Role of Capsular Polysaccharides and Lipooligosaccharides in Campylobacter Surface Properties,Autoagglutination,and Attachment to Abiotic Surfaces

Abstract

The role of capsular polysaccharides and lipooligosaccharides in cell surface hydrophobicity, surface charge, autoagglutination (AAG), and attachment to abiotic surfaces of three strains of Campylobacter jejuni and one strain of C. coli were investigated. This was achieved by removal of capsular polysaccharides and truncation of lipooligosaccharides core oligosaccharides by inactivation of the kpsE and waaF genes, respectively. The mutants and the wild-type strains were compared after growth under planktonic (broth) and sessile (agar) conditions. Cells grown as planktonic cultures showed a significantly (p<0.05) higher degree of hydrophobicity and AAG activity but differed from their sessile counterparts with respect to surface charge and attachment counts, depending on the strain. These results suggest that prior mode of growth affects the surface properties and attachment of Campylobacter in a strain-dependent manner. There were no significant (p>0.05) differences between the three C. jejuni strains and their ΔkpsE and ΔwaaF mutants with respect to all traits tested. Inactivation of the kpsE gene significantly (p<0.05) reduced the surface charge of the C. coli strain from ∼-10 to ∼-6 mV and increased its AAG activity, while disruption of the waaF gene significantly (p<0.05) increased its surface hydrophobicity by >8° and decreased the numbers of cells attaching to stainless steel and glass by ∼0.5 log/cm². These results suggest that surface polysaccharides may influence the surface properties and attachment to abiotic surfaces of C. coli but not C. jejuni. This suggestion, however, requires further investigation using a larger number of strains of both species.

Introduction

C ampylobacter jejuni and C. coli are important foodborne bacterial pathogens causing diseases in humans worldwide (Kirkpatrick and Tribble, 2011). The ability of C. jejuni and C. coli to adhere to surfaces plays an important role in their transmission through food-processing systems, leading to infections (Nguyen et al., 2012). Cell-surface hydrophobicity (Moser and Schroder, 1997), surface charge (Walan and Kihlstrom, 1988), and autoagglutination (AAG) (Guerry et al., 2006) are associated with the ability of Campylobacter to attach to various biotic surfaces such as fibronectin and cell lines INT 407 and HT-29.

Capsular polysaccharides (CPS) and lipooligosaccharides (LOS) are found to have an impact on cell surface hydrophobicity, AAG, and attachment of many Campylobacter strains to cell lines. For example, inactivation of CPS expression by mutation of the CPS transport genes kpsM, kpsS, and kpsE resulted in an increased surface hydrophobicity and reduced ability of C. jejuni strains 81–176 and 11168 to attach to epithelial cells INT 407 (Bacon et al., 2001; Bachtiar et al., 2007; Jeon et al., 2009). Truncation of LOS core oligosaccharides of these strains by inactivation of the heptosyltransferase II gene waaF also resulted in a similar effect (Jeon et al., 2009; Kanipes et al., 2004). In addition, removal of CPS and sialic acid from LOS by inactivation of the genes kpsM and neuC, respectively, reduced AAG activity of C. jejuni 81–176 (Guerry et al., 2006). However, the role of CPS and LOS in attachment of C. jejuni and C. coli to abiotic surfaces has not been investigated.

We have recently reported that attachment of different Campylobacter strains to abiotic surfaces, such as stainless steel and glass, is associated with increased cell surface hydrophobicity (Nguyen et al., 2010; Nguyen et al., 2011). The highly hydrophobic and adherent strains also attached strongly to the agar surface when they were grown on modified charcoal cephoperazone deoxycholate agar–Preston plates (Nguyen et al., 2011). Since surface polysaccharides including CPS and LOS are associated with cell surface hydrophobicity (van Oss, 1995) and the adherent nature of Campylobacter (Guerry and Szymanski, 2008), we undertook the present study to investigate whether CPS and LOS have a role in affecting Campylobacter surface hydrophobicity, surface charge, AAG, and mediating attachment to two abiotic surfaces, namely, stainless steel and glass. This was achieved by inactivation of CPS expression and truncation of LOS core oligosaccharides by disruption of the kpsE and waaF genes, respectively, in four highly hydrophobic and adherent Campylobacter strains (three C. jejuni strains and one C. coli strain).

