Investigation of Virulence and Cytolethal Distending Toxin Genes in Campylobacter spp. Isolated from Sheep in Turkey

Abstract

The presence of virulence and cytolethal distending toxin (Cdt) genes was investigated in isolates of Campylobacter jejuni, C. coli, C. lanienae, and C. lari that originated from intestinal contents and gallbladders of clinically healthy sheep. These genes have important roles in the pathogenicity of campylobacters. A total of 363 Campylobacter isolates (221 C. jejuni, 135 C. coli, five C. lanienae, and two C. lari) were used in this study. The frequency of racR, dnaJ, ciaB, pldA, flaA, and cadF virulence genes in all the isolates were determined to be 34.4%, 30%, 24.8%, 30.9%, 95%, and 81.3%, respectively, while the virB11 virulence gene could not be detected in any isolates. CdtA, cdtB, and cdtC genes were detected in 54.5%, 55.9%, and 52.3% of the isolates, respectively. None of the virulence and toxin genes examined here were detected in a total of 19 Campylobacter isolates consisting of 10 C. jejuni and nine C. coli. This is the first study investigating the presence of virulence and toxin genes in a large number of Campylobacter species isolated from clinically healthy sheep by scanning a large area. In addition, this is the first report investigating the presence of virulence and toxin genes in sheep-originated C. lanienae and C. lari isolates.

Introduction

T hermophilic Campylobacter species, particularly C. jejuni and C. coli, are among the most common causes of acute bacterial gastroenteritis in humans and animals all over the world (Humphrey et al., 2007). Campylobacter lari is seen less frequently and reported as a cause of diarrhea in humans (Matsuda and Moore, 2011). It is not yet clear whether C. lanienae isolated from pigs and cattle is a pathogen to humans and animals (Oporto and Hurdato, 2011). The pathogenesis of Campylobacter infections is very complex and influenced by many factors such as toxin production. The best-characterized toxin in Campylobacter species is cytolethal distending toxin (CDT). Three adjacent gene regions including cdtA, cdtB, and cdtC are responsible for CDT production in Campylobacter spp. and are capable of activating a subunit of CDT holotoxin (Wassenaar, 1997). Even though very high rates of CDT genes were reported in Campylobacter spp., existence of CDT-negative Campylobacter species have been reported by Pickett et al. (1996). A variety of cell cultures were used to understand the roles of CDT genes in the pathogenesis of Campylobacter. In some studies, isolates possessing high proportions of CDT genes have been reported to have no cytotoxic effect in cell culture (Pickett et al., 1996; Ripabelli et al., 2010). Other factors that play a role in the pathogenesis of Campylobacter are flaA, cadF, racR, and dnaJ gene regions, which are responsible for colonization and adherence, and virB11, ciaB and pldA gene regions, which are responsible for invasion. The flagellin genes are the best-characterized virulence determinants of Campylobacter. The involvement of the flaA gene in Campylobacter colonization has been shown (Nachamkin et al., 1993). CadF is one of the most important outer membrane proteins involved in intestinal epithelial cell attachment and colonization. Ziprin et al. (1999) reported that C. jejuni cadF mutants are unable to colonize the intestines of chickens. This gene region is highly protected in C. jejuni and C. coli isolates and has been reported to have a major role in the development of campylobacteriosis (Monteville et al., 2003). Most of the studies investigating CDT and virulence genes are related to Campylobacter species isolated from samples of poultry and humans with diarrhea (Müller et al., 2006; Talukder et al., 2008). There are limited studies about the prevalence of CDT and virulence genes in Campylobacter species isolated from other animals. Research studies regarding the prevalence of genes in Campylobacter isolated from sheep are quite limited, and a very small number of isolates were examined in these studies (Findik et al., 2011). In addition, the majority of studies are focused on C. jejuni and C. coli species, and there are no studies with C. lanienae and C. lari species. This study aimed to investigate the presence and frequency of virulence and CDT genes in Campylobacter species isolated from clinically healthy sheep.

