Prevalence and Molecular Characterization of Vibrio cholerae O1,Non-O1 and Non-O139 in Tropical Seafood in Cochin,India

Abstract

The objective of this study was to determine the prevalence of O1, O139, and non-O1 and non-O139 Vibrio cholerae, which were associated with fresh and raw seafood samples harvested from Cochin, India waters during 2009–2011. Results from V. cholerae–specific biochemical, molecular, and serological assays identified five El Tor V. cholerae O1 Ogawa strains and 377 non-O1, non-O139 V. cholerae strains from 265 seafood samples. V. cholerae O139 strains were not isolated. Polymerase chain reaction assays confirmed the presence of V. cholerae O1 El Tor biotype in seafood. Antibiotic susceptibility analysis revealed that the V. cholerae O1 strains were pansusceptible to 20 test antibiotics, whereas 26%, 40%, 62%, and 84% of the non-O1, non-O139 V. cholerae strains were resistant to cefpodoxime, ticarcillin, augmentin, and colistin, respectively. Detection of virulence and regulatory genes in V. cholerae associated with seafood revealed the presence of virulence and regulatory genes (i.e., ctx, zot, ace, toxR genes) in V. cholerae O1 strains, nevertheless, presence of ace and toxR genes were detected in non-O1, non-O139 in 9.8 and 91% strains, respectively. In conclusion, the presence of pathogenic V. cholerae in seafood harvested from local Cochin waters warrants the introduction of a postharvest seafood monitoring program, which will lead to a greater understanding of the distribution, abundance, and virulence of diverse pathogenic Vibrio populations that inhabit these different coastal regions so that a risk management program can be established.

Introduction

I n 2011, worldwide approximately 589,854 cases of cholera, including 7816 deaths, were reported from 58 countries (WHO, 2011). Out of more than 200 seroytpes of V. cholerae, only two serogroups, O1 and O139, are epidemics and pandemic in nature. The non-O1 and non-O139 strains have been associated with mild gastroenteritis outbreaks. Natural habitat of V. cholerae is aquatic environment in riverine, estuarine, and coastal ecosystems. Fish has been reported as an important reservoir for V. cholerae (Senderovich et al., 2010). Presence and detection of V. cholerae in fish, crustaceans, molluscan filter feeders, and aquatic environments warrant the importance of extensive study on prevalence of V. cholerae in tropical seafood.

There are numerous incidences of rejection and detention of seafood products due to the presence of V. cholerae in international seafood trade originated from Asia and Africa regions (Huss et al., 2003). Warm-water shrimp imported from Taiwan, India, and Indonesia showed a reportedly high level of V. cholerae contamination and for certain instances, detection of V. cholerae in cockles and mussels were reported in Malaysia and Thailand, respectively (Shiraishi et al., 1996; Suzita et al., 2009). The FAO microbiological risk assessment program describes a risk management approach for choleragenic V. cholerae O1 and O139 associated with internationally traded warm-water shrimp species (FAO, 2005).

Genetic studies and nucleotide analysis gave evidence that non-O1 and O139 serotypes are involved in the emergence of newer serotypes of V. cholerae. The emergence of pandemic V. cholerae O139 strains containing V. cholerae O1 virulence associated genes that were acquired though horizontal gene transfer mechanisms emphasizes the need for a robust seafood surveillance program so that future emerging pandemic V. cholerae serotypes can be promptly identified. Molecular characterization of virulence-associated genes such as ctx, toxR, ace, tcp, and zot indicate the virulence nature of V. cholerae, and these genes have been established as genetic markers for virulence, thus highlighting the choleragenic nature of O1, O139 V. cholerae (Faruque et al., 1998). Antimicrobial resistance in V. cholerae is a major issue in the Indian subcontinent as the reports by Siddique et al. (1989), Das et al. (2008) and Mandal et al. (2012) demonstrate and these studies have raised concerns that antibiotic use in the treatment of cholera may have led to the emergence of multidrug-resistant V. cholerae strains. The aim of this study was to determine the prevalence of V. cholerae in seafood, with emphasis on virulence genes and antimicrobial resistance pattern.

