive; however, MLST grouped the strains into three sequence types (ST): ST10, ST56, and ST223. Based on our findings, it was concluded that the stx_2d gene is common in STEC O113, which are generally eaeA negative. Furthermore, STEC O113:H4 is a new, emerging bovine serotype of human clinical significance.

Introduction

S higa toxin–producing Escherichia coli (STEC) are some of the most important foodborne pathogens to emerge within the past two decades, causing significant human disease, with major implications for human morbidity and mortality worldwide (Griffin and Tauxe, 1991). Although STEC O157:H7 is recognized as the most important serotype in relation to human infection, non-O157 cases are increasingly reported. For example, of the 3,573 confirmed cases of STEC infection in 2009 in Europe, almost half (48.3%) were attributed to non-O157 serogroups (Anonymous, 2011). The serogroup O113 is strongly associated with intimin-negative isolates and has caused human illness worldwide, including Spain (Blanco et al., 2003), the United States (Hogan et al., 2001), Australia (Paton et al., 1996), New Zealand (Lake et al., 2002), Canada (Karmali et al., 1985), Germany (Beutin et al., 1998), France (Decludt et al., 2000), Argentina (Rivas et al., 2006), and Belgium (Piérard et al., 1997).

STEC O113 has been frequently isolated from dairy and beef cattle (dos Santos et al., 2010; Fernandez et al., 2010). STEC O113:H-, O113:H4, and O113:H21 have also been isolated from a range of foods, including cheese, game, pork and pork products, beef and beef products, raw milk, and raw spreadable sausage (Werber et al., 2008). Indeed, a recent U.S. ground beef study reported O113:H21 as the most common serotype recovered (Bosilevac and Koohmaraie, 2011).

The first reported clinical cases of STEC O113 were serotype O113:H21 in hemolytic uremic syndrome (HUS) patients in Australia (Paton et al., 1999). More recently, members of this serogroup have been associated with individual cases of diarrheal illness in Ireland (Garvey et al., 2008, 2009a,b). The increased detection of the O113 serogroup and its links to clinical cases highlights the importance of this serogroup as an emerging pathogen.

STEC are characterized by the production of a range of Shiga toxins (also known as verocytotoxins), which can be differentiated into two major groups (stx ₁ and stx ₂). The stx ₁ group is quite homogenous, consisting of two variants: stx _1c (Zhang et al., 2002) and stx _1d (Kuczius et al., 2004). In contrast, the stx ₂ group is much more heterogeneous with variants: stx _2c, (Hii et al., 1991) stx _2d (Piérard et al., 1998), stx _2dact (Melton-Celsa et al., 1996), stx _2e (Muniesa et al., 2000), stx _2f (Schmidt et al., 2000), and stx2_g (Leung et al., 2003). STEC may also harbor a number of other virulence genes, including those required for the formation of attaching and effacing (A/E) lesions (Jerse et al., 1990; Blanco et al., 2006), the genetic determinants of which are located on the locus of enterocyte effacement (LEE) (Bolton, 2011).

LEE genes include eaeA (intimin) and tir (EspE; translocated intimin receptor), espA, espB, espD, espF, espG, and espH (type III secretion system [TTSS]) (Bolton, 2011). Other chromosomally located genes include the long polar fimbriae (lpf)–encoding genes (Torres et al, 2002). lpfA_O113 is particularly associated with the LEE-negative serotype O113:H21 and the adherence-mediating iha gene (Tarr et al., 2000; Schmidt et al., 2001). STEC may also carry virulence plasmids such as pO157 which contain virulence-associated genes (McNally et al., 2001), including the EHEC-enterohemolysin gene (hlyA), the extracellular serine protease gene (espP), the catalase peroxidase gene (katP), the type III secretion pathway–associated gene etpD, and the adherence-associated gene toxB (Bolton, 2011). Another virulence plasmid pO113 (Paton and Paton, 2002) encodes the STEC autotransporter (sab), which has been shown to promote adherence to human epithelial cells and mediate biofilm formation (Herold et al., 2009).

Recent studies on non-O157 STEC from farms and abattoirs in Ireland reported the serotype O113:H4 as being ubiquitous in both environments (Monaghan et al., 2011). Furthermore, this serogroup has become more prevalent in human clinical cases over the last 5 years. The objective of this study was to characterize Irish farm, food, and clinical O113 isolates in terms of virulence profile and genotype, and to compare them with a representative selection of food and clinically significant isolates from Norway, Australia, and New Zealand.

Materials and Methods

Isolate collection

Irish isolates from bovine feces (27), hide (5) carcass (1), and beef farm soil (4) (Table 1) were obtained from the Teagasc Food Research Centre (Ashtown) culture collection. The fecal isolates were originally from four different farms and isolated on six different sampling trips; the soil isolates were all from the same farm, but isolated on four different sampling occasions (Monaghan et al., 2011). The hide and carcass isolates were from the same abattoir, isolated on the same day with the exception of one of the hide isolates, which was from a different abattoir (Monaghan et al., 2012). The two Irish clinical isolates were provided by the Public Health Laboratory (PHL HSE DML, Cherry Orchard, Dublin). Both strains (Ire 1 and Ire 2) were isolated from patients with mild gastroenteric illness. Isolates from Australia and New Zealand were kindly provided by Prof. James Paton and Dr. Adrienne Paton (University of Adelaide). The former included clinical strains (HUS [AUS 1]), microangiopathic hemolytic anemia (MAHA) and thrombocytopenia (Aus 3), and an O113:H21 outbreak (asymptomatic carrier [Aus 5]) and a fermented sausage isolate (AUS 2). Both New Zealand strains (NZ 1 and NZ 2) were isolated from HUS patients, while the Norwegian isolates (Nor 1 and Nor 2) were obtained from bovine fecal samples and kindly provided by Prof. Yngvild Wasteson of the Norwegian School of Veterinary Science.

Table 1.