Materials and Methods

Bacterial strains

Three hundred sixty-three Campylobacter isolates (221 C. jejuni, 135 C. coli, five C. lanienae, and two C. lari), isolated from intestinal content and gallbladder samples of clinically healthy sheep slaughtered at abattoirs located in three provinces in the east of Turkey, were used in this study. A total of 900 internal organ samples containing 150 gallbladders and 150 intestinal contents from feeding sheep in each province (n=3) were aseptically transferred to 10 mL of Brucella broth (Difco, Detroit, MI) containing 7% laked horse blood, Campylobacter growth supplement (SR0048; Oxoid), and Preston Campylobacter selective supplement and then incubated at 42°C for 48 h under a microaerophilic atmosphere. A loopful of broth was inoculated onto modified charcoal cefoperazone deoxycholate agar and incubated under the previous conditions. The isolates were presumptively identified as Campylobacter spp. by colony appearance, microscopic morphology, and motility. All the isolates were identified by using genus- and species-specific polymerase chain reaction (PCR), which was described previously (Table 1). Reference strains of C. jejuni (NCTC11322), C. coli (NCTC11366), C. lari (NCTC11352), and C. lanienae (NCTC 13004) were used as positive controls, and sterile distilled water was used as negative control in the PCR assays.

Table 1.

Primers and Polymerase Chain Reaction (PCR) Conditions Used in This Study

Target	Sequences (5′-3′) (amplicon sizes)	PCR conditions	References
cdtA	F-GGAAATTGGATTTGGGGCTATACT	94°C 1 min	(Bang et al., 2003)
	R-ATCACAAGGATAATGGACAAT	42°C 2 min (30 cycles)
	(Amplicon:165 bp)	72°C 3 min
cdtB	F-GTTAAAATCCCCTGCTATCAACCA	94°C 1 min	(Bang et al., 2003)
	R-GTTGGCACTTGGAATTTGCAAGGC	42°C 2 min (30 cycles)
	(Amplicon:495 bp)	72°C 3 min
cdtC	F-TGGATGATAGCAGGGGATTTTAAC	94°C 1 min	(Bang et al., 2003)
	R-TTGCACATAACCAAAAGGAAG	42°C 2 min (30 cycles)
	(Amplicon:555 bp)	72°C 3 min
cadF	F-TTGAAGGTAATTTAGATATG	94°C 1 min	Konkel et al., 1999)
	R-CTAATACCTAAAGTTGAAAC	45°C 2 min (30 cycles)
	(Amplicon:400 bp)	72°C 3 min
virB11	F-GAACAGGAAGTGGAAAAACTAGC	95°C 30 s	(Bacon et al., 2000)
	R-TTCCGCATTGGGCTATATG	52°C 30 s (35 cycles)
	(Amplicon: 708 bp)	72°C 2 min
flaA	F-GGATTTCGTATTAACACAAATGGTGC	94°C 1 min	(Nachamkin et al., 1993)
	R-CTGTAGTAATCTAAAACATTTTG	45°C 1 min (30 cycles)
	(Amplicon: 1728 bp)	72°C 3 min
racR	F-GATGATCCTGACTTTG	94°C 1 min	(Datta et al., 2003)
	R-TCTCCTATTTTTACCC	45°C 1 min (30 cycles)
	(Amplicon: 584 bp)	72°C 1 min
dnaJ	F-AAGGCTTTGGCTCATC	94°C 1 min	(Datta et al., 2003)
	R-CTTTTTGTTCATCGTT	46°C 1 min (30 cycles)
	(Amplicon: 720 bp)	72°C 1 min
ciaB	F-TTTTATCAGTCCTTA	94°C 1 min	(Datta et al., 2003)
	R-TTTCGGTATCATTAGC	42°C 1 min (30 cycles)
	(Amplicon: 986 bp)	72°C 2 min
pldA	F-AAGCTTATGCGTTTTT	94°C 1 min	(Datta et al., 2003)
	R-TATAAGGCTTTCTCCA	45°C 1 min (30 cycles)
	(Amplicon: 913 bp)	72°C 2 min
Campylobacter spp.(16S rRNA)	F-GGATGACACTTTTCGGAGC	94°C 30 s	(Linton et al., 1996)
	R-CATTGTAGCACGTGTGTC	55°C 1 min (30 cycles)
	(Amplicon: 816 bp)	72°C 1 min
C. jejuni (Oxidoreductase)	F-CAAATAAAGTTAGAGGTAGAATGT	94°C 30 s	(Linton et al., 1997)
	R-GGATAAGCACTAGCTAGCTGAT	58°C 30 s (30 cycles)
	(Amplicon: 159 bp)	72°C 1 min
C. lanienae (16S rRNA)	F-GTAAGAGCTTGCTCTTATGAG	94°C 30 s	Logan et al., 2000)
	R-TCGTATCTCTACAAGGTTCTTA	58°C 1 min 30 s (30 cycles)
	(Amplicon: 920 bp)	72°C 1 min
C. coli (Aspartokinase)	F-GGTATGATTTCTACAAAGCGAG	94°C 30 s	(Linton et al., 1997)
	R-ATAAAAGACTATCGTCGCGTG	58°C 30 s (30 cycles)
	(Amplicon: 502 bp)	72°C 1 min
C. lari (16S rRNA)	F-CAAGTCTCTTGTGAAATCCAAC	94°C 1 min	(Linton et al., 1996)
	R- ATTTAGAGTGCTCACCCGAAG	64°C 1 min (25 cycles)
	(Amplicon: 561 bp)	72°C 1 min

