Prevalence of Hepatitis A Virus in Bivalve Molluscs Sold in Granada (Spain) Fish Markets

Abstract

Viruses are the leading cause of foodborne illness associated with the consumption of raw or slightly cooked contaminated shellfish. The aim of this study was to evaluate the prevalence of hepatitis A virus in molluscs. Standard and real-time reverse transcription–polymerase chain reaction procedures were used to monitor bivalve molluscs from the Granada fishmarkets (southern Spain) for this human enteric virus. Between February 2009 and October 2010, we collected a total of 329 samples of different types of bivalve molluscs (mussels, smooth clams, striped venus, and grooved clams). The results showed the presence of hepatitis A virus in 8.5% of the 329 samples analyzed. We can therefore confirm that conventional fecal indicators are unreliable for demonstrating the presence or absence of viruses. The presence of hepatitis A virus in molluscs destined for human consumption is a potential health risk in southern Spain.

Introduction

T he consumption of bivalve molluscs infected with human pathogenic viruses is associated with a number of human diseases. As filter feeders, bivalve molluscs take in water and filter out organic matter including microbial and viral pathogens. These pathogens may build up within the digestive system. Oysters, clams, and mussels are associated with certain seafood-borne diseases because their habitats may contain high concentrations of contaminants that can be directly adsorbed, and they are often consumed raw or undercooked (Croci et al., 2005).

Traditionally, coliform bacteria and Escherichia coli are measured as indicators of microbiological infection of bivalve molluscs, and monitoring contamination by probing for the presence of these bacteria has successfully prevented bivalve mollusk–borne infections caused by fecal bacteria (Carter, 2005).

Regulations have been established in Europe and Spain to monitor and ensure the sanitary quality of waters used in bivalve production. The European Union (EU) has specific rules governing the production and commercialization of live bivalve molluscs destined for direct human consumption or for transformation prior to consumption (Counsel Directive 91/492/CEE, Regulation (EU) n° 2074/2005, Regulation (EU) n° 1441/2007, Regulation (EU) n° 1021/2008). Yet EU legislation considers only bacteriological parameters, and does not address the viral pathogen load of bivalve molluscs (Baggi et al., 2001; Serracca et al., 2009). Specifically, analyses focus on Salmonella and Escherichia coli (Regulation (EU) n° 853/2004, Regulation (EU) n° 854/2004), which bear no correlation with the presence of viruses (Mesquita et al., 2011).

Depuration is a commercial one-time practice entailing placement of harvested bivalve molluscs in tanks of clean seawater for several hours to allow them to filter contaminants. This reduces the levels of microorganisms present in mollusc tissue, decreasing the potential for infections associated with bivalve mollusc ingestion (Lee et al., 2010). Many reports indicate that depuration can effectively eliminate bacterial pathogens. However, studies with enteric viruses—hepatitis A virus, noroviruses and human adenovirus—show that it is more difficult to remove viruses from infected oysters, and that they tend to be concentrated in the digestive gland of bivalves (Corrêa et al., 2012).

Enteric viruses are a significant public health problem in many countries, including the Mediterranean region, where they may circulate in the environment and possibly contaminate food and water. Epidemiological evidence suggests that human enteric viruses are the most common pathogens transmitted by bivalve molluscs and that hepatitis A in particular is the most serious viral infection linked to bivalve mollusc consumption, causing debilitating disease and, occasionally, death (Pintó et al., 2008).

In the present work, we aimed to analyze the level of contamination by hepatitis A virus in various types of bivalve molluscs from Mediterranean or European countries sold in the fish markets of Granada (southern Spain) and destined for local consumption, and to determine the prevalence of this virus in samples positive and negative for Escherichia coli as a quality indicator according to current legislation (Regulation (EU) n° 853/2004, Regulation (EU) n° 854/2004).

Materials and Methods

Materials

Samples

From February 2009 to October 2010, fresh bivalve molluscs (Mediterranean mussel Mytilus galloprovincialis, smooth clam Callista chione, grooved carpet shell clam Tapes decussatus, and striped venus clam Chamelea gallina) were obtained from retail vendors located by searching the online Yellow Pages in Spanish using the term pescaderías (fish and seafood stores) in the city of Granada. This led us to 46 vendors, and SPSS v. 15.0 software (SPSS Inc., Chicago, IL) was used to randomly select 16 vendors (12 specialty stores and four fish/seafood sections in large supermarkets), which were considered representative of all the local vendors. A total of 329 samples of bivalve molluscs were collected. In Table 1, we describe the mollusc type, the market of origin, the season, and the day of the week that each sample was taken.