Isolate Codes, Serotypes, and Sources

Country	Isolate code	Serotype	Source
Ireland	Cl Ire 1 & 3	O113:H4	Patient (gastrointestinal illness)
	Ire 9, 35, 36, 98, 99, 101, 102, 103, 104, 105, 117, 118, 140, 141, 142, 143, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162 & 227	O113:H4	Bovine feces (farm)
	Ire 11, 37, 81 & 106		Soil (bovine farms)
	Ire A7, 8, 9, 10 & 49	O113:H4	Bovine hide (abattoir)
	Ire A11	O113:H4	Bovine carcass (abattoir)
Australia	Aus 1, Aus 5	O113:H21	Patient (asymptomatic carriers)
	Aus 2	O113:H21	Fermented sausage
	Aus 3	O113:H21	Patient (HUS)
New Zealand	NZ 4 & 6	O113:H21	Patient (HUS)
Norway	Nor 16 & 17	O113:H21	Cattle feces

HUS, hemolytic uremic syndrome.

Serotyping

All isolates were serotyped at the Pennsylvania State University (University Park, PA), as previously described (Monaghan et al., 2011, 2012).

Detection and of virulence genes and variants

All isolates were screened for the presence of stx ₁, stx ₂, eaeA, hlyA, tir, espA, katP, espP, etpD, hlyA, espB, saa, sab, toxB, iha, lpfA _O157/OI-141, lpfA _O113, and lpfA _O157/OI-154, as previously described (Monaghan et al. 2011). The Shiga toxin genes were subtyped using previously published typing protocols and conditions (Table 2). A list of positive control strains and references is provided in Table 3.

Table 2.

Target Genes and Primer Sequence Used for the Detection of Shiga Toxin–Producing Escherichia coli Virulence Gene Markers

Primer	Sequence (5′ - 3′)	Target (gene)	Reference
vt1-F	ATAAATCGCCATTCGTTGACTAC	stxA₁	Paton and Paton, 1998
vt1-R	AGAACGCCCACTGAGATCATC
vt2-F	GGCACTGTCTGAAACTGCTCC	stxA₂	Paton and Paton, 1998
vt2-R	TCGCCAGTTATCTGACATTCTG
eaeA-F	GACCCGGCACAAGCATAAGC	eaeA	Paton and Paton, 1998
eaeA-R	CCACCTGCAGCAACAAGAGG
hlyA-F	GCATCATCAAGCGTACGTTCC	hlyA	Paton and Paton, 1998
hlyA-R	AATGAGCCAAGCTGGTTAAGCT
TIR-F	CATTACCTTCACAAACCGAC	tir	Kobayashi et al., 2001
TIR-R	CCCCGTTAATCCTCCCAT
EspAa	CACGTCTTGAGGAAGTTTGG	espA	McNally et al., 2001
EspAb	CCGTTGTTAATGTGAGTGCG
EspBa	CGATGGTTAATTCCGCTTCG	espB	McNally et al., 2001
EspBb	CGATGGTTAATTCCGCTTCG
ESPPa	AAACAGCAGGCACTTGAACG	espP	McNally et al., 2001
ESPPb	AGACAGTTCCAGCGACAACC
D1	CGTCAGGAGGATGTTCAG	etpD	Schmidt et al., 1997
D13R	CGACTGCACCTGTTCCTGATTA
wkat-B	CTTCCTGTTCTGATTCTTCTGG	katP	Brunder et al., 1996
wkat-F	AACTTATTTCTCGCATCATCC
lpfO141-F	CTGCGCATTGCCGTAAC	lpfA_O157/OI-141	Szalo et al., 2002
lpfO141-R	ATTTACAGGCGAGATCGTG
lpfA-F	ATGAAGCGTAATATTATAG	lpfA _O113	Doughty et al., 2002
lpfA-R	TTATTTCTTATATTCGAC
O154-FCT	GCAGGTCACCTACAGGCGGC	lpfA _O157/OI-154	Toma et al., 2004
O154-RCT	CTGCGAGTCGGCGTTAGCTG
SAADF	CGTGATGAACAGGCTATTGC	Saa	Paton and Paton, 2002
SAADR	ATGGACATGCCTGTGGCAAC
toxB.911F	ATACCTACCTGCTCTGGATTGA	toxB	Tarr et al., 2002
toxB.1468R	TTCTTACCTGATCTGATGCAGC
iha-I	CAGTTCAGTTTCGCATTCACC	Iha	Schmidt et al., 2001
iha-II	GTATGGCTCTGATGCGATG
LH0147-BamHI	CCCGGATCCGGAAACTCCAAGAGTATTGC	Sab	Herold et al., 2009
LH0147-EcoRI	CCCGAATTCCCTTGCTTTTCCCTGTTACC
Stx1c-1	TTTTCACATGTTACCTTTCCT	stxA_1c	Zhang et al., 2002
Stx1c-2	CATAGAAGGAAACTCATTAGG
VT1varF	CTTTTCAGTTAATGCGATTGCT	stxA_1d	Burk et al., 2003
VT1varR	AACCCCATGATATCGACTGC
LP43	ATCCTATTCCCGGGAGTTTACG	stxA₂ variants	Cebula et al., 1995
LP44	GCGTCATCGTATACACAGGAGC
GK3	ATGAAGAAGATGTTTATG	stx ₂ B and stx _2c B	Gunzar et al., 1992
GK4	TCAGTCATTATTAAACTG
SLT-II-vc	ACCACTCTGCAACGTGTCGC	stx _2c and stx _2dact	Jelacic et al., 2003
CKS2	ACTGAATTGTGACACAGATTA
VT2-cm	AAGAAGATATTTGTAGCGG	stx _2d B	Piérard et al., 1998
VT2-f	TAAACTGCACTTCAGCAAAT
FK1	CCCGGATCCAAGAAGATGTTTATAG	stx _2e B	Franke et al., 1995
FK2	CCCGAATTCTCAGTTAAACTTCACC
128-1	AGATTGGGCGTCATTCACTGGTTG	stx _2f A	Schmidt et al., 2000
128-2	TACTTTAATGGCCGCCCTGTCTCC
209F	GTTATATTTCTGTGGATATC	stx_2g	Leung et al., 2003
781R	GAATAACCGCTACAGTA
VSAAF	ACTCGCATAATTGGTGGTG	saa variants	Lucchesi et al., 2006
VSAAR	ATCATTGGTATTGCTGTCAT
EaeVF	AGYATTACTGAGATTAAG	eaeA variants	Ramachandran et al., 2003
EaeVR	AAATTATTYTACACARAY
EaeZetaVR	AGTTTATTTTACGCAAGT
EaeIotaVR	TTAAATTATTTTATGCAAAC

Table 3.