Materials and Methods

Bacterial strains and culture conditions

The bacterial strains and plasmids used in this study are listed in Table 1. For all assays, Campylobacter strains were grown as planktonic cultures in Nutrient Broth No. 2 (NB2, Oxoid) (without shaking) or as sessile cultures on NB2 supplemented with 1.2% (wt/wt) technical agar (Agar No. 3, Oxoid) at 42°C for 48 h under capnophilic conditions (5% CO₂). Cells were harvested by centrifugation (13,131×g, 10 min), washed once with 150 mM phosphate buffered saline (PBS, 8.5 g/L NaCl, 0.2 g/L KCl, 1.44 g/L Na₂HPO₄, 0.24 g/L KH₂PO₄, pH 7.4) and then resuspended in the same buffer unless otherwise stated. Escherichia coli strains were grown in Luria-Bertani (Sigma, St. Louis, MO) broth with shaking (150 rpm) or on Luria-Bertani agar at 37°C for cloning experiments. Media were supplemented with ampicillin (100 μg/mL) or kanamycin (50 μg/mL) where appropriate.

Table 1.

Bacterial Strains and Plasmids Used in This Study

Bacterial strains and plasmids	Description	Resistance	Source
Campylobacter strains
C516a	C. jejuni HS: 4^a		(Nguyen et al., 2011)
81116	C. jejuni NCTC 11828, HS: 6		(Manning et al., 2001)
C977a	C. jejuni, HS: 57		(Nguyen et al., 2011)
C719a	C. coli HS: 1/44		(Nguyen et al., 2011)
C516a ΔkpsE	Isogenic ΔkpsE mutant of C516a	Kan	This study
81116 ΔkpsE	Isogenic ΔkpsE mutant of 81116	Kan	This study
C977a ΔkpsE	Isogenic ΔkpsE mutant of C977a	Kan	This study
C719a ΔkpsE	Isogenic ΔkpsE mutant of C719a	Kan	This study
C516a ΔwaaF	Isogenic ΔwaaF mutant of C516a	Kan	This study
81116 ΔwaaF	Isogenic ΔwaaF mutant of 81116	Kan	This study
C977a ΔwaaF	Isogenic ΔwaaF mutant of C977a	Kan	This study
C719a ΔwaaF	Isogenic ΔwaaF mutant of C719a	Kan	This study
Escherichia coli strains
JM109	Wild-type strain		Promega
DH5α	Wild-type strain		(Hanahan, 1983)
Plasmids
pMW2	Vector with C. jejuni kanamycin resistance cassette (Km^R)	Kan	(Bachtiar et al., 2007)
pGEM^®-T Easy	Cloning vector	Amp	Promega
pGEM-T::kpsE	pGEM^®-T Easy carrying a 614-bp fragment containing 214 bp of the 3′ end of the kpsT gene and 400 bp of the 5′ end of the kpsE gene of C. jejuni NCTC 11828, and a 348-bp fragment containing 251 bp of the 3′ end of the kpsE gene and 97 bp of the 5′ end of the kspD gene of the C. jejuni NCTC 11828.	Amp	study
pGEM-T::kpsE::Km^R	pGEM-T::kpsE containing a Km^R cassette inserted between the 614-bp and 348-bp fragments	Amp Kan	This study
pGEM-T::waaF1	pGEM^®-T Easy carrying a 742-bp fragment containing 470 bp of the 3′ end of the waaV gene and 272 bp of the 5′ end of the waaF gene of C. jejuni NCTC 11828, and a 697-bp fragment containing 243 bp of the 3′ end of the waaF gene and 454 bp of the 5′ end of the gmhA gene of C. jejuni NCTC 11828	Amp	This study
pGEM-T::waaF1::Km^R	pGEM-T::waaF1 containing a Km^R cassette inserted between the 742-bp and 697-bp fragments	Amp Kan	This study
pGEM-T::waaF2	pGEM^®-T Easy carrying a 742-bp fragment containing 470 bp of the 3′ end of the waaV gene and 272 bp of the 5′ end of waaF gene of C. coli C719a, and a 742-bp fragment containing 451 bp of the 3′ end of the waaF gene and 291 bp of the 5′ end of the waaF-flanking sequence of C. coli C719a
pGEM-T::waaF2::Km^R	pGEM-T::waaF2 containing a Km^R cassette inserted between the 742-bp upstream and 742-bp downstream fragments	Amp Kan	This study

Penner serotyping based on soluble heat-stable (HS) antigens.

Kan, kanamycin; Amp, ampicillin.