Table 1.

Sample Description

N=329	N	%
Type of mollusc
Mussel	113	34.3
Smooth clam	45	13.7
Striped Venus	113	34.3
Grooved	58	17.6
Origin
Stand-alone fish market	242	73.6
Supermarket	87	26.4
Season
Winter	69	21.0
Spring	112	34.0
Summer	71	21.6
Autumn	77	23.4
Day of the week
Monday	36	10.9
Tuesday	158	48.0
Wednesday	135	41.0

Methods

Sample preparation

Twenty-five grams of the mollusc body (stomach and digestive diverticulum) were homogenized with 200 mL of 0.1% peptone water (pH 7.0±0.2) in a Stomacher blender (Stomacher 400 Circulator, Seward Limited, Norfolk, UK) for 2 min at 150 rpm (Moreno Roldán et al., 2011; CEN, 2003). The supernatant was divided into 8-mL aliquots, and 2 mL of glycerol was added to each aliquot. The aliquots were stored at −40°C until subsequent experiments to determine the viral concentrations.

Virus concentration

Five milliliters of the previously described supernatant were centrifuged (Digicen20-R) at 20,000×g for 5 min and kept chilled at 4°C for 12 h. A 16% polyethylene glycol 6000 solution (Merck, Madrid) and a 0.6 M NaCl solution were added to precipitate out the viral particles. The sample was then centrifuged at 12,000×g (Ultracentrifuge, Sigma 3K10, Osterode, Germany) for 30 min at 4°C, and the resulting precipitate was resuspended in 0.5 mL of Tris-Tween (Panreac, Barcelona). This viral particle concentrate was kept at −40°C until the extraction of nucleic acids and reverse transcriptase–polymerase chain reaction (RT-PCR) (Kingsley et al., 2001; Sair et al., 2002; Guévremont et al., 2006).

Extraction

Using 200 μL of each sample, the viral nucleic acids were extracted and purified using the Purelink™ Viral RNA/DNA Kit (Invitrogen, Carlsbad, CA) following the manufacturer's instructions. The viral nucleic acids were stored at −80 °C for 1 month until RT-PCR (Steyer et al., 2011).

RT-PCR for the detection of hepatitis A

The specific primers HAV 1 and HAV 2 (Table 2) were selected via an alignment of a 20–21 nucleotide section of the noncoding regions of the 5’ end to synthesize extension products, which generated fragments of 192 bp (Sharon et al., 2008).

Table 2.

HAV Primers

Virus	Primer	Sequence 5′– 3′	Fragment
HAV	HAV 1	CAGCACATCAGAAAGGTGAG
	HAV 2	CTCCAGAATCATCTCCAAC	192

For this process, the commercial One Step SYBR^® PrimeScript™ (Takara, Japan) kit was used, according to the manufacturer's protocol. The PCR amplification consisted of reverse transcriptase (32 min at 50°C); denaturation of the RT and activation of the hot-start polymerase (95°C, 15 min); and 60 cycles of template denaturation (94°C, 15 s), primer annealing (55°C, 15 s), and primer extension (72°C, 30 s) in a thermocycler (Primus 25, MWG-Biotech, Germany). The resulting fragments were analyzed using conventional electrophoresis in a 2% agarose gel with a buffer containing Tris-Tween base, sodium acetate trihydrate, EDTA (Na)₂•2H₂O, and ethidium bromide. We used a 100-bp reference marker and allowed the gel to run at 300 V for approximately 2 cm.

Statistical analysis

The data were analyzed using SPSS version 15.0 statistical software (SPSS Inc.). For the study of the categorical and qualitative variables, we used absolute and relative frequencies (%). The associations between variables were analyzed using contingency tables and Pearson's chi-square test; p-values<0.05 were considered significant. Confidence intervals were estimated at 95% for each of the variables (Martín and Luna del Castillo, 2004).

Results

Of the samples tested (329), 8.5% tested positive for HAV. Analysis by type of bivalve mollusc showed a greater prevalence of HAV in the smooth clams (11.5%; Table 3). This may be because this mollusc needs prolonged periods of purification, depending on the source area (Lee et al., 2010).

Table 3.

Prevalence of HAV According to Type of Mollusc

	HAV
	Negative			Positive
Type of mollusc	N	%	95% CI	N	%	95% CI	Total
Mussel	105	92.9	86.1–96.7	8	7.1	3.3–13.9	113
Striped venus	42	93.3	80.7–92.3	3	6.7	1.7–19.3	45
Smooth clam	100	88.5	80.8–93.5	13	11.5	6.5–19.2	113
Grooved	54	93.1	82.4–97.8	4	6.9	2.2–17.5	58
Total	301	91.5	87.8–94.2	28	8.5	5.8–12.2	329

CI, confidence interval.