Materials and Methods

Isolation and identification

More than 100 tons of seafood landings pass through Cochin fishing harbor daily; this seafood is subsequently distributed to the different fish markets within the city and surrounding areas. A total of 265 fresh and raw seafood samples were collected from seven fish markets of Cochin and nearby areas, over a period of 3 years (2009–2011). The periods of seafood samples collected from different fish markets are given in Table 1. The samples were collected in sterile polythene bags and were assayed for V. cholerae within 2–3 h. The seafood samples comprising fish (n=87), shrimp (n=59), clam (n=35), crab (n=31), mussel (n=29), and squid (n=24) were included in the study. Seafood samples were analyzed for the presence of V. cholerae as per Bacteriological Analytical Manual, U.S. Food and Drug Administration method (Elliot et al., 2001). Seafood samples consisting of whole body parts of fish, shrimp, squid, crabs, and soft muscle parts of clam and mussel were included in the analysis. Twenty-five grams of each seafood was homogenized with 225 mL of alkaline peptone water in a stomacher (Seward, UK) and pre-enriched at 37°C for 18 h, followed by selective plating onto thiosulfate citrate bile salt sucrose agar. Typical colonies on selective plates were screened for the key biochemical reactions for V. cholerae according to the Bacteriological Analytical Manual (Elliot et al., 2001) and Bergey's Manual of Systematic Bacteriology (Brenner and Farmer III, 2005). All dehydrated media used in this study were procured from BD Difco (Sparks, MD) or else indicated.

Table 1.

Periods of Seafood Collection from Different Fish Markets of Cochin

Sampling period	Seafood and number of sample	Fish markets
April–June 2009	Fish, shrimp, crab, clam; 48	1,2,3
October–December 2009	Fish, shrimp, clam, squid; 37	1,2,3
January–March 2010	Fish, shrimp, mussel, squid; 35	1,5,6
September–December 2010	Fish, shrimp, crab, squid; 21	2,3,4
January–March 2011	Fish, shrimp, crab, squid; 31	1,3,5
April–June 2011	Fish, shrimp, crab, clam, squid; 68	1,2,4
October–December 2011	Fish, shrimp, crab, clam, squid; 25	1,2,3

1, Polkandom; 2, Fort Kochi; 3, Thevara; 4, Ernakulum; 5, Aroor; 6, Kaloor.

Serotyping of V. cholerae isolates

The biochemically confirmed V. cholerae isolates were serotyped to ascertain the presence of pandemic strains such as V. cholerae O1 and O139 in seafood. The biochemically confirmed isolates were initially tested for V. cholerae poly O1 antiserum (BD Difco) and if positive were further screened for the presence of individual O1 serogroup antigens (Ogawa, Inaba, and Hikojima, BD Difco). The isolates negative with the V. cholerae poly O1 antiserum were further screened for the presence of the V. cholerae O139 “Bengal” serogroup using O139 serogroup-specific antiserum (Denka Seiken, Japan) as per manufacturer's instructions.

PCR analysis for the confirmation of V. cholerae O1 Classical and El Tor biotypes and O139 strains

PCR-based assays were performed to determine the prevalence and distribution O1, O139, Classical, and El Tor biotypes of V. cholerae by targeting rfb-O1, rfb-O139, tcpA (classical), and tcpA (El Tor) genes among the strains, respectively. DNA from the strains were prepared using the bacterial genomic DNA extraction kit (Sigma, India). The primers used in this assay and the reaction conditions are listed in Table 2. The PCR reaction contained 0.4 pmol/(L concentration of each primer, 200 (M concentration of each dNTP (Finnzymes, Finland), 1X PCR buffer (20 mmol/L Tris-HCl [pH 8.2], 50 mmol/L KCl, 1.5 mmol/L MgCl₂), 1 U of Taq polymerase (Dynazyme II, Finland), and 1 (L of sample DNA ((50 ng). The amplification reaction was 94°C for 3 min, followed by 34 cycles of 94°C for 1 min, 60°C; tcpA (classical and El Tor) and 55°C (rfb-O1 and rfb-O139) for 1 min, and 72°C for 1 min and a final extension of 72°C for 4 min was also employed. The amplified PCR product was run at 6 volts/cm for 120 min on a 1.5% agarose gel containing 0.5 (g/mL of ethidium bromide. Gel images were captured using the Alpha Innotech Corporation (USA) gel documentation system.