Construction of ΔkpsE and ΔwaaF mutants

Construction of ΔkpsE mutants was performed as previously described (Bachtiar et al., 2007). A suicide plasmid pGEM-T::kpsE::Km^R was constructed by cloning a 614-bp upstream DNA fragment (including 400 bp of the 5′ end of the kpsE gene and 214 bp of the 3′ end of the flanking kpsT gene), the kanamycin cassette (from the pMW2 vector), and a 348-bp downstream fragment (containing 251 bp of the 3′ end of the kpsE gene and 97 bp of the 5′ end of the flanking kpsD gene) into pGEM-T Easy vector (Promega) (Table 2). The suicide plasmid was subsequently introduced to Campylobacter cells by electroporation as previously described (van Vliet et al., 1998) to replace a 462-bp segment of the kpsE gene by a 1448-bp kanamycin resistance gene.

Table 2.

Primers Used in Mutagenesis Experiments

Primers ^a	Nucleotide sequence (5′ to 3′) ^b
kpsT_F	TGATGAATTCGGAGCTGTTGGAGATCCT
kpsE_R	GGTTGGATCCGTATGAACCTTAACTCTTGC
kpsE_F	TTCAGGATCCAACTATAGAAGCTACT
kpsD_R	TAGCTCTAGATTGATCCTCTGCTGAA
waaV_F	CAAACCGACCAGCAAAAATG
waaF_R	GTTGGATCCGTAAAGATAGGGCTTGTT
waaF_F1	AGTGGATCCATGCACCTAAGTGCGGTT
gmhA_R	GGTGAGCTTTTGTGTGAGTG
waaF_F2	ATGGGATCCGAGTTATTTTGC
waaFflank_R	CTGCAAGTAAGTGCTGCAATG

The genome of Campylobacter jejuni NCTC 11828 (Pearson et al., 2007) was used to design all of the primers except for waaF_F2 and waaF flank_R, which were designed using the genome of C. jejuni ICDCCJ07001 (Zhang et al., 2010),

Restriction sites are underlined.

Truncation of LOS core oligosaccharides of C. jejuni strains was achieved by inactivation of the heptosyltransferase II gene (waaF) using a similar protocol to that described above for mutation of the kpsE gene.

Detection of CPS and LOS by Alcian Blue staining

The differences between CPS and LOS expression by the wild-type strains and the ΔkpsE and ΔwaaF mutants were determined by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) followed by Alcian Blue staining as described previously (Karlyshev and Wren, 2001). Briefly, bacterial cells from 48-h planktonic and sessile cultures were resuspended in lysis buffer (31.25 mM Tris-HCl [pH 6.8], 4% SDS, 20% glycerol, and 0.025% bromophenol blue). Samples were heated at 100°C for 5 min and centrifuged at 13, 131×g for 5 min. Aliquots of 20 μL of the supernatant were taken and mixed with 1 μL of proteinase K (20 mg/mL, Sigma, St. Louis, MO). The samples were incubated at 50°C for 1 h and fractionated on precast SDS-PAGE (Bio-Rad, Criterion, 4–20%% Tris-HCl, Cat. No. 3450033) followed by staining with 0.1% Alcian Blue (Sigma) in 40% ethanol and 5% acetic acid.

Cell surface hydrophobicity

Cell surface hydrophobicity of Campylobacter was determined using water contact angle measurement as described by Busscher et al. (2008) using a goniometer (KSV Instruments, Ltd., Helsinki, Finland). Planktonic and sessile cells grown as described above were resuspended in ultrapure (type I) Milli-Q water and filtered through a 0.45-μm-pore membrane filter (mixed cellulose ester HA filter, 25 mm diameter) (Millipore, Billerica, MA). The bacterial cell-filters were attached to glass using double-sided adhesive tape and dried in a desiccator containing drierite (CaSO₄, W. A. Hammond Drierite Company Ltd., Xenia, OH) for 30 min. A drop of Milli-Q water was placed onto the filter, and the contact angle was determined by measuring the angle between the filter surface and the tangent to the drop at the solid–liquid air point.

Cell surface charge

Cell surface charge of Campylobacter was determined using zeta potential measurement as previously described (Li and McLandsborough, 1999). A volume of 1 mL of cell suspension (10⁷ colony-forming units/mL in PBS) was used to measure zeta potential using a Zetasizer Nano (Malvern Instruments Ltd., Worcestershire, UK).

AAG activity

AAG activity was determined using an assay described by Misawa and Blaser (2000). Planktonic and sessile cells were resuspended in 150 mM PBS (pH 7.4) to an OD₆₀₀ 1.0. Two milliliters of cell suspension was transferred to 12×75-mm polypropylene tubes, and incubated at 25°C for 0.33, 2, 4, 6, and 24 h. After each incubation time, 1 mL of the upper phase was carefully removed and the OD₆₀₀ was measured. The reduction of the OD₆₀₀ in the upper phase from the initial setting of 1.0 reflects the degree of AAG activity.