DNA extraction and PCR

A phenol extraction method described by Acik and Cetinkaya (2005) was used to extract DNA from isolates. Briefly, a loopful taken from pure cultures identified as C. jejuni, C. coli, C. laniaenae, and C. lari with the species-specific PCR were transferred into Eppendorf tubes containing 300 μL distilled water. Equal amounts of TNES buffer (20 mmol Tris, pH 8.0, 150 mmol NaCl, 10 mmol EDTA, 0.2% sodium dodecyl sulfate), and proteinase K (200 μg/mL) were added to the tubes and the suspension was incubated at 56°C for 2 h and was boiled for 10 min afterwards. An equal amount of phenol was added to the suspension and stirred. Then, ethanol precipitation was performed. The pellet obtained in the last step was diluted with 100 μL of distilled water. PCR was performed using the primers and heat cycles given in Table 1 to investigate virulence and CDT genes in Campylobacter isolates. The PCR was performed in a TC512 Temperature Cycling System (Techne, Staffordshire, UK) in a total of 50 μL containing 5 μL of 10x PCR buffer (750 mM Tris-HCl, pH 8.8, 200 mM (NH₄)₂SO₄, 0.1% Tween 20), 5 μL of 2 mM MgCl₂, 250 mM of each deoxynucleotide triphosphate, 1.25 U of Taq DNA polymerase (MBI Fermantas, St. Leon-Rot, Germany), 20 pmol of each primer, and 5 μL of template DNA.

Determination of CDT activity

CDT activity was measured in a total of 27 isolates consisting of five C. lanienae, two C. lari, 10 randomly selected C. coli, and C. jejuni isolates (five cdt gene–negative and five cdt gene–positive isolates of each species) using HeLa cell culture (Foot and Mouth Disease Institute, Ankara, Turkey) to reveal the pathogenesis of Campylobacter spp. identified at species level. Bacterial cell lysates were prepared and assayed for CDT activity according to the method described by Pickett et al. (1994) with minor modifications. Briefly, Campylobacter isolates produced in modified charcoal cefoperazone deoxycholate agar medium were inoculated to Eagle's Minimum Essential Medium (EMEM, Invitrogen). Bacterial density of the medium was measured by spectrophotometry and was set up with 0.125 (2×10⁸ colony-forming units/mL) at OD600. The bacterial strains suspended in EMEM tissue culture medium were lysed with the sonication method (4×30-s bursts with 30-s intervals between each burst). After sonication, samples were centrifuged at 10,000×g and the supernatants were filtered using 0.22-μL pore size. CDT assay was performed with HeLa cells grown in EMEM supplemented with 10% fetal bovine serum. Microtiter plates (96-well) were seeded with 2×10⁴ HeLa cells per well and incubated for 18 h before the assay was performed. One hundred microliters of each dilution was applied to these wells, and the plates were incubated at 37°C in a 5% CO₂ incubator. Morphological changes of HeLa cells were examined every 24 h for 3 days. Toxin titers were determined by performing twofold serial dilutions of the sonic lysate in HeLa cell culture medium. CDT activity titer was defined as the reciprocal of the highest dilution that produced distension in >50% of the cells. With morphological changes occurring in the cell following incubation, staining of actin filaments was achieved using Alexa Fluor^®448-conjugated phalloidin (Invitrogen) (Aragon et al., 1997). Four isolates of C. jejuni and C. coli (two from each species) were used as positive controls and sterile phosphate buffer saline was used as negative control in the assays.