Table 2.

Annealing Temperature, Amplicon Size, and Primers Used for Detection of Different Genes by Polymerase Chain Reaction Assay

Gene	Primer sequence	Annealing temperature (°C)	Amplicon size (bp)	Reference
ctxA	CGGGCAGATTCTAGACCTCCTG CGATGATCTTGGAGCATTCCCAC	60	564	Keasler and Hall, 1993
toxR	TGTTCGGATTAGGACAC TACTCACACACTTTGATGGC	60	883	Rivera et al., 2001
tcpA (Eltor)	AAGAAGTTTGTAAAAGAAGAACAC GAAAGGACCTTCTTTCACGTTG	60	471	Keasler and Hall, 1993
tcpA (Classical)	CACGATAGGAAAACCGGTCAAGAG ACCAAATGCAACGCCGAATCGAG	60	617	Keasler and Hall, 1993
zot	TCGCTTAACGATGGCGCGTTTT AACCCCGTTTCACTTCTACCCA	60	243	Colombo et al., 1994
ace	GCTTATGATGGACACCCTTTA TTTGCCCTGCGAGCGTTAAAC	55	284	Colombo et al., 1994
rfb- O1	GTTTCACTGAACAGATGGG GGTCATCTGTAAGTACAAC	55	192	Keasler and Hall, 1993
rfb- O139	AGCCTCTTTATTACGGGTGG GTCAAACCCGATCGTAAAGG	55	449	Keasler and Hall, 1993

Detection of virulence and regulatory genes

V. cholerae O1, non-O1, non-O139 were screened for different virulence and regulatory genes such as ctx, zot, ace, and toxR genes. A list of primers and the PCR reaction conditions are given in Table 2. Standard PCR reaction conditions were employed, and amplified PCR products were run at 6 volts/cm for 120 min on 2% agarose gel containing 0.5 (g/mL of ethidium bromide. A positive control (V. cholerae, ATCC 14033) was always included in the PCR assay. Gel images were recorded using the Alpha Innotech Corporation (USA) gel documentation system.

Antibiotic susceptibility analysis

V. cholerae O1 (n=5), and non-O1, non-O139 (n=210), excluding the multiple strains from the same seafood sample, were analyzed for antimicrobial resistance properties using the disc diffusion method on Muller Hinton agar (Difco). V. cholerae strains were tested against all major antibiotics groups used in human and veterinary medicines such as sulphonamides, quinolones, β-lactams, cephalosporins, tetracyclines, aminoglycosides, and chloramphenicol. The standard antibiotic discs containing a group of 20 antibiotics (viz., ciprofloxacin [10 μg], imipenem [10 μg], tobramycin [10 μg], nalidixic acid [30 μg], moxifloxacin [5 μg], ofloxacin [5 μg], sparfloxacin [10 μg], levofloxacin [5 μg], norfloxacin [10 μg], co-trimoxazole [25 μg], colistin [10 μg], augmentin [30 μg], kanamycin [30 μg], gatifloxacin [5 μg], gentamicin [10 μg], amikacin [30 μg], streptomycin [10 μg], ceftriaxone [10 μg], cefpodoxime [10 μg], ticarcillin [75 μg] procured from HiMedia [Mumbai, India]) were used in susceptibility studies. The susceptibility assay was carried out with a slight modification in the method of Kirby-Bauer disk susceptibility test (CLSI, 2008). In brief, a 4–6-h culture of each test strain in tryptic soy broth (BD, USA) was spread onto Muller Hinton agar (BD, USA) plates with a sterile cotton swab and the inoculum was allowed to dry. After drying, the discs were added to the inoculated plates. The plates were incubated at 37°C for 24 h. Escherichia coli (ATCC 25922) was used as a control strain during the assay, and antimicrobial susceptibility test results were recorded based on the breakpoints for the interpretation of resistance and susceptibility as recommended in CLSI guidelines (2008) and the World Health Organization/Centers for Disease Control manual (WHO, 2003).