Statistically significant differences were not observed regarding season and HAV contamination, although prevalence was somewhat higher for the fall season (11.7%; Table 4). The mollusc samples tested were satisfactory for the parameter Escherichia coli (<230 most probable number [MPN] Escherichia coli/100 g flesh and intervalvular liquid [FIL]), giving 8.5% contamination by this virus (Table 5).

Table 4.

Prevalence of HAV According to Season

	HAV
	Negative			Positive
Season	N	%	95% CI	N	%	95% CI	Total
Winter	65	94.2	85.1–98.1	4	5.8	1.9–14.9	69
Spring	103	92.0	84.9–96.0	9	8.0	4.0–15.1	112
Summer	65	91.5	81.9–96.5	6	8.5	3.5–18.1	71
Autumn	68	88.3	78.5–94.1	9	11.7	5.8–21.5	77
Total	301	91.5	87.8–94.2	28	8.5	5.8–12.2	329

CI, confidence interval.

Table 5.

Distribution of Samples Negative and Positive for HAV According to the Parameter Escherichia coli

	HAV
	Negative			Positive
Escherichia coli	No.	%	95% CI	No.	%	95% CI	Total
<230 MPN/100 g FIL	257	91.5	87.4–94.3	24	8.5	5.7–12.6	281
>230 MPN/100 g FIL	44	91.7	79.1–97.3	4	8.3	2.7–20.9	48
Total	301	91.5	87.8–94.2	28	8.5	5.8–12.2	329

CI, confidence interval; MPN, most probable number; FIL, flesh and intervalvular liquid.

Discussion

A great quantity of viruses of human origin can be excreted through the feces and urine of infected individuals. These enter wastewater and are dispersed, potentially reaching the water supply or food chain of bivalve molluscs, which then become sources of new infections.

The consumption of bivalve molluscs is reportedly related to 70% of the hepatitis A diagnosed in Italy, 19% in Germany, 25% in the United Kingdom, and 11% in Japan (Lees, 2000).

In addition to determining the level of contamination by hepatitis A in molluscs, our aim was to test whether the treatment that such foods undergo is sufficient to eliminate the risk of transmission of gastrointestinal viruses. While the 8.5% positive samples that we detected would suggest insufficient health guarantees, they are much lower than the values described in previous studies (Amri et al., 2011; Mesquita et al., 2011; Namsai et al., 2011) with 32%, 33%, and 26.3%, respectively. On the other hand, some studies report even lower percentages of samples positive for HAV—4.4% (De Paola et al., 2010) and 5.6% (Terio et al., 2010). In the study by Kanasinakatte et al. (2008), no samples were positive for HAV.

Altogether, these results reflect great variation in the presence of HAV in molluscs. This can be attributed to the different levels of prevalence of hepatitis A in populations worldwide, more or less stringent public health regulations, and the specific RNA extraction procedures or primers used in the studies.

Although we found that the smooth clam presented the highest level of contamination (Table 3), other authors report the highest values in mussels (Namsai et al., 2011; Amri et al., 2011; La Rosa et al., 2012), respectively, obtaining 88.9%, 6.5%, and 36.3% HAV positive samples. Croci et al. (2005) demonstrate that even when the mussel is subjected to heat for a few minutes, opening its valves, the virus is not destroyed.

Another factor to bear in mind is that clams are buried in the sand, while mussels and oysters live on rocky surfaces (Le Guyader et al., 1994). This may explain why the study by Amri et al. (2011) obtained results similar to ours for mussels and oysters, while the smooth clams they tested presented much greater HAV contamination (45.8%).

Although viral infection can occur throughout the year, HAV infection tends to be seasonal, occurring mainly in January. Physical and chemical factors affect the stability and survival of viral particles in the aquatic environment, including seasonal temperature, pH, and salinity (Kingsley and Chen, 2009).

In summer, HAV prevalence is less likely due to reduced circulation of the virus (Svraka, 2007). In our study, HAV was detected in all the seasons of the year, though slightly higher in autumn, in 11.7% of samples (Table 4). There may have been an increase in fecal contamination during the autumn months, raising the concentration of the virus in the waters where the molluscs grew. In southern Italy, De Paola et al. (2010) obtained the highest rates of HAV in molluscs harvested between December and March, however.