Isolates Used as Positive Controls

Strain	Serotype	Source	Target gene	Reference/source
3653/97	O78: H-	Patient with diarrhea	stx _1c	Zhang et al., 2002
7139/96	O8: H-	Asymptomatic carrier	stx _1d	Kuczius et al., 2004
E32511	O157: H-	Patient with HC	stx _2c	Hii et al., 1991
EH250	ONT:H12	Patient with diarrhea	stx _{2d (non-activatable)}	Piérard et al., 1998
B2F1	O91:H21	Patient with HUS	stx _{2d-activatable}	Melton-Celsa et al., 1996
2771/97	ONT: H-	Patient with diarrhea	stx _2e	Muniesa et al., 2000
T4/97	O128:H2	Pigeon	stx _2f	Schmidt et al., 2000
EC132	O111:H-	Bovine feces	stx₁ , stx ₂, eaeA & hlyA	University of Munster, Germany
98NK2	O113:H21	Patient with HUS	lpf _O113, saa, sab	Paton and Paton, 1999
38094	O157:H7	Patient with HUS	KatP, etpD, Tir, espP, espA, espB, lpf _O157/OI154, toxB & iha	CDC, Atlanta, GA
C9490	O157:H7	Patient with HUS	Lpf	Wells et al., 1983

HC, hemorrhagic colitis; HUS, hemolytic uremic syndrome; CDC, Centers for Disease Control and Prevention.

MLST analysis

Seven housekeeping genes were amplified and sequenced in accordance with the protocol of the Escherichia coli Multilocus Sequence Typing (MLST) Database (http://mlst.ucc.ie/mlst/dbs/Ecoli/documents/primersColi_html). The genes chosen (coding for proteins in the parentheses) were as follows: adk (adenylate kinase), fumC (fumarate hydratase), gyrB (DNA gyrase), icd (isocitrate/isopropylmalate dehydrogenase), mdh (malate dehydrogenase), purA (adenylosuccinate dehydrogenase), and recA (recombinase A). DNA templates were quantified using an ND-1000 NanoDrop spectrophotometer (NanoDrop Technologies, LLC, Wilmington, DE). Amplification of housekeeping genes was carried out using the primers and annealing temperatures as listed in Table 4. The annealing temperature was dependant on primer sets. After amplification, all PCR products were verified for size and integrity by electrophoresis, as previously described. Product length varied from 583 to 932 bp (Table 4). In some cases, where more than one PCR product was amplified, the expectant size band was excised from the agarose gel and PCR product extracted.

Table 4.

Primer Sequence, Product Length, and Annealing Temperature of Primers Used in MLST Analysis

Gene	Sequence (5’-3’)	Annealing temperature (^oC)	Product size (base pairs)
adk	adkF1: TCATCATCTGCACTTTCCGC	54°C	583
	adkR1: CCAGATCAGCGCGAACTTCA
fumC	fumCR1: TCCCGGCAGATAAGCTGTGG	54°C	806
	fumCF: TCACAGGTCGCCAGCGCTTC
	fumCR: GTACGCAGCGAAAAAGATTC
gyrB	gyrBF: TCGGCGACACGGATGACGGC	60°C	911
	gyrBR1: GTCCATGTAGGCGTTCAGGG
	gyrBR: ATCAGGCCTTCACGCGCATC-
icd	icdF: ATGGAAAGTAAAGTAGTTGTTCCGGCACA	54°C	878
	icdR: GGACGCAGCAGGATCTGTT
mdh	mdhF: ATGAAAGTCGCAGTCCTCGGCGCTGCTGGCGG	60°C	932
	mdhR: TTAACGAACTCCTGCCCCAGAGCGATATCTTTCTT
purA	purAF1: TCGGTAACGGTGTTGTGCTG	58°C	816
	purAF: CGCGCTGATGAAAGAGATGA
	purAR: CATACGGTAAGCCACGCAGA
recA	recAR1 5′-AGCGTGAAGGTAAAACCTGTG	58°C	780
	recAF 5′-CGCATTCGCTTTACCCTGACC
	recAF1 5′-ACCTTTGTAGCTGTACCACG
	recAR 5′-TCGTCGAAATCTACGGACCGGA

From http://mlst.ucc.ie/mlst/dbs/Ecoli/documents/primersColi_html

MLST, multilocus sequence typing.

All PCR-generated DNA templates were purified using the Qiagen QIAquick PCR purification kit (model 28106), and double-stranded sequencing was carried out by Eurofins MWG (Ebersberg, Germany) along with each respective primer set. All DNA sequence analysis was carried out using programs from the DNASTAR Lasergene 7 software package (DNASTAR, Madison, WI). Assembly was carried out using SeqMan, trimming using SeqBuilder, and alignment using MegAlign through the clustal W method. Each of the seven gene loci was assigned an allele number by submission of the sequences to the MLST Database at the ERI, University College Cork (http://mlst.ucc.ie/mlst/dbs/Ecoli/). Each isolate was assigned a sequence type (ST) according to its allelic profile.

PFGE analysis

Pulse field gel electrophoresis was preformed using the standardised protocol for subtyping of E. coli O157:H7, as established by the Centers for Disease Control and Prevention (CDC, Atlanta, GA) (Ribot et al., 2006). Restriction digestion was carried out on 2-mm slices of plugs by incubating overnight with the restriction enzyme XbaI (New England Biolabs, Ipswich, MA). Gels were immersed in O.5×Tris/boric acid/EDTA buffer (TBE; Sigma-Aldrich, St. Louis, MO) and run with the following parameters: initial switch time 2.16 s, final switch time 54.17 s, run time 18 h, 30-kb low MW, 600-kb high MW, temperature 14°C, ramping factor linear, pump at 11 min⁻¹. PFGE profiles were normalized and subjected to computer-assisted DNA fingerprint analysis using BioNumerics software (Applied Maths, Sint-Martens-Latem, Belgium). The genetic diversity and relatedness of the E. coli O113 isolates were compared at an 80% similarity criterion using Dice coefficient and the underweighted pair group method (UPGMA).