Results

Typical colonies of V. cholerae isolated on thiosulfate citrate bile salt sucrose agar were subjected to a set of morphological and biochemical assays: Gram strain, motility, oxidase production, growth in 0 and 3% NaCl, lysine and ornithine decarboxylase activity, and utilization of adonitol, arabinose, cellobiose, myo-inositol, lactose, salicin, arginine, dextrose, d-galactose, maltose, d-mannitol, d-mannose, sucrose and trehalose, indole production, and sensitivity to 0/129. Cultures which were Gram-negative, motile, oxidase-positive, could grow in 0% NaCl and in the presence of 3% NaCl, were lysine and ornithine decarboxylase positive, did not utilize adonitol, arabinose, cellobiose, myo-inositol, lactose, salicin, arginine, but utilized dextrose, d-galactose, maltose, d-mannitol, d-mannose, sucrose and trehalose and produced indole and were sensitive to 0/129 were identified presumptively as V. cholerae. A total of 382 V. cholerae strains were isolated and presumptively identified in the 265 seafood samples. Subsequently, serotyping of the biochemically confirmed V. cholerae isolates found five V. cholerae O1 Ogawa strains associated with fish and shrimp samples, and the remaining 377 V. cholerae strains were identified as non-O1, non-O139 (Table 3). PCR analysis confirmed the presence of Ogawa serotype in the five O1 strains and also determined that the tcpA variant gene associated with the El Tor biotype was present and that the Classical biotypic tcpA variant gene was not signifying that the five V. cholerae O1 strains were of the EL Tor biotype. Furthermore, non-O1, non-O139 strains were negative for the presence of the O1-rfb gene and all V. cholerae isolates were also negative for the O139-rfb gene. PCR amplification of different virulence and regulatory genes showed that the five V. cholerae O1 strains possessed ctx, zot, ace, and toxR genes. The non-O1, non-O139 were negative for ctx, zot genes; however, 9.8% and 91% of these strains possessed ace and the regulatory gene toxR, respectively (Table 4).

Table 3.

Detection of Vibrio cholerae in Seafood

Seafood	No. tested	V. cholerae O1 isolates	V. cholerae non-O1, non-O139 isolates
Fish	87	2	141
Shrimp	59	3	82
Crab	31	0	51
Clam	35	0	37
Mussel	29	0	41
Squid	24	0	25
	265	5	377

Table 4.

Presence of Genes (zot, ctx, ace, toxR, tcpA-Classical, tcpA-El Tor, rfb-O1, rfb -O139) in Vibrio cholerae O1, Non-O1, Non-O139 Isolates

	Detection of
	zot	Ctx	Ace	toxR	tcpA Classical	tcpA El Tor	rfb O1	rfb O139
V. cholerae O1 (n=5)	5/5	5/5	5/5	5/5	0/5	5/5	5/5	0/5
V. cholerae non-O1, non-O139 (n=377)	0/377	0/377	37/377	343/377	0/377	0/377	0/377	0/377

Antibiotic susceptibility analysis revealed that V. cholerae O1 strains were pansusceptible to 20 test antibiotics, whereas 26%, 40%, 62%, and 84% of the non-O1, non-O139 V. cholerae strains were resistant to cefpodoxime, ticarcillin, augmentin, and colistin, respectively. Multidrug resistance was detected against three drugs (augmentin, cefpodoxime, and colistin) in 26%, or (cefpodoxime, ticarcillin, augmentin) in 40%; four drugs (cefpodoxime, ticarcillin, augmentin, colistin) in 26%, five drugs (cefpodoxime, ticarcillin, augmentin, colistin, ceftriaxone) in 14%; and six drugs (cefpodoxime, ticarcillin, augmentin, colistin, ceftriaxone, moxifloxacin) in 12% of the non-O1, non-O139 V. cholerae strains (Table 5). Two percent of these strains also showed resistant to nalidixic acid, cotrimoxazole, and gatifloxacin. All non-O1, non-O139 strains were pansensitive toward tobramycin, ofloxacin, norfloxacin, gentamicin, amikacin, and streptomycin.