In conclusion, bivalve molluscs intended for human consumption must comply with specific standards for a zone denominated category A, meaning no more than 230 MPN of Escherichia coli in 100 g, and containing no Salmonella in 25 g of mollusc meat. Of the mollusc samples we studied, 281 were fit for consumption in the sense that they contained less than 230 MPN/100 g, yet 24 of them (8.5%) were positive for HAV. Hence, the above indicator can be considered insufficient for ensuring the safety of bivalve molluscs for human consumption and this strongly suggests that current legislation does not serve to control virological quality. A lack of correlation between the bacterial levels established by European legislation and the presence/absence of enteric viral pathogens is well documented by authors describing results in line with our findings (Baggi et al., 2001; Croci et al., 2005; Serracca et al., 2009; Amri et al., 2011).

In view of the very serious consequences of HAV in certain groups of the population and the low minimal infectious dose, populations at risk should be better educated regarding the risks involved in the ingestion of raw bivalve molluscs, and legislation should be reviewed accordingly.

Footnotes

Disclosure Statement

No competing financial interests exist.

References

Amri

, Hmaıed

, Loisy

, Lebeau

, Barkallah

, Saidi

, Slim

. Detection du virus de l'hepatite A dans les coquillages en Tunisie par reverse transcription-nested PCR recherche de correlation entre la contamination viraleet bacterienne. Pathol Biol, 2011; 59:217–221(In French.)

Baggi

, Demarta

, Peduzzi

. Persistence of viral pathogens and bacteriophages during sewage treatment: Lack of correlation with indicator: Lack of correlation with indicator bacteria. Res Microbiol, 2001; 8:152.

Carter

. Enterically infecting viruses: Pathogenicity, transmission and significance for food and waterborne infection. J Appl Microbiol, 2005; 98:1354–1380.

[CEN] European Committee for Standardization. Microbiology of food for human and animal consumption. Preparation of analysis samples, initial suspension, and decimal dilutions for the microbiological exam. Part 3. Specific rules for the preparation of fish and fish productsISO 6887-3-20032003.

Council Directive of July 15, 1991. 91/492/CEE, by which health laws applicable to the production and marketing of live bivalve mollusc were established.

Corrêa

, Rigotto

, Moresco

, Kleemann

, Teixeira

, Poli

, Oliveira

, Monte

. The depuration dynamics of oysters (Crassostea gigas) artificially contaminated with hepatitis A virus and human adenovirus. Mem Inst Oswaldo Cruz, 2012; 107:11–17.

Croci

, De Medici

, Di Pasquale

, Toti

. Resistance of hepatitis A virus in mussels subjected to different domestic cookings. Int J Food Microbiol, 2005; 105:139–144.

De Paola

, Woods

, Burkhardt

, Calci

, Krantz

, Bowers

, Kasturi

, Byars

, Jacobs

, Williams-Hill

, Nabe

. Bacterial and Viral Pathogens in Live Oysters: 2007. United States Market Survey. Appl Environ Microbiol, 2010; 76:2754–2768.

Guévremont

, Brassard

, Houdeb

, Simard

, Trottier

. Development of an extraction and concentration procedure and comparison of RT-PCR primer systems for the detection of hepatitis A virus and norovirus GII in green onions. J Virol Meth, 2006; 134:130–135.

10.

Kanasinakatte

, Bhavani

, Venugopal

, Karunasagar

, Krohne

, Karunasagar

. Prevalence of human pathogenic enteric viruses in bivalve molluscan shellfish and cultured shrimp in south west coast of India. Int J Food Microbiol, 2008; 122:279–286.

11.

Kingsley

, Richards

. Rapid and efficient extraction method for reverse transcription PCR detection of hepatitis A and Norwalk-like viruses in bivalve molluscs. Appl Environ Microbiol, 2001; 67:4152–4157.

12.

Kingsley

, Chen

. Influence of pH, salt, and temperature on pressure inactivation of hepatitis A virus. Int J Food Microbiol, 2009; 130:61–66.

13.

La Rosa

, Fratini

, Spuri Vennarucci

, Guercio

, Purpari

, Muscillo

. GIV noroviruses and other enteric viruses in bivalves: A preliminary study. New Microbiologica, 2012; 35:27–34.

14.

Lee

, Lovatelli

, Ababouch

. Depuración de Bivalvos: Aspectos Fundamentales y Prácticos. FAO Documento técnico de pesca n° 511: Rome: FAO, 2010; 74.

15.

Le Guyader

, Dubois

, Menard

, Pommepuy

. Detection of hepatitis A virus, rotavirus and enterovirus in naturally contaminated bivalve molluscs and sediment by reverse transcription-semi nested PCR. Appl Environ Microbiol, 1994; 60:3365–3371.