Bacterial attachment to abiotic surfaces

The ability of Campylobacter to attach to abiotic surfaces was determined based on the numbers of cells attaching to stainless steel (type 304, #4 finish, 50×20×0.9-mm thickness) (Hanly Sheet Metal, Murrarie, Queensland, Australia) and glass (76×25×1-mm thickness) (Sail Brand, China) as previously described (Nguyen et al., 2011).

Attachment assays were performed by placing the clean sterile surfaces in the vertical position in 40 mL of cell suspensions (10⁷ colony-forming units/mL) in PBS contained in 50-mL centrifugation tubes (Sarstedt, Nümbrecht, Germany) at 25°C for 20 min. After attachment, the coupons were removed using sterile forceps and rinsed twice by gently dipping into 40 mL PBS to remove excess liquid droplets and loosely attached cells. The coupons were subsequently stained for 20 min in the dark using 0.01% (wt/vol) acridine orange stain, followed by gently dipping the coupons in 40 mL of Milli-Q water. The attached cells were quantified using epifluorescence microscopy (Leica DM 6000B, Leica Microsystems CMS GmbH, Wetzlar, Germany). A total of 50 fields per coupon were scanned and the fluorescent cells were enumerated. Counts were calculated as log cell/cm². The level of detection is 2.05 log cell/cm², which is obtained when the total number of attached cells in 50 microscopic fields is one.

Statistical analysis

All experiments were performed in triplicate. All quantitative data, unless otherwise stated, are presented as means with error represented by standard deviation. Significant differences between all data sets were determined by means of one-way analysis of variance (Tukey's method) using Minitab software (Minitab 15; Minitab Inc., Minneapolis, MN).

Results

Construction of ΔkpsE mutants and ΔwaaF mutants

Mutants (ΔkpsE) of all four Campylobacter strains (C516a, 81116, C977a, and C719a) were successfully generated. As a consequence of insertion of the kanamycin cassette in the kpsE coding region, the ΔkpsE mutants generate a 2.4-kbp polymerase chain reaction (PCR) product using primers kpsT_F and kpsD_R as opposed to a 1.4-kbp PCR products generated by the wild-type strains (Fig. 1A).

FIG. 1.

Polymerase chain reaction (PCR) verification of the insertion of the kanamycin cassette in the ΔkpsE and ΔwaaF mutants. The ΔkpsE mutants showed 2.4-kbp PCR products using primers kpsT_F and kpsD_R as opposed to 1.4-kbp PCR products shown by the wild-type (WT) strains (A). The ΔwaaF mutants showed 2.9-kbp PCR products using primers waaF_F and gmhA_R (for Campylobacter jejuni) or primers waaF_F and waaFflank_R (for C. coli) as opposed to 1.9-kbp PCR products shown by the wild-type (WT) strains (B). The first and last lanes are DNA markers. The second last lane is a negative control. The remaining lanes are wild-type and deletion mutant PCR products of the Campylobacter strains and labeled by strain number.

Mutants (ΔwaaF) of the two C. jejuni strains (C516a and 81116) and the C. coli strain (C719a) were also successfully generated using a homologous double crossover event between the plasmids pGEM-T::waaF1::Km^R (for C. jejuni) and pGEM-T::waaF2::Km^R (for C. coli). As a consequence of homologous DNA recombination, a 503-bp fragment of the waaF gene in the two C. jejuni strains and a 286-bp fragment of the waaF gene in the C. coli strain were deleted and replaced by a 1448-bp kanamycin resistance gene. As a consequence of insertion of the kanamycin cassette in the waaF coding region, the ΔwaaF mutants showed a 2.9-kbp PCR product using primers waaF_F and gmhA_R (for C. jejuni) and primers waaF_F and waaFflank_R (for C. coli) as opposed to a 1.9-kbp PCR products shown by the wild-type strains (Fig. 1B). Several attempts to generate a ΔwaaF mutant for C. jejuni C977a were unsuccessful because no pGEM-T::waaF1::Km^R transformants could be isolated.