Table 5.

Antibiotics Resistance Pattern in Vibrio cholerae

Antibiotics	V. cholerae O1, % resistance (n=5)	V. cholerae non-O1, non-O139 isolates, % resistance (n=210)
Tobramycin (10 μg)	0	0
Ofloxacin (5 μg)	0	0
Norfloxacin (10 μg)	0	0
Gentamicin (10 μg)	0	0
Amikacin (30 μg)	0	0
Streptomycin (10 μg)	0	0
Nalidixic acid (30 μg)	0	2
Cotrimoxazole (25 μg)	0	2
Gatifloxacin (5 μg)	0	2
Sparfloxacin (10 μg)	0	4
Kanamycin (30 μg)	0	8
Ciprofloxacin (10 μg)	0	10
Imipenem (10 μg)	0	10
Levofloxacin (5 μg)	0	10
Moxifloxacin (5 μg)	0	12
Ceftriaxone (10 μg)	0	14
Colistin (10 μg)	0	26
Ticarcillin (75 μg)	0	40^a
Cefpodoxime (10 μg)	0	62
Augmentin (30 μg)	0	84

Intermediate showed as resistance.

Discussion

The present study demonstrated the occurrence of V. cholerae in tropical seafood harvested from the waters near Cochin (India), during 2009 through 2011. Detection of V. cholerae in seafood associated with fish species harvested in Indian coastal waters suggests that this seafood commodity should be considered a risk to consumers and supports other studies reported by Hill et al. (2011) and Senderovich et al. (2010), which demonstrate that fish should be considered a major reservoir and vector for V. cholerae.

Warm-water shrimp, an important seafood commodity from tropical countries, has been identified as a source of V. cholerae O1, and on many occasions it was found to be responsible for causing cholera outbreaks in other countries (FAO, 2005). Though in the present study the geographic area was only limited to the Cochin area, the fishing harbor handles more than 100 tons of seafood daily and its catch is distributed to multiple fish markets (approximately 75) in the surrounding region. The detection of choleragenic V. cholerae O1 Ogawa, El Tor strains in Cochin shrimp and fish samples is highly significant and concurs with the reports of other investigators for the Indian subcontinent. Otta et al. (1999) and Gopal et al. (2005) reported the presence of V. cholerae non-O1 and non-O1 serovars in tropical Indian seafood. However, Siddique et al. (2006) did report the presence of V. cholerae O1 in the seafood samples of other tropical Asian countries. In concurrence with these earlier studies, the present study revealed detection of mainly non-O1 and non-O139 along with a few O1 strains in seafood. A recent outbreak in South India due to V. cholerae O1 El Tor biotype suggests persistence of the biotype El Tor in south Indian aquatic environments (Goel et al., 2011). Similarly, it is thought that V. cholerae O1 El Tor strains originating from the Indian subcontinent may be responsible for the expanding cholera epidemic in Haiti, because such strains were nearly identical by molecular analyses (Chin et al., 2011). The presence of V. cholerae in seafood raised concern that cholera could be introduced to other countries through the commerce of contaminated seafood or through the discharge of ship ballast waters.