Results

Serotypic analysis of the O (lipopolysaccharide) antigens confirmed all the tested isolates as O-type 113. H (flagellar) analysis identified the Irish isolates (clinical, farm and abattoir) as H type 4 and the remaining (Australian, New Zealand, and Norwegian) isolates as H type 21.

The distribution of virulence genes detected in the isolates is shown in Table 5. The toxin gene stx _2d was common to all isolates (100%), while stx ₁ was present in the majority of farm, abattoir, and clinical isolates of Irish origin (83%). The stx _1c gene was present only in the two Irish human clinical isolates. The attachment-associated gene iha was present in all isolates, and the enterohemolysin gene hlyA was common to all clinical, food, and Norwegian bovine isolates. The plasmid-encoded espP gene was also detected in these isolates and in addition was detected in one Irish bovine hide isolate (23% of all isolates). The pO113-associated lpfA_O113 and saa genes were present in all isolates from Norway, Australia, and New Zealand (17% of all isolates), while the sab gene was only detected in the clinical isolates from Australia and New Zealand (11% of all isolates). All isolates lacked the following genes: eaeA, tir, espA, espB, katP, etpD, toxB, lpfA_O157/OI-141, and lpfA_O157/OI-154.

Table 5.

Distribution of Virulence Genes in All Isolates

		Virulence genes detected ^a
Isolate code	Serotype	stx₁	stx₂	hlyA	lpfA_O113	espP	saa	sab	iha
Aus 1, 3, and 5	O113:H21	−	stx _2d	+	+	+	+	+	+
NZ 4 and 6
Aus 2, Nor 16 and 17	O113:H21	−	stx _2d	+	+	+	+	−	+
Cl Ire 1 and 3	O113:H4	stx _1c	stx _2d	+	−	+	−	−	+
Ire A49		stx ₁	stx _2d	−	−	+	−	−	+
Ire 9, 11, 35, 36, 81, 101, 102, 103, 104, 105, 106, 117, 140, 141, 142, 143, 154, 155, 156, 157, 158, 159, 160, 161, 162, and 227	O113:H4	stx ₁	stx _2d	−	−	−	−	−	+
Ire 37 and 153	O113:H4	stx ₁	stx _2d	−	−	−	−	−	+
Ire A7, 8, 9, 10, 11 & Ire 98, 99, and 118	O113:H4	−	stx _2d	−	−	−	−	−	+

Note: eaeA, tir, espA, espB, katP, etpD, toxB, iha, lpfA_O157/OI-141, and lpfA_O157/OI-154 were not detected in any of the isolates.

Thirty-three distinct PFGE patterns were identified from the 46 isolates (Fig. 1). Four different patterns (A–D) contained two or more isolates with “indistinguishable” patterns in accordance with Tenover's interpretation (Tenover et al., 1995); all of these were within the Irish cohort of isolates. The largest of these (pattern A) contained 11 Irish isolates (Ire 153, 11, 37, 140, 35, 36, 143, 104, 105, 81, and 106) with an indistinguishable pattern. These Irish isolates were composed of seven bovine feces and four soil isolates, from three different farms and isolated on different sampling occasions over the course of 12 months (Monaghan et al., 2011). Ire 9 and Ire 99 were closely related to each other and to pattern A. These isolates originated from different farms and were isolated at different times of the year. Pattern B comprised two “indistinguishable” isolates (Ire A7 and A8 bovine hides) which were also “closely related” (within 2–3 fragment differences) to Irish isolates Ire A10 and A9 (bovine hides). These four isolates were obtained in the same abattoir on the same occasion. Pattern C comprised two “indistinguishable” isolates (Ire 161 and 162) which were from bovine feces and were isolated from the same farm on the same sampling trip. Pattern D comprised two “indistinguishable” isolates (Ire 157 and 159) originating from bovine feces; these isolates also originated from the same farm and were isolated on the same sampling trip. All other 25 PFGE patterns were unrelated and distinct from each other. This included all the human clinical isolates from Ireland, Australia, and New Zealand and the food isolate from Australia and the bovine isolates from Norway.

FIG. 1.

Pulsed-field gel electrophoresis (PFGE) profile of farm, abattoir, food, and clinical O113 isolates.

The 46 isolates provided seven MLST loci and could be grouped into three different STs (Fig. 1). All of the Irish isolates belonged to ST 10. The Norwegian bovine isolates and the Australian food isolate belonged to ST223, and the clinical isolates from Australia and New Zealand all belonged to ST56.

Discussion

All of the Irish STEC O113 isolates were H type 4, regardless of source (farm, abattoir, or human clinical). This serotype has been previously isolated from foods of bovine origin and has been implicated in human illness (Prager et al., 2005; Werber et al., 2008). The O113:H4 predominance in Ireland is in contrast to other countries where H type 21 is more common as a causative agent in human infections (Paton and Paton, 1999; Hogan et al., 2001; Blanco et al., 2003).

Virulence gene analysis of the isolates showed that stx _2d was common to all, regardless of source or geographic origin. The presence of this variant across all of the O113 isolates correlates with the findings of previous work (Miko et al., 2009). A close association has been found between the severity of disease in infected patients and the presence of the stx ₂ gene (Beutin et al., 2002). The stx ₁ gene was present in the majority of the Irish isolates, and the human clinical strains carried the stx _1c variant. This was not unexpected as the stx _1c variant is frequently detected in O113:H4 (Friedrich et al., 2003) and is commonly associated with intimin-negative isolates.