Inactivation of the kpsE and waaF genes results in loss of CPS and truncation of LOS core oligosaccharides

CPS and LOS expression by the wild-type strains, ΔkpsE and ΔwaaF mutants grown as sessile cultures, was assessed by SDS-PAGE followed by Alcian Blue staining (Fig. 2). Using this technique, the CPS of all the wild-type strains appeared as high-molecular-weight smears (for example, the smear running above 35 kDa [for C977a] and above 25 kDa [for C719a]). The LOS appeared as low-molecular-weight (below 10 kDa) smears. The bands above 10 kDa may be aggregates of LOS due to overloading of the gel, but may alternatively be CPS molecules, which also run between 10 and 35 kDa. As shown in Fig. 2, the mutation of the waaF gene had an effect on all three of the strains (C516a, 81116, and C719a) as indicted by the disappearance of the bands above 10 kDa. However, it is difficult to discern what effect the kpsE mutation had on all of the strains. This is because mutation of the kpsE gene had no observable effect on the CPS and LOS profiles of the C516a and 81116 strains and minimal effect on the C977a and C719a strains. These features are shown as smears disappearing above the 35-kDa region and around the 35-kDa region, respectively. When grown in planktonic cultures, cells of all strains showed comparable CPS and LOS profiles as the sessile cells (data not shown).

FIG. 2.

Effects of the insertional mutation in the kpsE and waaF genes on the expression of capsular polysaccharides (CPS) and lipooligosaccharides (LOS) by Campylobacter. The CPS and LOS were fractionated on sodium dodecylsulfate–polyacrylamide gel electrophoresis and visualized using Alcian blue staining. The first and last lanes are protein markers. The second last lane is a negative control. The remaining lanes are wild-type and deletion mutant CPS and LOS fractions of the Campylobacter strains and labeled by strain number.

Inactivation of the kpsE and waaF genes affect the cell surface properties, AAG, and attachment to abiotic surfaces for the C. coli strain but not C. jejuni strains

In order to determine the role of CPS and LOS on cell surface properties, AAG, and attachment of Campylobacter to abiotic surfaces, water contact angle, zeta potential values, AAG activity, and counts of attached cells to stainless steel and glass of the wild-type strains, ΔkpsE and ΔwaaF mutants were compared. As shown in Table 3 and Fig. 3, there were no significant (p>0.05) differences in all traits tested between the wild-type, ΔkpsE, ΔwaaF mutants of three C. jejuni strains grown in either planktonic or sessile culture, indicating that inactivating the kpsE and waaF genes did not affect surface hydrophobicity, surface charge, and attachment of C. jejuni to abiotic surfaces. Inactivating the kpsE gene also did not affect surface hydrophobicity and attachment of the C. coli strain but reduced the negative charge on the cell surface (from ∼-10 mV to ∼-6 mV) and increased AAG activity (from OD₆₀₀ of ∼0.924 to ∼0.204). In contrast, inactivating the waaF genes did not affect cell surface charge and AAG of the C. coli strain but increased its surface hydrophobicity by >8° and reduced its ability to attach to abiotic surfaces by ∼0.5 log/cm².

FIG. 3.

Autoagglutination activity of the wild type (▪), ΔkpsE (•) and ΔwaaF (▴) mutants grown as planktonic (solid lines) and sessile (broken lines) cultures for Campylobacter jejuni C516a (A), C. jejuni 81116 (B), C. jejuni C977a (C), and C. coli C719a (D). Cells were resuspended in 150 mM phosphate-buffered saline (pH 7.4) to an OD₆₀₀ of 1.0 and incubated at 25°C without shaking for 0.33, 2, 4, 6, and 24 h. After each time interval, the OD₆₀₀ of the top 1 mL was measured. The lower the OD₆₀₀ values, the stronger the autoagglutination activity.

Table 3.

Cell Surface Hydrophobicity, Surface Charge and Attachment to Abiotic Surfaces of Campylobacter Strains and Their ΔkpsE and ΔwaaF Mutants