PCR amplification of different virulence genes highlighted the pattern of target genes in O1, non-O1, and non-O139 strains associated with seafood. Although the mechanism of pathogenesis in V. cholerae O1 and O139 is well understood, the localized cholera-like outbreaks due to non-O1, non-O139 serogroups pose a serious doubt regarding the possibilities of different pathogenicity mechanisms prevalent in non-O1 and non-O139 strains. There are reports on localized cholera-like disease due to non-O1 and non-O139 strains in tropical countries (Sharma, et al., 1998). Here we are reporting that 7% of non-O1, non-O139 strains possessed the ace gene, which is an important toxin-producing gene in V. cholerae O1. The presence of the toxR gene in 347 out of 377 non-O1 and non-O139 strains highlighted its involvement in pathogenicity due to the toxR gene. The present study clearly showed that all of the O1 strains possessed ctx, tcp, zot, and toxR genes, which are considered the virulence markers possessed by epidemic strains. On the contrary, the non-O1 and non-O139 V. cholerae strains did not possess the zot and ctx genes. Virulence-associated factors in V. cholerae are reported to be present in ctxAB, tcp, ace, zot, hly, and toxR genes (Sharma, et al., 1998; Rivera et al., 2001). Only O1 and O139 strains should have these genes in their armament to elicit watery diarrhea in humans. Data obtained in the present study indicates that there is no visible difference in the virulence gene profile of toxigenic V. cholerae O1 strains, though they were isolated from different seafood samples. Both toxigenic V. cholerae O1 strains and non-O1, non-O139 strains possess toxR, the central regulatory protein gene, and these strains are present in the seafood environment.

Antimicrobial resistance in V. cholerae is well documented, particularly in clinical isolates. In the present study, the V. cholerae O1 strains were completely pansensitive toward a group of clinical relevant antibiotics; nevertheless, the non-O1, non-O139 V. cholerae strains showed resistance toward 14 of these antibiotics. There are very few reports available on antibiotic resistance in V. cholerae that originated from environmental sources. Development of antibiotic resistance due to a 100-kb ICE (Integrated and Conjugative Element) was identified in V. cholerae O139 in India and Asia (Amita et al., 2003; Burrus et al., 2006). Prabhu et al. (2007) also showed that environmental isolates may exhibit more resistance to antibiotics than the clinical sources.

Conclusion

In conclusion, the present study demonstrates the prevalence and distribution of non-O1, non-O139 V. cholerae in tropical seafood along with isolation of a few V. cholerae O1 strains, thus necessitating the need for standardized seafood postharvesting monitoring and program. The presence of virulence and other regulatory genes highlighted the nature and level of pathogenicity in O1, non-O1, and non-O139 V. cholerae associated with seafood. Finally, the study emphasizes the need for a regular surveillance program, which will be a valuable tool for identifying suspected epidemic V. cholerae from the seafood environment and thus helps in controlling a seafood-borne cholera outbreak.

Footnotes

Acknowledgment

The authors are thankful to the Director, CIFT for his approval to publish this article.

Disclosure Statement

No competing financial interests exist.

References

Chowdhury R

Amita

, Thungapathra

, Ramamurthy

et al. Class 1 integrons and SXT elements in El Tor strains isolated before and after 1992 Vibrio cholerae O139 outbreak, Calcutta, India. Emerg Infect Dis, 2003; 9:500–502.

Brenner

, Farmer

III . Enterobacteriaceae. Bergey's Manual of Systematic Bacteriology, 2 ^nd. Brenner

, Kreig

, Staley

. New York: Springer, 2005; 587–878.

Burrus

, Marrero

, Waldor

. The current ICE age: 11. Biology and evolution of SXT-related integrating conjugative elements. Plasmid, 2006; 55:173–183.

Chin

C-S

, Sorenson

, Harris

et al. The origin of the Haitian cholera outbreak strain. N Engl J Med, 2011; 364:33–42.

[CLSI] Clinical and Laboratory Standard Institute. Performance Standards for antimicrobial susceptibility testing 18th Informational supplement: M100-S18, 28, 153. Wayne, PA: CLSI, 2008.

Colombo

, Mastrandrea

, Santona

et al. Distribution of the ace, zot, and ctxA toxin genes in the clinical and environmental Vibrio cholerae. J Infect Dis, 1994; 170:750–751.

Das

, Saha

, Kaur

. Trend of antibiotic resistance of Vibrio cholerae strains from East Delhi. Indian J Med Res, 2008; 127:478–482.

Elliot

, Kaysner

, Jackson

et al. Vibrio cholerae, V. parahaemolyticus, V. vulnificus, and other Vibrio spp. Bacteriological Analytical Manual U.S. Food and Drug Administration 8 ^thRevision AAOAC International: Gaithersburg, MD, 2001.