In addition to Shiga toxin–producing genes, virulence gene profiling data obtained in this study also suggested that a number of other genes (hlyA, espP, and iha) are important in O113-associated illness in humans. These genes were common to all clinical isolates regardless of source or geography. In fact, the iha gene was present in all isolates including those of clinical origin. It has previously been described as an adhesion factor and has been shown to increase adhesion to epithelial cells (Leveile et al., 2006). The putative adhesion gene saa was present in the clinical isolates from Australia and New Zealand, but this gene was absent from the Irish clinical isolates. It has been previously speculated that the presence of the saa gene is a mandatory factor in the facilitation of human illness with STEC O113 (Paton and Paton, 1999). However, our data clearly demonstrates that the saa gene was absent in strains associated with gastrointestinal illness, and to the best of our knowledge this is the first report of a clinically significant STEC strain lacking both saa and eaeA genes.

The hlyA and espP gene products may also play a significant role in pathogenicity. Both genes were exclusive to the clinical isolates with the exception of one abattoir isolate which carried the latter. It is generally accepted that the hlyA gene product has a key role in human infection. Antibodies to this hemolysin have been detected in the sera of convalescent HUS patients (Schmidt et al., 1995), and a cytotoxic effect of the HlyA toxin on human endothelial cells has also been reported (Aldick et al., 2007). The espP gene has similarly been linked to pathogenic STEC (Jarvis and Kaper, 1996; Brunder et al., 1997).

The LpfA genetic variant lpfA_O113 was not detected in any of the Irish isolates regardless of source. This gene was however present in the clinical isolates originating from Australia and New Zealand. The absence of this gene in (Irish human) clinical isolates suggests that its products are not essential for associated illness in humans and may be exclusively affiliated with O113:H21 isolates.

MLST analysis assigned the isolates to three STs. All of the Irish isolates tested were assigned to ST10; all of these isolates shared similar virulence profiles and were serotype O113:H4. Five isolates (all clinical isolates from Australia and New Zealand) were assigned to ST56; all isolates shared identical virulence profiles and were O113:H21. The remaining isolates (three) were assigned to ST223 (Norwegian and Australian); all of these were O113:H21 isolates with identical virulence profiles. Of the STs identified, ST10 and ST223 have been previously isolated from humans (E. coli MLST Database, http://mlst.ucc.ie/). MLST ST10 is commonly associated with isolates of human origin and has also been found to a lesser extent in animals, including cattle, poultry, pigeons, rabbits, and pigs, while ST223 has been isolated from human, bovine, and canine samples. ST56 has not been isolated from humans but has been reported in samples from bison, giraffe, and sheep. To the best of our knowledge, this is the first time that a clinically significant O113:H21 strain of ST56 has been reported in the MLST database (http://mlst.ucc.ie/).

PFGE clustered the Irish isolates of farm and abattoir origin together with exceptions. The Australian clinical isolates Aus 3 and Australian food isolate Aus 2 clustered away from the rest of the clinical isolates. The remaining Australian, New Zealand and Irish clinical isolates and Norwegian bovine isolates clustered together. These groupings were in contrast to the MLST findings and illustrate that, although they may be viewed as complementary techniques, discrepancies between molecular typing methods remain (Melles et al., 2007).

The PFGE “indistinguishable” patterns were confined to Irish nonhuman isolates only. Evidence of clonality was found in Irish bovine feces and soil. This is as expected, considering the cattle grazing routines and associated fecal contamination of the Irish pastures. The absence of a PFGE link between the two Irish human isolates suggests that these infections may have been sporadic and may not be associated with the Irish bovine or environmental isolates.

Conclusion

This study demonstrated the transfer of geographically similar STEC O113 from soil, bovine feces, and hides to carcasses. Virulence profiling suggests the farm and abattoir isolates were potentially clinically significant. When comparisons were carried out between the Irish clinical and non-clinical isolates, virulence gene profiling was found to be very similar with all isolates carrying stx ₁, stx _2d, and iha genes. The Irish isolates had the same ST using MLST analysis; however, further discriminatory PFGE typing did not show clonality between the Irish human isolates and the bovine or environmental isolates. The Irish clinical isolates also lacked the saa gene, and this demonstrated, for the first time, that isolates which lack the eae and saa genes may also be clinically significant, suggesting another mechanism of attachment. The Australian, New Zealand, and Norwegian isolates showed fewer similarities to both the clinical and environmental Irish isolates, with the most notable difference being their H type and “different” PFGE patterns.

The findings of this work emphasize the need for continued monitoring of non-O157 serogroups, especially within the food chain, where the focus of monitoring is heavily biased toward O157. Furthermore, STEC O113 is emerging and may be a significant threat to public health in the future. Further research on the epidemiology and pathogenicity of this serotype is therefore urgently required.

Footnotes

Acknowledgments

This project was funded by the Department of Agriculture, Fisheries and the Marine (DAFM) under the Food and Institutional Research Measure (FIRM), Ireland.

Disclosure Statement

No competing financial interests exist.

References

Aldick

, Bielaszewska

, Zhang

, Brockmeyer

, Schmidt

, Friedrich

, Kim

, Schmidt

, Karch

. Hemolysin from Shiga toxin–negative Escherichia coli O26 strains injures microvascular endothelium. Microbes Infect, 2007; 9:282–290.

Anonymous. The Community Summary Report on Trends and Sources of Zoonoses, Zoonotic Agents and Food-Borne Outbreaks in the European Union in 2009. EFSA J, 2011; 9:2090.

Beutin

, Zimmermann

, Gleier

. Human infections with Shiga toxin–producing Escherichia coli other than serogroup O157 in Germany. Emerg Infect Dis, 1998; 4:635–639.

Beutin

, Kaulfuss

, Cheasty

, Brandenburg

, Zimmermann

, Gleier

, Willshaw

, Smith

. Characteristics and association with disease of two major subclones of Shiga toxin (Verocytotoxin)–producing strains of Escherichia coli (STEC) O157 that are present among isolates from patients in Germany. Diagn Microbiol Infect Dis, 2002; 44:337–346.

Beutin

, Kong

, Feng

, Wang

, Krause

, Leomil

, Jin

, Wang

. Development of PCR assays targeting the genes involved in synthesis and assembly of the new Escherichia coli O174 and O177 O antigens. J Clin Microbiol, 2005; 43:5143–5149.