Results

Based on PCR analysis, the occurrence of virulence genes other than virB11 in the Campylobacter isolates were detected in the range between 25% and 95%. While the most commonly found genes in Campylobacter species were flaA and cadF genes, the virB11 gene could not be detected in any of the isolates. The prevalence of flaA and cadF genes examined in five C. lanienae isolates was 100% and 80%, respectively, but the other virulence genes were detected in one isolate only (Table 2).

Table 2.

Polymerase Chain Reaction Results of Cytolethal Distending Toxin (CDT) and Virulence Genes of Campylobacter spp. Isolated from Sheep

Number of CDT and virulence genes (%)
Samples	Strain	Number	racR	dnaJ	ciaB	pldA	flaA	cadF	virB11	cdtA	cdtB	cdtC
Intestinal content	C. jejuni	116	19 (16.4)	19 (16.4)	31 (26.7)	36 (31)	110 (94.8)	110 (94.8)	0 (0)	63 (54.3)	63 (54.3)	57 (49.1)
	C. coli	111	48 (43.2)	35 (31.5)	22 (19.8)	21 (18.9)	103 (92.8)	53 (47.7)	0 (0)	39 (35.1)	44 (39.6)	42 (37.8)
	C. lanienae	4	1 (25)	1 (25)	1 (25)	1 (25)	4 (100)	3 (75)	0 (0)	2 (50)	3 (75)	3 (75)
	C. lari	1	0 (0)	0 (0)	0 (0)	0 (0)	1 (100)	1 (100)	0 (0)	0 (0)	0 (0)	0 (0)
	Total	232	68 (29.3)	55 (23.7)	54 (23.3)	58 (25)	218 (94)	167 (72)	0 (0)	104 (44.8)	110 (47.4)	102 (44)
Gallbladder	C. jejuni	105	49 (46.7)	49 (46.7)	33 (31.4)	48 (45.7)	102 (97.1)	102 (97.1)	0 (0)	82 (78.1)	84 (80)	74 (70.5)
	C. coli	24	8 (33.3)	5 (20.8)	3 (12.5)	6 (25)	23 (95.8)	23 (95.8)	0 (0)	11 (45.8)	8 (33.3)	12 (50)
	C. lanienae	1	0 (0)	0 (0)	0 (0)	0 (0)	1 (100)	1 (100)	0 (0)	0 (0)	0 (0)	0 (0)
	C. lari	1	0 (0)	0 (0)	0 (0)	0 (0)	1 (100)	1 (100)	0 (0)	1 (100)	1 (100)	1 (100)
	Total	131	57 (43.5)	54 (41.2)	36 (27.5)	54 (41.2)	127 (96.9)	127 (96.9)	0 (0)	94 (71.8)	93 (71)	87 (66.4)
General total		363	125 (34.4)	109 (30)	90 (24.8)	112 (30.9)	345 (95)	295 (81.3)	0 (0)	198 (54.5)	203 (55.9)	190 (52.3)

The prevalence of cdtA, cdtB, and cdtC genes were detected as 54.5%, 55.9%, and 52.3%, respectively, in all the Campylobacter isolates. Prevalence of CDT genes was found to be higher in gallbladder-originated Campylobacter isolates than the intestine-originated isolates. While the CDT genes were not encountered in gallbladder-originated C. lanienae isolates, they were found in the range of 50–75% in the intestinal isolates (Table 2).