	wCAM (°) ^a		ZP (mV) ^b		Attachment to stainless steel (log cell/cm²) ^c		Attachment to glass (log cell/cm²)^c
Strains	Planktonic	Sessile	Planktonic	Sessile	Planktonic	Sessile	Planktonic	Sessile
C. jejuni C516a
Wild-type	53.0±2.3^D,E	35.4±0.7^B	−13.5±1.9^C,D	−5.2±0.6^A,	4.55±0.23^A,B	4.99±0.06^C	4.29±0.08^A	4.56±0.25^A,B
ΔkpsE	60.0±4.0^E	33.9±4.4^A,B	−10.9±1.8^C,D	−6.4±1.0^A,B	4.65±0.13^B	5.00±0.12^C	4.45±0.12^A	4.84±0.07^B,C
ΔwaaF	56.2±6.2^D,E	35.2±2.5^b	−14.0±2.7^D	−6.2±1.3^A,B	4.89±0.19^B,C	5.06±0.11^C	4.58±0.21^A,B	4.91±0.15^B,C
C. jejuni 81116
Wild-type	53.8±5.6^D,E	34.8±1.5^B	−6.2±1.8^A,B	−8.1±2.4^A,B,C	4.97±0.11^C	4.84±0.04^B,C	4.80±0.19^B,C	4.82±0.14^B,C
ΔkpsE	57.9±8.0^D,E	39.1±4.1^B	−4.9±1.2^A	−11.9±1.9^C,D	5.01±0.17^C	5.02±0.17^C	4.95±0.16^B,C	5.02±0.13^C,D
ΔwaaF	64.3±6.9^D,E	33.6±0.9^B	−8.0±0.9^B	−8.1±0.9^B	4.96±0.11^C	4.9±0.08^C	4.87±0.21^B,C	4.93±0.12^B,C
C. jejuni C977a
Wild-type	52.9±3.3^D,E	45.6±1.6^C	−11.2±1.1^C,D	−10.6±0.6^C,D	5.26±0.18^C,D	4.89±0.13^B,C	4.91±0.19^B,C	4.62±0.21^A,B
ΔkpsE	54.5±6.6^D,E	40.1±5.0^B,C	−9.6±1.2^B,C	−9.8±0.3^B.C	5.03±0.11^C	4.81±0.17^B,C	5.04±0.08^C,D	4.74±0.12^B
C. coli C719a
Wild-type	46.9±2.4^C,D	30.5±0.5^A	−10.2±0.9^B,C	−9.8±0.9^B,C	5.45±0.08^D	4.87±0.18^B,C	5.27±0.13^D	4.92±0.19^B
ΔkpsE	52.2±4.9^D,E	31.7±3.9^A,B	−6.1±0.9^A,B	−6.6±0.4^A,B	5.27±0.13^C,D	4.69±0.11^B	5.53±0.06^E	4.98±0.14^B
ΔwaaF	74.1±2.3^F	38.6±3.1^B	−12.4±1.7^C,D	−12.1±1.8^C,D	4.71±0.05^B	4.38±0.02^A	4.82±0.03^B	4.38±0.09^A

Data labeled with the same letter are not significantly different (p>0.05). The comparison included the entire set of strains and both planktonic and sessile modes of growth.

Cell surface hydrophobicity determined using water contact angle measurement (wCAM). Cells were grown as planktonic culture using Nutrient Broth No. 2 (NB2) and sessile culture (NB2+agar) and resuspended in MiliQ water.

Cell surface charge determined using zeta potential (ZP) measurement. Cells were grown as planktonic culture using Nutrient Broth No. 2 (NB2) and sessile culture (NB2+agar) and resuspended in 150 mM phosphate-buffered saline (PBS) (pH 7.4).

Bacterial attachment to abiotic surfaces determined based on the number of cells attaching to stainless steel and glass. Cells were grown as planktonic culture using Nutrient Broth No. 2 (NB2) and sessile culture (NB2+agar) and resuspended in 150 mM PBS (pH 7.4). Counts of attached cells were determined using epifluorescence microscopy after 20 min attachment at 25°C.

Planktonic or sessile mode of growth affects the cell surface properties and attachment to abiotic surfaces of both C. jejuni and C. coli

For all the strains tested, cells had a significantly (p<0.05) higher water contact angle when grown as planktonic cultures than as sessile cultures, indicating that planktonic cells are more hydrophobic than their sessile counterparts using this measure. With the exception of the ΔkpsE mutants of the strains C719a and C977a, planktonic cells of all the other strains also showed significantly (p<0.05) stronger AAG activity than sessile cells after 4-h incubation. However, planktonic cells had variable surface negative charge and attachment counts to stainless steel and glass as compared to sessile cells depending on the strain (Table 3).

Discussion

The role of surface polysaccharides in affecting Campylobacter cell surface hydrophobicity, surface charge, AAG, and mediating attachment to abiotic surfaces was investigated in the present study. Campylobacter cells possess four different surface polysaccharides, namely, CPS, LOS, and O-linked and N-linked glycans (Guerry and Szymanski, 2008). To determine the contribution of CPS, the kpsE gene was inactivated. The kpsE gene is involved in the transport of the CPS polymers to the bacterial cell surface and consequently mutation of the kpsE gene results in nonencapsulated mutants (Bachtiar et al., 2007). Four ΔkspE mutants have been successfully generated in three C. jejuni strains and one C. coli strain.