Blanco

, Blanco

, Mora

, González

, Bernárdez

, Alonso

, Coira

, Rodriguez

, Rey

, Alonso

, Usera

. Verotoxin-producing Escherichia coli in Spain: Prevalence, serotypes, and virulence genes of O157:H7 and non-O157 VTEC in ruminants, raw beef products, and humans. Exp Biol Med (Maywood), 2003; 228:345–351.

Blanco

, Blanco

, Dahbi

, Mora

, Alonso

, Varela

, Gadea

, Schelotto

, González

, Blanco

. Typing of intimin (eae) genes from enteropathogenic Escherichia coli (EPEC) isolated from children with diarrhea in Montevideo, Uruguay: Identification of two novel intimin variants (μB and ξR/β2B) J Med Microbiol, 2006; 55:1165–1174.

Bolton

. Verocytotoxigenic (Shiga toxin–producing) Escherichia coli: Virulence factors and pathogenicity in the farm to fork paradigm. Foodborne Pathog Dis, 2011; 8:357–365.

Bosilevac

, Koohmaraie

. Prevalence and characterization of non-O157 Shiga toxin–producing Escherichia coli isolated from commercial ground beef in the United States. Appl Environ Microbiol, 2011; 77:2103–2112.

10.

Brunder

, Schmidt

, Karch

. KatP, a novel catalase peroxidase encoded by the large plasmid of enterohaemorrhagic Escherichia coli O157:H7. Microbiology, 1996; 142:3305–3315.

11.

Brunder

, Schmidt

, Karch

. EspP, a novel extracellular serine protease of enterohaemorrhagic Escherichia coli O157:H7 cleaves human coagulation factor V. Mol Microbiol, 1997; 24:767–778.

12.

Bürk

, Dietrich

, Açar

, Moravek

, Bülte

, Märtlbauer

. Identification and characterization of a new variant of Shiga toxin 1 in Escherichia coli ONT:H19 of bovine origin. J Clin Microbiol, 2003; 41:2106–2112.

13.

Cebula

, Payne

, Feng

. Simultaneous identification of strains of Escherichia coli serotype O157:H7 and their Shiga-like toxin type by mismatch amplification mutation assay-multiplex PCR. J Clin Microbiol, 1995; 33:248–250.

14.

Decludt

, Bouvet

, Mariani-Kurkdjian

, Grimont

, Hubert

, Loirat

. Haemolytic uraemic syndrome and Shiga toxin–producing Escherichia coli infection in children in France. The Société de Néphrologie Pédiatrique. Epidemiol Infect, 2000; 124:215–220.

15.

dos Santos

, Irino

, Vaz

, Guth

. Set of virulence genes and genetic relatedness of O113:H21 Escherichia coli strains isolated from the animal reservoir and human infections in Brazil. J Med Microbiol, 2010; 59:634–640.

16.

Doughty

, Sloan

, Bennett-Wood

, Robertson

, Robins-Browne

, Hartland

. Identification of a novel fimbrial gene cluster related to long polar fimbriae in locus of enterocyte effacement–negative strains of enterohemorrhagic Escherichia coli. Infect Immun, 2002; 70:6761–6769.

17.

Fernández

, Irino

, Sanz

, Padola

, Parma

. Characterization of Shiga toxin–producing Escherichia coli isolated from dairy cows in Argentina. Lett Appl Microbiol, 2010; 51:377–382.

18.

Franke

, Gunzer

, Wieler

, Baljer

, Karch

. Construction of recombinant Shiga-like toxin-IIv (SLT-IIv) and its use in monitoring the SLT-IIv antibody status of pigs. Vet Microbiol, 1995; 43:41–52.

19.

Friedrich

, Borell

, Bielaszewska

, Fruth

, Tschäpe

, Karch

. Shiga toxin 1c–producing Escherichia coli strains: Phenotypic and genetic characterization and association with human disease. J Clin Microbiol, 2003; 41:2448–2453.

20.

Fuller

, Pellino

, Flagler

, Strasser

, Weiss

. Shiga toxin subtypes display dramatic differences in potency. Infect Immun, 2011; 79:1329–1337.

21.

Garvey

, McKeown

, Carroll

, McNamara

. Epidemiology of verotoxigenic E. coli in Ireland, 2006. Epi-Insight, 2008; 9:2–3.

22.

Garvey

, McKeown

, Carroll

, McNamara

. Epidemiology of verotoxigenic E. coli in Ireland, 2007. Epi-Insight, 2009a. 10,9.

23.

Garvey

, McKeown

, Carroll

, McNamara

. Epidemiology of verotoxigenic E. coli In Ireland, 2008. Epi-Insight, 2009b. 10,9.

24.

Griffin

, Tauxe

. The epidemiology of infections caused by Escherichia coli O157:H7, other enterohemorrhagic E. coli, and the associated hemolytic uremic syndrome. Epidemiol Rev, 1991; 13:60–98.

25.

Gunzer

, Böhm

, Rüssmann

, Bitzan

, Aleksic

, Karch

. Molecular detection of sorbitol-fermenting Escherichia coli O157 in patients with hemolytic uremic syndrome. J Clin Microbiol, 1992; 30:1807–1810.

26.

Herold

, Paton

. Sab, a novel autotransporter of locus of enterocyte effacement–negative Shiga-toxigenic Escherichia coli O113:H21, contributes to adherence and biofilm formation. Infect Immun, 2009; 489:3234–3243.

27.

Hii

, Gyles

, Morooka

, Karmali

, Clarke

, De Grandis

, Brunton

. Development of verotoxin 2– and verotoxin 2 variant (VT2v)–specific oligonucleotide probes on the basis of the nucleotide sequence of the B cistron of VT2v from Escherichia coli E32511 and B2F1. J Clin Microbiol, 1991; 29:2704–2709.

28.

Hogan

, Gloor

, Uhl

, Cockerill

, Milliner

. Two cases of non-O157:H7 Escherichia coli hemolytic uremic syndrome caused by urinary tract infection. Am J Kidney Dis, 2001; 38:1–6.