CDT activity in HeLa cell culture

When HeLa cells were treated with the sonic lysates, the cells did not show any characteristic changes in morphology within 72 h. However, morphological changes such as cell swelling, expansion, growth, and cell shape change were detected in the cells treated with positive controls after 48 h. None of the Campylobacter isolates showed CDT activity. CDT titers in positive controls were detected as 1 in 64.

Discussion

The ideal way to study the pathogenesis of an infection is to determine pathological changes in vivo produced by the causative agents in a suitable live-animal model. In addition, in vitro studies such as detection of genes involved in pathogenesis and cell culture with molecular methods are performed to help in understanding the pathogenesis of Campylobacter infection. The presence of virulence and CDT genes has been investigated in Campylobacter species isolated from many different sources. In vitro CDT production in cell cultures and their harmful effects have also been investigated (Nakajima et al., 2012; Quertz et al., 2012). In these studies, the isolates were obtained from stool samples of people admitted to the hospital with complaints of gastroenteritis, and from feces of animals, particularly poultry. CDT genes in addition to virulence genes were investigated using a small number of samples (60 C. jejuni and five C. coli) (Quertz et al., 2012). A limited number of research studies are available on the investigation of CDT and virulence genes in sheep-originated Campylobacter species in the literature. So far, a small number of isolates (44 isolates) have been examined with focus on C. jejuni only (Findik et al., 2011). It is therefore important to investigate CDT and virulence genes in sheep carrying a high rate of Campylobacter spp., particularly C. coli.

The most frequently detected virulence gene was flaA (95%) in the present study. When the results were analyzed at the species level, the flaA gene was found in 100% of C. lanienae and C. lari, and 96% of C. jejuni isolates while it was detected at a lower proportion (93%) in C. coli isolates. This gene, which is known to be highly protected in Campylobacter species, has been reported to be present in all C. jejuni and C. coli isolates in a previous study (Bang et al., 2003). However, in our study, the flaA gene was not detected in approximately 5% of the isolates. Interestingly, the other six virulence and CDT genes were not detected either, in the isolates that did not contain the flaA gene. This is probably due to becoming a mutant strain after losing virulence genes. In a molecular genetic study conducted by Nachamkin et al. (1993), it was reported that mutations might occur in the flaA gene but there was no mutations in the flaB gene, which is needed for colonization. To fully understand pathogenicity of virulence and CDT genes, negative isolates should be investigated in cell cultures and experimental animals.

In our study, while the cadF gene was found to be present in 89% of all the Campylobacter isolates, a lower proportion of this gene was detected in C. coli isolates. Interestingly, the cadF gene could not be detected in more than half of the intestine-originated C. coli isolates. On the other hand, other virulence genes and CDT genes were also detected at low rates in these isolates. The prevalence of C. coli in sheep and pigs is known to be high when compared to other animals such as poultry and cattle. In some studies, it has been reported to be close to the prevalence of C. jejuni (Stanley et al., 1998). However, the prevalence of C. coli is rare in humans, as the agent can be isolated from approximately 5% of patients with diarrhea (Humphrey et al., 2007). It is thought that in humans, the virulence of C. coli is low due to its weak pathogenicity. There are no studies investigating the cadF gene and other virulence genes in Campylobacter isolated from sheep.

RacR, dnaJ, ciaB, and pldA genes also have important roles in the pathogenesis of Campylobacter. Each of these genes has different roles and was detected in 25–34% of Campylobacter isolates examined in this study. In a study carried out in human fecal samples by Talukder et al. (2008), racR, dnaJ, pldA, and ciaB virulence genes were detected in significantly high proportions (95–100%) unlike our study. The main reason for this difference may be that Talukder et al. (2008) obtained Campylobacter isolates from patients with diarrhea, whereas virulence genes were investigated in isolates obtained from clinically healthy sheep in the present study. These genes were not identified in any of the C. lari isolates, and all of these virulence genes were detected in only one C. lanienae isolate. However, it is difficult to make a plausible comment about these findings as the number of C. lanienae and C. lari isolates used in this study were limited.