Our study showed that CPS might have only a minor contribution to cell surface properties, AAG, and attachment to abiotic surfaces of the three C. jejuni strains. However, since the wild-type of two C. jejuni strains do not express CPS, it is not possible to observe the effect of CPS on the functional assays related to cell surface hydrophobicity, AAG, or attachment to abiotic surfaces of C. jejuni. This claim, therefore, needs to be validated using other strains that are able to express CPS or by changing culture conditions stimulating CPS expression by our strains. The role of CPS in affecting cell surface properties and AAG may vary depending on individual strains, since our results did not agree with that of previous studies, which reported that loss of CPS increases the surface hydrophobicity of C. jejuni 11168 (Jeon et al., 2009) but decreases AAG activity of the strain C. jejuni 81–176 (Guerry et al., 2006). The differences in surface properties between wild-type strains and isogenic mutants may be attributable to procedural differences between studies. Future work on additional strains, such as C. jejuni 81–176 and C. jejuni 11168, and using the assays as described in the previous studies may help rule out this possibility. CPS may also have little role in cell surface hydrophobicity and attachment to abiotic surfaces of the C. coli strain, but it is required to maintain the surface charge on the cell surface and is strongly involved in AAG of the strain.

Our study also showed that LOS core has little role in affecting cell surface properties, AAG, and attachment to abiotic surfaces of C. jejuni. However, LOS, unlike CPS, may not be required to maintain the surface charge and AAG of the C. coli strain but may affect cell surface hydrophobicity and attachment to abiotic surfaces of this strain. Increased cell surface hydrophobicity is known to enhance bacterial attachment to surfaces by increasing hydrophobic interactions (Bos et al., 1999; Nguyen et al., 2011). However, this is not the case in the present study since truncation of LOS core oligosaccharides rendered the C. coli strain more hydrophobic but reduced its attachment number to these surfaces. Our results support the claim that explaining bacterial attachment to inert surfaces based on nonspecific interactions such as hydrophobic and electrostatic interactions is not always successful (Parkar et al., 2001; Roosjen et al., 2006). The reduced ability of the more hydrophobic waaF mutant of the C. coli strain to attach to abiotic surfaces may be due to a reduction of specific interactions between LOS and abiotic surfaces upon truncation of LOS.

In addition to the abovementioned findings, our study also demonstrated that planktonic or sessile mode of growth may affect cell surface properties and their subsequent ability to attach to abiotic surfaces. While it is not clear which mode enhanced their surface charge and attachment to abiotic surfaces since this varied between strains, planktonic cultures displayed increased cell surface hydrophobicity and AAG activity as compared to sessile cultures. It has been shown that relative to planktonic cells, sessile cells also exhibited a repression of genes involved in motility and flagellar expression (Sampathkumar et al., 2006). Since Campylobacter hydrophobicity and AAG are strongly associated with flagellar expression (Misawa and Blaser, 2000), it is possible that sessile cells of our Campylobacter strains demonstrate a repression in flagellar expression, which subsequently renders them less hydrophobic and prone to agglutination than planktonic cells.

In conclusion, this work demonstrated that CPS and LOS have an impact on the cell surface properties, AAG, and attachment to abiotic surfaces for C. coli but not for C. jejuni. Since only a limited number of strains were studied in the present study, this claim requires further investigation using a larger number of strains of both C. jejuni and C. coli. It has been shown that hydrophobicity and AAG of C. jejuni 11168 and 81–176 are strongly associated with flagellar expression and, more specifically, O-linked flagellin glycosylation (Misawa and Blaser, 2000; Guerry et al., 2006). Further investigations on the effects of flagellin glycosylation on hydrophobicity and AAG of the C. jejuni strains in the present study are also required. This could be achieved by inactivating the pse genes, which are required for biosynthesis and/or transfer of pseudaminic acid (PseAc) and PseAm (an acetamidino form of PseAc) to flagellin, and comparing these mutants to wild-type strains with normally glycosylated flagella.

Disclosure Statement

No competing financial interests exist.

References

Bachtiar

, Coloe

, Fry

. Knockout mutagenesis of the kpsE gene of Campylobacter jejuni 81116 and its involvement in bacterium–host interactions. FEMS Immunol Med Microbiol, 2007; 49:149–154.

Bacon

, Szymanski

, Burr

, Silver

, Alm

, Guerry

. A phase-variable capsule is involved in virulence of Campylobacter jejuni 81–176. Mol Microbiol, 2001; 40:769–777.

Bos

, van der Mei

, Busscher

. Physico-chemistry of initial microbial adhesive interactions: Its mechanisms and methods for study. FEMS Microbiol Rev, 1999; 23:179–230.

Busscher

, Norde

, Van der Mei

. Specific molecular recognition and nonspecific contributions to bacterial interaction forces. Appl Environ Microbiol, 2008; 74:2559–2564.