16.

Lees

. Viruses and bivalve bivalve molluscs. Int J Food Microbiol, 2000; 59:81–116.

17.

Martín

, Luna del Castillo

. El test χ² y sus aplicaciones (in Spanish) Biostatistics for Health Sciences, 5 ^th. Madrid: Norma Capital, 2004; 332–396.

18.

Mesquita

, Vaz

, Cerqueira

, Castilho

, Santos

, Monteiro

, Manso

, Romalde

, São

, Nascimento

. Norovirus, hepatitis A virus and enterovirus presence in bivalve molluscs from high quality harvesting areas in Portugal. Food Microbiol, 2011; 28:936–941.

19.

Moreno Roldán

, Espigares Rodríguez

, Navarro Vicente

, Fernández-Crehuet Navajas

, Moreno Abril

. Microbial contamination of bivalve molluscs used for human consumption. J Food Safety, 2011; 31:257–261.

20.

Namsai

, Louisirirotchanakul

, Wongchinda

, Siripanyaphinyo

, Virulhakul

, Puthavathana

, Myint

, Gannarong

, Ittapong

. Surveillance of hepatitis A and E viruses contamination in bivalve molluscs in Thailand. Lett Appl Microbiol, 2011; 53:608–613.

21.

Pintó

, Bosch

. Rethinking virus detection in food. Koopmans

MPG

, Cliver

, Bosch

Food-borne Viruses: Progress and Challenges. Barcelona: ASM Press, 2008; 171–188.

22.

Regulation (EU) n° 853/2004 of the European Parliament and Council April 29, 2004. by which specific hygienic laws for animal-based food products were established.

23.

Regulation (EU) n° 854/2004 of the European Parliament and Council, by which specific laws for the organization of official quality control over animal-based products destined for human consumption were established.

24.

Regulation (EU) n° 1021/2008 of the Commission, October 17, 2008, which modified annexes I, II, and III of Regulation (EU) n° 854/2004 of the European Parliament and Council, by which specific laws for the organization of official quality control over animal-based products destined for human consumption were established, and Regulation (EU) n° 2076/2005, in which live bivalve molluscs, certain fish products, and the personnel that aid in the quality control in slaughterhouses were addressed. Official Journal of the European Union. L 277/15-17.

25.

Regulation (EU) n° 1441/2007 of the Commission, December 5, 2007, which modified Regulation (EU) n° 2073/2005 relative to the microbiological criteria applicable to food products. Official Journal of the European Union. L 322/12-29.

26.

Regulation (EU) n° 2074/2005 of the Commission, December 5, Official Journal of the European Union L 338/27-59, by which application measures for certain products were established in accordance with Regulation (EU) n° 853/2004 of the European Parliament and Council and for the organization of official quality control in accordance with Regulation (EU) n° 854/2004 of the European Parliament and Council and (EU) n° 882/2004 of the European Parliament and Council. Exceptions are introduced to Regulation (EU) n° 852/2004 of the European Parliament and Council, which modifies Regulations (EU) n° 853/2004 and (EU) n° 854/2004.

27.

Sair

, D'Souza

, Moe

, Jaykus

. Improved detection of human enteric viruses in foods by RT-PCR. J Virol Meth, 2002; 100:57–69.

28.

Serracca

, Verani

, Battistini

, Rossini

, Carducci

, Ercolini

. Evaluation of adenovirus and E. coli as indicators for human enteric viruses presence in mussels produced in La Spezia Gulf (Italy) Lett Appl Microbiol, 2009; 50:462–467.

29.

Sharon

, Nappier

, Graczyk

, Schwab

. Bioaccumulation, retention, and depuration of enteric viruses by Crassostrea virginica and Crassostrea ariakensis Oysters. Appl Environ Microbiol, 2008; 74:6825–6831.

30.

Steyer

, Godič Torkar

, Gutiérrez-Aguirre

, Poljšak-Prijatelj

. High prevalence of enteric viruses in untreated individual drinking water sources and surface water in Slovenia. Int J Hygiene Environ Health, 2011; 214:392–398.

31.

Svraka

, Duizer

, Vennema

, De Bruin

, Van der Veer

, Dorresteijn

, Koopmans

. Etiological role of viruses in outbreaks of acute gastroenteritis in The Netherlands from 1994 through 2005. J Clin Microbiol, 2007; 45:1389–1394.

32.

Terio

, Di Pinto

, Martella

, Tantillo

. RNA extraction method for the PCR detection of hepatitis A virus in bivalve molluscs. Int J Food Microbiol, 2010; 142:198–201.