VirB gene, detected by Bacon et al. (2000) and reported to be involved in the pathogenesis of Campylobacter, was not found in Campylobacter isolates in the present study. Although this gene has been reported to be present in 7–15% of Campylobacter isolates from different animals, it has not been detected at all in some studies (Talukder et al., 2008; Bang et al., 2003; Datta et al., 2003). Talukder et al. (2008) reported that this gene was not detected in 58 Campylobacter isolates from human feces. These data suggest that the vast majority of Campylobacter isolates do not contain plasmid (Bacon et al., 2000).

Cytotoxins encoded by CDT genes are important factors in the pathogenesis of Campylobacter infections, and these CDTs have been reported to have significant roles in human enteritis and inhibit the G2 and M phases of cell division (Wassenaar, 1997). In recent studies, the distribution and prevalence of CDT genes in C. jejuni and C. coli isolates were investigated and found at different ratios (Bang et al., 2003; Rozynek et al., 2005). This varies depending on many factors such as animal species, specimen type, methodology, and regional differences. According to Rozynek et al. (2005), the prevalence of cdtA, cdtB, and cdtC genes varied from 13% to 35% in poultry and from 22% to 50% in human isolates. On the other hand, Martinez et al. (2006) reported a higher prevalence (98%) in C. jejuni isolates obtained from various sources in different European countries. In Turkey, cdtA, cdtB, and cdtC genes could not be detected in 5.9%, 10.7%, and 0.6% of C. jeuni isolates, respectively, from animals (Findik et al., 2011). In the present study, CDT genes were detected in approximately half of the isolates, and the prevalence of these genes was higher in C. jejuni and C. lanienae isolates. In a study by Jain et al. (2008), while cdtB gene was detected in 87.8% of C. jejuni and 14.2% of C. coli, it was not observed in C. lari isolates. All the CDT genes were detected in one of the two C. lari isolates examined in this study. However, it should be emphasized that in both studies a very limited numbers of C. lari isolates were investigated for the presence of CDT genes, and therefore these results may not reflect the actual prevalence of CDT genes. While this study was the first reporting CDT genes in C. lanienae, CDT genes were detected in only 40–60% of isolates. Each CDT gene itself does not have the capability to damage cells, but these three toxin genes combined can build toxic effect (Lara-Tejero and Galán, 2001). Asakura et al. (2007) identified deletions in cdtA and cdtB gene regions in C. jejuni isolates, and Eyigor et al. (1999) reported the presence of mutations in CDT-negative isolates. Although deletions and mutations have a role in diversity of CDT gene prevalence in Campylobacter isolates, geographic differences are also thought to have a major role. Campylobacter infections affect more people in developed countries, and the prevalence of these genes is also higher in developed countries than in developing countries (Bang et al., 2003; Talukder et al., 2008). There seems to be a positive correlation between the prevalence of CDT genes and the infection rate of Campylobacter in humans (Ripabelli et al., 2010).

While the prevalence of CDT genes was found at high proportions in sheep-originated Campylobacter isolates, the activity of CDT production of these isolates was not detected in HeLa cell cultures. This is in agreement with the previous studies. Ripabelli et al. (2010) reported that the presence of CDT genes in Campylobacter isolates was 100%, but none of the isolates caused CDT production in Vero and Hep-2 cell cultures. The main reason for this is thought to arise from the difference between in vitro and in vivo gene expression. Indeed, CDT production capacity of Campylobacter isolates was found to be higher in in vivo studies (Newell and Pearson, 1984). Studies also suggest that the type of cell culture is important for the detection of CDT production capacity. Although many different cell cultures were used in research studies, HeLa cell culture has been reported to be the most appropriate and effective cell culture to detect CDT activity (Friis et al., 2005). In addition, CDT production capacity in cell cultures has been reported to differ between Campylobacter species. Pickett et al. (1996) reported that CDT production capacity of C. coli in cell culture was lower than that of C. jejuni. In the present study, none of the isolates was determined to produce CDT activity in HeLa cell cultures.

In conclusion, the prevalence of virulence and CDT genes in Campylobacter isolated from sheep was lower when compared to the other studies or other animal species, which suggests that campylobacters of sheep origin might be less virulent. However, additional studies using animal models are necessary to analyze this further.