Guerry

, Ewing

, Schirm

, Lorenzo

, Kelly

, Pattarini

, Majam

, Thibault

, Logan

. Changes in flagellin glycosylation affect Campylobacter autoagglutination and virulence. Mol Microbiol, 2006; 60:299–311.

Guerry

, Szymanski

. Campylobacter sugars sticking out. Trends Microbiol, 2008; 16:428–435.

Hanahan

. Studies on transformation of Escherichia coli with plasmids. J Mol Biol, 1983; 166:557–580.

Jeon

, Muraoka

, Scupham

, Zhang

. Roles of lipooligosaccharide and capsular polysaccharide in antimicrobial resistance and natural transformation of Campylobacter jejuni. J Antimicrob Chemother, 2009; 63:462–468.

Kanipes

, Holder

, Corcoran

, Moran

, Guerry

. A deep-rough mutant of Campylobacter jejuni 81–176 is noninvasive for intestinal epithelial cells. Infect Immun, 2004; 72:2452–2455.

10.

Karlyshev

, Wren

. Detection and initial characterization of novel capsular polysaccharide among diverse Campylobacter jejuni strains using Alcian blue dye. J Clin Microbiol, 2001; 39:279–284.

11.

Kirkpatrick

, Tribble

. Update on human Campylobacter jejuni infections. Curr Opin Gastroenterol, 2011; 27:1–7.

12.

, McLandsborough

. The effects of the surface charge and hydrophobicity of Escherichia coli on its adhesion to beef muscle. Int J Food Microbiol, 1999; 53:185–193.

13.

Manning

, Duim

, Wassenaar

, Wagenaar

, Ridley

, Newell

. Evidence for a genetically stable strain of Campylobacter jejuni. Appl Environ Microbiol, 2001; 67:1185–1189.

14.

Misawa

, Blaser

. Detection and characterization of autoagglutination activity by Campylobacter jejuni. Infect Immun, 2000; 68:6168–6175.

15.

Moser

, Schroder

. Hydrophobic characterization of thermophilic Campylobacter species and adhesion to INT 407 cell membranes and fibronectin. Microb Pathog, 1997; 22:155–164.

16.

Nguyen

, Fegan

, Turner

, Dykes

. Role of attachment to surfaces on the prevalence and survival of Campylobacter through food systems. J Food Prot, 2012; 75:195–206.

17.

Nguyen

, Turner

, Dykes

. Effect of temperature and contact time on Campylobacter jejuni attachment to, and probability of detachment from, stainless steel. J Food Prot, 2010; 73:832–838.

18.

Nguyen

, Turner

, Dykes

. Influence of cell surface hydrophobicity on attachment of Campylobacter to abiotic surfaces. Food Microbiol, 2011; 28:942–950.

19.

Parkar

, Flint

, Palmer

, Brooks

. Factors influencing attachment of thermophilic Bacilli to stainless steel. J Appl Microbiol, 2001; 90:901–908.

20.

Pearson

, Gaskin

DJH

, Segers

, Wells

, Nuijten

PJA

, van Vliet

AHM

. The complete genome sequence of Campylobacter jejuni strain 81116 (NCTC11828) J Bacteriol, 2007; 189:8402–8403.

21.

Roosjen

, Busscher

, Nordel

, van der Mei

. Bacterial factors influencing adhesion of Pseudomonas aeruginosa strains to a poly (ethylene oxide) brush. Microbiol-SGM, 2006; 152:2673–2682.

22.

Sampathkumar

, Napper

, Carrillo

, Willson

, Taboada

, Nash

JHE

, Potter

, Babiuk

, Allan

. Transcriptional and translational expression patterns associated with immobilized growth of Campylobacter jejuni. Microbiol-SGM, 2006; 152:567–577.

23.

van Oss

. Hydrophobicity of biosurfaces: Origin, quantitative determination and interaction energies. Colloids Surf B Biointerfaces, 1995; 5:91–110.

24.

van Vliet

AHM

, Wood

, Henderson

, Wooldridge

, Ketley

. Genetic manipulation of enteric Campylobacter species. Method Microbiol, 1998; 27:407–419.

25.

Walan

, Kihlstrom

. Surface charge and hydrophobicity of Campylobacter jejuni strains in relation to adhesion to epithelial HT-29 cells. APMIS, 1988; 96:1089–1096.

26.

Zhang

, He

, Li

, Sun

, Gu

, You

, Meng

, Zhang

. Genomic characterization of the Guillain-Barré syndrome-associated Campylobacter jejuni ICDCCJ07001 isolate. PLoS ONE, 2010; 5:e15060.