Faruque

, Albert

, Mekalanos

. Epidemiology, genetics and ecology of toxigenic Vibrio cholerae. Microbiol Mol Biol Rev, 1998; 62:1301–1314.

10.

[FAO] Food and Agriculture Organization of the United Nations. Risk assessment of choleragenic Vibrio cholerae O1 and O139 in warm water shrimp for international trade: Interpretative summary and technical report. Microbiological risk assessment series No. 9. FAO: Rome, Italy, 2005.

11.

Goel

, Jain

, Kumar

et al. Molecular characterization of reveals involvement of altered El Tor biotype Vibrio cholerae O1 strains in cholera outbreak at Hyderabad, India. J Microbiol, 2011; 49:280–284.

12.

Gopal

, Otta

, Kumar

et al. The occurrence of Vibrio species in tropical shrimp culture environments: Implications for food safety. Int J Food Microbiol, 2005; 102:151–159.

13.

Hill

, Cohen

, Kahler

et al. Toxigenic Vibrio cholerae O1 in water and seafood, Haiti. Emerg Infect Dis, 2011; 17:2147–2150.

14.

Huss

, Ababouch

, Gram

. Assessment and Management of Seafood Safety and Quality, FAO Fisheries Technical Paper 444. Rome: Food and Agriculture Organization of the United Nations, 2003.

15.

Keasler

, Hall

. Detecting and biotyping V. cholerae O1 with multiplex polymerase chain reaction. Lancet, 1993; 341:1661.

16.

Mandal

, Dinoop

, Parija

. Increasing antimicrobial resistance of Vibrio cholerae O1 biotype El Tor strains isolated in a tertiary-care centre in India. J Health Popul Nutr, 2012; 30:12–16.

17.

Otta

, Karunasagar

. Bacterial flora associated with shrimp culture ponds growing Penaeus monodon in India. J Aquacul Trop, 1999; 14:309–318.

18.

Prabhu

, Pandian

, Vasan

. Pathogenicity, antibiotics susceptibility, and genetic similarity of environmental and clinical isolates of Vibrio cholerae. Indian J Exp Biol, 2007; 45:817–823.

19.

Rivera

ING

, Chun

, Huq

et al. Genotypes associated with virulence in environmental isolates of Vibrio cholerae. Appl Environ Microbiol, 2001; 67:2421–2429.

20.

Senderovich

, Izhaki

, Halpern

. 2010. Fish as reservoir and vectors of Vibrio cholerae. PLoS One, 2010; 5:8607.

21.

Sharma

, Thungapathra

, Ghosh

et al. Molecular analysis of non-O1, non-O139 Vibrio cholerae associated with an unusual upsurge in the incidence of cholera-like disease in Calcutta, India. J Clin Microbiol, 1998; 36:756–763.

22.

Shiraishi

, Takeda

, Taga

et al. Isolation of Vibrio cholerae in imported frozen seafood and their cholera-enterotoxin production. Kansenshogaku Zasshi, 1996; 70:175–179.

23.

Siddique

, Zaman

, Mazumder

. Simultaneous outbreaks of contrasting drug-resistant classic and El Tor Vibrio cholerae O1 in Bangladesh. Lancet, 1989; 1:396.

24.

Siddique

, Bhutto

, Von Seidlein

et al. Consecutive outbreaks of Vibrio cholerae O139 and Vibrio cholerae O1 cholera in a fishing village near Karachi, Pakistan. Trans R Soc Trop Med Hyg, 2006; 100:476–482.

25.

Suzita

, Abdulamir

, Baker

et al. A mini review: Outbreak via shellfish. Am J Infect Dis, 2009; 5:40–47.

26.

[WHO] World Health Organization. Data and Statistics, Infectious Diseases, Cholera, Data. 2011. http://www.who.int/research/en/. 2011 December 25.

27.

WHO. Manual for the Laboratory Identification and Antimicrobial Susceptibility Testing of Bacterial Pathogens of Public Health Importance in the Developing World. 2003WHO/CDS/CSR/EPH/2002.15.