Footnotes

Acknowledgments

This study was funded by The Scientific and Technical Research Council of Turkey (TUBITAK, TOVAG-110O356).

Disclosure Statement

No competing financial interests exist.

References

Acik

, Cetinkaya

. The heterogeneity of Campylobacter jejuni and Campylobacter coli strains isolated from healthy cattle. Lett App Microbiol, 2005; 41:397–403.

Aragon

, Chao

, Dreyfus

. Effect of cytolethal distending toxin on F-actin assembly and cell division in Chinese hamster ovary cells. Infect Immun, 1997; 68:4384–4390.

Asakura

, Samosornsuk

, Taguchi

, Kobayashi

, Misawa

, Kusumoto

, Nishimura

, Matsuhisa

, Yamasaki

. Comparative analysis of cytolethal distending toxin (cdt) genes among Campylobacter jejuni, C. coli and C. fetus strains. Microb Pathog, 2007; 42:174–1783.

Bacon

, Alm

, Burr

, Hu

, Kopecko

, Ewing

, Trust

, Guerry

. Involvement of a plasmid in virulence of Campylobacter jejuni 81-176. Infect Immun, 2000; 68:4384–4390.

Bang

, Nielsen

, Scheutz

, Pedersen

, Handberg

, Madsen

. PCR detection of seven virulence and toxin genes of Campylobacter jejuni and Campylobacter coli isolates from Danish pigs and cattle and cytolethal distending toxin production of the isolates. J Appl Microbiol, 2003; 94:1003–1014.

Datta

, Niwa

, Itoh

. Prevalence of 11 pathogenic genes of Campylobacter jejuni by PCR in strains isolated from humans, poultry meat and broiler and bovine faeces. J Med Microbiol, 2003; 52:345–348.

Eyigor

, Dawson

, Langlois

, Pickett

. Cytolethal distending toxin genes in Campylobacter jejuni and Campylobacter coli isolates: Detection and analysis by PCR. J Clin Microbiol, 1999; 37:1646–1650.

Findik

, Ica

, Onuk

, Percin

, Kevenk

, Ciftci

. Molecular typing and CDT genes prevalence of Campylobacter jejuni isolates from various sources. Trop Anim Health Prod, 2011; 43:711–719.

Friis

, Pin

, Pearson

, Wells

. In vitro cell culture methods for investigating Campylobacter invasion mechanisms. J Microbiol Methods, 2005; 61:145–160.

10.

Humphrey

, O'Brien

, Madsen

. Campylobacters as zoonotic pathogens: A food production perspective. Int J Food Microbiol, 2007; 117:237–257.

11.

Jain

, Prasad

, Sinha

, Husain

. Differences in virulence attributes between cytolethal distending toxin positive and negative Campylobacter jejuni strains. J Med Microbiol, 2008; 57:267–272.

12.

Konkel

, Gray

, Kim

, Garvis

, Yoon

. Identification of the enteropathogens Campylobacter jejuni and Campylobacter coli based on the cadF virulence gene and its product. J Clin Microbiol, 1999; 37:510–517.

13.

Lara-Tejero

, Galán

. CDTA, CDTB, CDTC form a tripartite complex that is required for cytolethal distending toxin activity. Infect Immun, 2001; 69:4358–4365.

14.

Linton

, Owen

, Stanley

. Rapid identification by PCR of the genus Campylobacter and of five Campylobacter species enteropathogenic for man and animals. Res Microbiol, 1996; 147:707–718.

15.

Linton

, Lawson

, Owen

, Stanley

. PCR detection, identification to species level, and fingerprinting of Campylobacter jejuni and Campylobacter coli direct from diarrheic samples. J Clin Microbiol, 1997; 35:2568–2572.

16.

Logan

, Burnens

, Linton

, Lawson

, Stanley

. Campylobacter lanienae sp. nov., a new species isolated from workers in an abattoir. Int J Syst Evol Microbiol, 2000; 2:865–872.

17.

Martinez

, Mateo

, Churruca

, Girbau

, Alonso

, Fernández-Astorga

. Detection of CDTA, CDTB, and CDTC genes in Campylobacter jejuni by multiplex PCR. Int J Med Microbiol, 2006; 296:45–48.