29.

Jarvis

, Kaper

. Secretion of extracellular proteins by enterohemorrhagic Escherichia coli via a putative type III secretion system. Infect Immun, 1996; 64:4826–4829.

30.

Jelacic

, Damrow

, Chen

, Jelacic

, Bielaszewska

, Ciol

, Carvalho

, Melton-Celsa

, O'Brien

, Tarr

. Shiga toxin–producing Escherichia coli in Montana: Bacterial genotypes and clinical profiles. J Infect Dis, 2003; 188:719–729.

31.

Jerse

, Yu

, Tall

, Kaper

. A genetic locus of enteropathogenic Escherichia coli necessary for the production of attaching and effacing lesions on tissue culture cells. Proc Natl Acad Sci USA, 1990; 87:7839–7843.

32.

Karmali

, Petric

, Lim

, Fleming

, Arbus

, Lior

. The association between idiopathic hemolytic uremic syndrome and infection by verotoxin-producing Escherichia coli. J Infect Dis, 1985; 151:775–782.

33.

Kenny

, Ellis

, Leard

, Warawa

, Mellor

, Jepson

. Co-ordinate regulation of distinct host cell signalling pathways by multifunctional enteropathogenic Escherichia coli effector molecules. Mol Microbiol, 2002; 44:1095–1107.

34.

Kobayashi

, Shimada

, Nakazawa

, Morozumi

, Pohjanvirta

, Pelkonen

, Yamamoto

. Prevalence and characteristics of Shiga toxin–producing Escherichia coli from healthy cattle in Japan. Appl Environ Microbiol, 2001; 67:484–489.

35.

Kuczius

, Bielaszewska

, Friedrich

, Zhang

. A rapid method for the discrimination of genes encoding classical Shiga toxin (Stx) 1 and its variants, Stx1c and Stx1d, in Escherichia coli. Mol Nutr Food Res, 2004; 48:515–521.

36.

Lake

, Hudson

, Cressey

. Risk profile Shiga toxin–producing Escherichia coil in red meat and meat products. New Zealand Food Safety Authority, 2002. www.nzfsa.govt.nz/science/risk-profiles/stec-in-red-meat.pdf. 2012 October 1.

37.

Leung

, Peiris

, Ng

, Robins-Browne

, Bettelheim

, Yam

. A newly discovered verotoxin variant, VT2g, produced by bovine verocytotoxigenic Escherichia coli. Appl Environ Microbiol, 2003; 69:7549–7553.

38.

Léveillé

, Caza

, Johnson

, Clabots

, Sabri

, Dozois

. Iha from an Escherichia coli urinary tract infection outbreak clonal group A strain is expressed in vivo in the mouse urinary tract and functions as a catecholate siderophore receptor. Infect Immun, 2006; 74:3427–3436.

39.

Lucchesi

PMA

, Kruger

, Parma

. Distribution of saa gene variants in verocytotoxigenic Escherichia coli isolated from cattle and food. Res Microbiol, 2006; 157:263–266.

40.

McNally

, Roe

, Simpson

, Thomson-Carter

, Hoey

, Currie

, Chakraborty

, Smith

, Gally

. Differences in levels of secreted locus of enterocyte effacement proteins between human disease-associated and bovine Escherichia coli O157. Infect Immun, 2001; 69:5107–5114.[Retraction in: McNally A, et al. Infect Immun 2005; 73:2571.

41.

Melles

, van Leeuwen

, Snijders

, Horst-Kreft

, Peeters

, Verbrugh

, van Belkum

. Comparison of multilocus sequence typing (MLST), pulsed-field gel electrophoresis (PFGE), and amplified fragment length polymorphism (AFLP) for genetic typing of Staphylococcus aureus. J Microbiol Methods, 2007; 69:371–375.

42.

Melton-Celsa

, Darnell

, O'Brien

. Activation of Shiga-like toxins by mouse and human intestinal mucus correlates with virulence of enterohemorrhagic Escherichia coli O91:H21 isolates in orally infected, streptomycin-treated mice. Infect Immun, 1996; 64:1569–1576.

43.

Miko

, Pries

, Haby

, Steege

, Albrecht

, Krause

, Beutin

. Assessment of Shiga toxin–producing Escherichia coli isolates from wildlife meat as potential pathogens for humans. Appl Environ Microbiol, 2009; 75:6462–6470.

44.

Monaghan

, Byrne

, Fanning

, Sweeney

, McDowell

, Bolton

. Serotypes and virulence profiles of non-O157 Shiga toxin–producing Escherichia coli (STEC) from bovine farms. Appl Environ Microbiol, 2011; 77:8662–8668.

45.

Monaghan

, Byrne

, Fanning

, Sweeney

, McDowell

, Bolton

. Serotypes and virulotypes of non-O157 Shiga toxin–producing Escherichia coli (STEC) on bovine hides and carcasses. Food Microbiol, 2012; 32:223–229.

46.

Muniesa

, Recktenwald

, Bielaszewska

, Karch

, Schmidt

. Characterization of a Shiga toxin 2e–converting bacteriophage from an Escherichia coli strain of human origin. Infect Immun, 2000; 68:4850–4855.

47.

Paton

, Paton

. Detection and characterization of Shiga toxigenic Escherichia coli by using multiplex PCR assays for stx1, stx2, eaeA, enterohemorrhagic E. coli hlyA, rfbO111, and rfbO157. J Clin Microbiol, 1998; 36:598–602.

48.

Paton

, Paton

. Molecular characterization of the locus encoding biosynthesis of the lipopolysaccharide O antigen of Escherichia coli serotype O113. Infect Immun, 1999; 67:5930–5937.

49.

Paton

, Paton

. Direct detection and characterization of Shiga toxigenic Escherichia coli by multiplex PCR for stx1, stx2, eae, ehxA, and saa. J Clin Microbiol, 2002; 40:271–274.

50.