18.

Matsuda

, Moore

. The epidemiology and zoonotic transmission of thermophilic Campylobacter lari. Br Microbiol Res J, 2011; 1:104–121.

19.

Monteville

, Yoon

, Konkel

. Maximal adherence and invasion of INT 407 cells by Campylobacter jejuni requires the CadF outer-membrane protein and microfilament reorganization. Microbiology, 2003; 149:153–165.

20.

Müller

, Schulze

, Müller

, Hänel

. PCR detection of virulence-associated genes in Campylobacter jejuni strains with differential ability to invade Caco-2 cells and to colonize the chick gut. Vet Microbiol, 2006; 113:123–129.

21.

Nachamkin

, Yang

, Stern

. Role of Campylobacter jejuni flagella as colonization factors for three-day-old chicks: Analysis with flagellar mutants. Appl Environ Microbiol, 1993; 59:1269–1273.

22.

Nakajima

, Hirayama

, Tazumi

, Hayashi

, Tasaki

, Asakura

, Yamasaki

, Moore

, Millar

, Matsuda

. Comparative analysis of Campylobacter lari cytolethal distending toxin (CDT) effect on HeLa cells. J Basic Microbiol, 2012; 52:559–565.

23.

Newell

, Pearson

. The invasion of epithelial cell lines and the intestinal epithelium of infant mice by Campylobacter jejuni/coli. J Diarrhoeal Dis Res, 1984; 2:19–26.

24.

Oporto

, Hurtado

. Emerging thermotolerant Campylobacter species in healthy ruminants and swine. Foodborne Pathog Dis, 2011; 8:807–813.

25.

Pickett

, Cottle

, Pesci

, Bikah

. Cloning, sequencing, and expression of the Escherichia coli cytolethal distending toxingenes. Infect Immun, 1994; 62:1046–1051.

26.

Pickett

, Pesci

, Cottle

, Russell

, Erdem

, Zeytin

. Prevalence of cytolethal distending toxin production in Campylobacter jejuni and relatedness of Campylobacter sp. cdtB gene. Infect Immun, 1996; 64:2070–2078.

27.

Quertz

, Lima

, Havt

, Prata

, Cavalcante

, Medeiros

, Cid

, Moraes

, Rey

, Soares

, Mota

, Weigl

, Guerrant

, Lima

. Campylobacter jejuni infection and virulence-associated genes in children with moderate to severe diarrhoea admitted to emergency rooms in northeastern Brazil. J Med Microbiol, 2012; 61:507–513.

28.

Ripabelli

, Tamburro

, Minelli

, Leone

, Sammarco

. Prevalence of virulence-associated genes and cytolethal distending toxin production in Campylobacter spp. isolated in Italy. Comp Immunol Microbiol Infect Dis, 2010; 33:355–364.

29.

Rozynek

, Dzierzanowska-Fangrat

, Jozwiak

, Popowski

, Korsak

, Dzierzanowska

. Prevalence of potential virulence markers in Polish Campylobacter jejuni and Campylobacter coli isolates obtained from hospitalized children and from chicken carcasses. J Med Microbiol, 2005; 54:615–619.

30.

Stanley

, Wallace

, Currie

, Diggle

, Jones

. The seasonal variation of thermophilic campylobacters in beef cattle, dairy cattle and calves. J Appl Microbiol, 1998; 85:472–480.

31.

Talukder

, Aslam

, Islam

, Azmi

, Dutta

, Hossain

, Nur-E-Kamal

, Nair

, Cravioto

, Sack

, Endtz

. Prevalence of virulence genes and cytolethal distending toxin production in Campylobacter jejuni isolates from diarrheal patients in Bangladesh. J Clin Microbiol, 2008; 46:1485–1488.

32.

Wassenaar

. Toxin Production by Campylobacter spp. Rev Clin Microbiol, 1997; 10:466–476.

33.

Ziprin

, Young

, Stanker

, Hume

, Konkel

. The absence of cecal colonization of chicks by a mutant of Campylobacter jejuni not expressing bacterial fibronectin-binding protein. Avian Dis, 1999; 43:586–589.