Paton

, Ratcliff

, Doyle

, Seymour-Murray

, Davos

, Lanser

, Paton

. Molecular microbiological investigation of an outbreak of hemolytic uremic syndrome caused by dry fermented sausage contaminated with Shiga-like toxin–producing Escherichia coli. J Clin Microbiol, 1996; 34:1622–1627.

51.

Paton

, Woodrow

, Doyle

, Lanser

, Paton

. Molecular characterization of a Shiga toxigenic Escherichia coli O113:H21 strain lacking eae responsible for a cluster of cases of hemolytic uremic syndrome. J Clin Microbiol, 1999; 37:3357–3361.

52.

Piérard

, Stevens

, Moriau

, Lior

, Lauwers

. Isolation and virulence factors of verocytotoxin-producing Escherichia coli in human stool samples. Clin Microbiol Infect, 1997; 3:531–540.

53.

Piérard

, Muyldermans

, Moriau

, Stevens

, Lauwers

. Identification of new verocytotoxin type 2 variant B-subunit genes in human and animal Escherichia coli isolates. J Clin Microbiol, 1998; 36:3317–3322.

54.

Prager

, Annemuller

, Tschape

. Diversity of virulence patterns among Shiga toxin–producing Escherichia coli from human clinical cases—Need for more detailed diagnostics. Int J Med Microbiol, 2005; 295:29–38.

55.

Ramachandran

, Brett

, Hornitzky

, Dowton

, Bettelheim

, Walker

, Djordjevic

. Distribution of intimin subtypes among Escherichia coli isolates from ruminant and human sources. J Clin Microbiol, 2003; 41:5022–5032.

56.

Ribot

, Fair

, Gautom

, Cameron

, Hunter

, Swaminathan

, Barrett

. Standardization of pulsed-field gel electrophoresis protocols for the subtyping of Escherichia coli O157:H7, Salmonella, and Shigella for PulseNet. Foodborne Pathog Dis, 2006; 3:59–67.

57.

Rivas

, Miliwebsky

, Chinen

, Roldán

, Balbi

, García

, Fiorilli

, Sosa-Estani

, Kincaid

, Rangel

, Griffin

. Case-Control Study Group. Characterization and epidemiologic subtyping of Shiga toxin–producing Escherichia coli strains isolated from hemolytic uremic syndrome and diarrhea cases in Argentina. Foodborne Pathog Dis, 2006; 3:88–96.

58.

Schmidt

, Rüssmann

, Schwarzkopf

, Aleksic

, Heesemann

, Karch

. Prevalence of attaching and effacing Escherichia coli in stool samples from patients and controls. Zentralbl Bakteriol, 1994; 281:201–213.

59.

Schmidt

, Beutin

, Karch

. Molecular analysis of the plasmid-encoded hemolysin of Escherichia coli O157:H7 strain EDL 933. Infect Immun, 1995; 63:1055–1061.

60.

Schmidt

, Henkel

, Karch

. A gene cluster closely related to type II secretion pathway operons of Gram-negative bacteria is located on the large plasmid of enterohemorrhagic in Escherichia coli O157 strains. FEMS Microbiol Lett, 1997; 148:265–272.

61.

Schmidt

, Scheef

, Morabito

, Caprioli

, Wieler

, Karch

. A new Shiga toxin 2 variant (Stx2f) from Escherichia coli isolated from pigeons. Appl Environ Microbiol, 2000; 66:1205–1208.

62.

Schmidt

, Zhang

, Hemmrich

, Jelacic

, Brunder

, Tarr

, Dobrindt

, Hacker

, Karch

. Identification and characterization of a novel genomic island integrated at selC in locus of enterocyte effacement–negative, Shiga toxin–producing Escherichia coli. Infect Immun, 2001; 69:6863–6873.

63.

Szalo

, Goffaux

, Pirson

, Piérard

, Ball

, Mainil

. Presence in bovine enteropathogenic (EPEC) and enterohaemorrhagic (EHEC) Escherichia coli of genes encoding for putative adhesins of human EHEC strains. Res Microbiol, 2002; 153:653–658.

64.

Tarr

, Bilge

, Vary

Jr , Jelacic

, Habeeb

, Ward

, Baylor

, Besser

. Iha: A novel Escherichia coli O157:H7 adherence-conferring molecule encoded on a recently acquired chromosomal island of conserved structure. Infect Immun, 2000; 68:1400–1407.

65.

Tarr

, Large

, Moeller

, Lacher

, Tarr

, Acheson

, Whittam

. Molecular characterization of a serotype O121:H19 clone, a distinct Shiga toxin–producing clone of pathogenic Escherichia coli. Infect Immun, 2002; 70:6853–6859.

66.

Toma

, Martínez Espinosa

, Song

, Miliwebsky

, Chinen

, Iyoda

, Iwanaga

, Rivas

. Distribution of putative adhesins in different seropathotypes of Shiga toxin–producing Escherichia coli. J Clin Microbiol, 2004; 42:4937–4946.

67.

Torres

, Giron

, Perna

, Burland

, Blattner

, Avelino-Flores

, Kaper

. Identification and characterization of lpfABCC'DE, a fimbrial operon of enterohemorrhagic Escherichia coli O157:H7. Infect Immun, 2002; 70:5416–5427.

68.

, Nisan

, Yona

, Hanski

, Rosenshine

. EspH, a new cytoskeleton-modulating effector of enterohaemorrhagic and enteropathogenic Escherichia coli. Mol Microbiol, 2003; 47:595–606.

69.

Wells

, Davis

, Wachsmuth

, Riley

, Remis

, Sokolow

, Morris

. Laboratory investigation of hemorrhagic colitis outbreaks associated with a rare Escherichia coli serotype. J Clin Microbiol, 1983; 18:512–520.

70.

Werber

, Beutin

, Pichner

, Stark

, Fruth

. Shiga toxin–producing Escherichia coli serogroups in food and patients, Germany. Emerg Infect Dis, 2008; 14:1803–1806.

71.

Zhang

, Bielaszewska

, Kuczius

, Karch

. Identification, characterization, and distribution of a Shiga toxin 1 gene variant (stx1c) in Escherichia coli strains isolated from humans. J Clin Microbiol, 2002; 40:1441–1446.