Phenotypic and Genotypic Characterization of Salmonella enterica Serovar Enteritidis Isolates Associated with a Mousse Cake–Related Outbreak of Gastroenteritis in Ningbo,China

Abstract

Salmonella enterica subsp. enterica serovar Enteritidis (Salmonella Enteritidis) is a major pathogen responsible for causing the largest number of sporadic cases and outbreaks of human salmonellosis worldwide. In this study, an outbreak of Salmonella Enteritidis involving 112 cases in Ningbo, China was investigated with a combination of genotypic subtyping methods and phenotypic analysis. The pulsed-field gel electrophoresis and multilocus variable-number tandem-repeat analysis profiles showed that most of the outbreak clinical isolates (22/23) were indistinguishable from each other and were identical to the isolates obtained from implicated mousse cakes, demonstrating that this outbreak of gastroenteritis was caused by Salmonella Enteritidis–contaminated mousse cakes. Moreover, all isolates, irrespective of source, had an identical antibiotic susceptibility pattern. Five virulence-associated genes in Salmonella pathogenicity islands and the plasmid-associated virulence genes spvB/C were present in both the food and clinical isolates. Importantly, all of these isolates can survive well under low-temperature treatment, indicating that manufacturers of foodstuffs with raw ingredients (not subjected to thermal processing) should use an effective approach to prevent or eliminate the microbial hazards to public health.

Introduction

S almonella enterica serovar Enteritidis (Salmonella Enteritidis) has been regarded as the world's leading cause of salmonellosis since the mid-1980s (Ward et al., 2000). Recent surveillance reports from China also documented Salmonella Enteritidis as the first or the second most frequently isolated Salmonella serovar (Xia et al., 2009; Yang et al., 2010; Ke et al., 2014; Lu et al., 2014). Salmonella Enteritidis generally causes human illness with typical symptoms including fever, vomiting, diarrhea, and abdominal cramps within 12–72 h after ingestion of contaminated food (CDC, 2010). However, only 3% of Salmonella-related foodborne disease is confirmed and reported to surveillance systems (Niehaus et al., 2011). On May 30, 2013, 96 patients from the same company in Ningbo, China acquired gastroenteritis and sought medical advice in local hospitals. On the same day, 16 children of a kindergarten were also infected. The kindergartners consumed the identical batch of mousse cakes from the same food factory as the 96 company workers did. All the isolates from the outbreak had been previously identified as Salmonella Enteritidis (1, 9, 12: g, m: -) in our laboratory by traditional serotyping (unpublished data). Similar outbreaks caused by Salmonella Enteritidis have been reported in diverse foods, such as chicken with harusame noodles (Tokuzaki and Takahashi, 2007), eggs (Kilic et al., 2010; Liu et al., 2012), and salad (Mertens et al., 2013). A combination of phenotypic analysis and genotypic subtyping methods were employed in the epidemiological investigations of these outbreaks.

In this study, all isolates from this outbreak were subtyped by pulsed-field gel electrophoresis (PFGE) and multilocus variable-number tandem-repeat analysis (MLVA), to track and to confirm that this outbreak was associated with contaminated mousse cakes. Since shaping in the refrigerator instead of traditional baking is used during the production of mousse cakes, cold tolerance of these isolates may have been a contributing factor in this outbreak, allowing the organism to persist or grow to infectious levels. Therefore, low-temperature stress tolerance was determined in this study. Also, these isolates were tested for their antibiotic resistance, virulence genes, and plasmid replicon types, to identify the pathogenic factors and potential hazards of this outbreak-associated Salmonella Enteritidis.

Materials and Methods

Salmonella Enteritidis isolates

A total of 31 Salmonella Enteritidis strains were isolated from a mousse cake–related outbreak that occurred from May 30 to June 1, 2013 in Ningbo, China. The strain associated with this outbreak consisted of 8 isolates from implicated mousse cakes (essential ingredients: eggs, butter, sugar, cream, and other flavorings; key production process: all the ingredients are mixed well and shaped in the refrigerator for at least 8 h; storage recommendations: 0–4°C for 1–2 d), and 23 isolates from 23 patients among the 112 cases who ate these cakes in the period of the outbreak and showed clinical symptoms of gastroenteritis (Table 1). It was noted that the positive rate of Salmonella Enteritidis detection among these 112 patients was only 80% because some patients had taken medicine before sampling. Moreover, the patients were sent to different hospitals, some of which failed to keep all the samples. Therefore, only 23 clinical isolates were obtained for subsequent study.

Table 1.

Sources, Virulence Genes Detection, and Survival Rates Associated with the Outbreak Set of Salmonella Enteritidis Isolates

		Virulence-associated genes						Virulence-associated genes
Strain no.	Source	invH/sopE/rhuM/spi4H/ttrB	spvB/C	Replicon plasmids	Survival rate at −20°C	Strain no.	Source	invH/sopE/rhuM/spi4H/ttrB	spvB/C	Replicon plasmids	Survival rate at −20°C
SJTUF11240	Stool	+	+	ColE/IncFIIA	15.76±1.39%^a	SJTUF11256	Stool	+	+	ColE/IncFIIA	18.61±1.32%^a
SJTUF11241	Stool	+	+	ColE/IncFIIA	16.05±1.36%^a	SJTUF11257	Stool	+	+	ColE/IncFIIA	26.84±1.02%^a
SJTUF11242	Stool	+	+	ColE/IncFIIA	20.02±0.34%^a	SJTUF11258	Stool	+	+	ColE/IncFIIA	26.14±0.79%^a
SJTUF11243	Stool	+	+	ColE/IncFIIA	20.98±0.75%^a	SJTUF11259	Stool	+	+	ColE/IncFIIA	28.74±0.66%^a
SJTUF11244	Stool	+	+	ColE/IncFIIA	16.38±0.55%^a	SJTUF11260	Stool	+	+	ColE/IncFIIA	15.30±0.92%^a
SJTUF11245	Stool	+	+	ColE/IncFIIA	16.74±0.35%^a	SJTUF11261	Stool	+	+	ColE/IncFIIA	22.95±0.37%^a
SJTUF11246	Stool	+	+	ColE/IncFIIA	15.49±0.74%^a	SJTUF11262	Stool	+	–	ColE	22.55±0.13%^a
SJTUF11247	Stool	+	+	ColE/IncFIIA	16.67±0.53%^a	SJTUF11263	Stool	+	+	ColE/IncFIIA	22.25±0.27%^a
SJTUF11248	Cake	+	+	ColE/IncFIIA	22.51±0.58%^a	SJTUF11264	Stool	+	+	ColE/IncFIIA	10.01±1.21%^a
SJTUF11249	Cake	+	+	ColE/IncFIIA	20.05±0.84%^a	SJTUF11265	Cake	+	+	ColE/IncFIIA	17.03±0.86%^a
SJTUF11250	Cake	+	+	ColE/IncFIIA	19.52±1.52%^a	SJTUF11266	Cake	+	+	ColE/IncFIIA	11.89±0.10%^a
SJTUF11251	Cake	+	+	ColE/IncFIIA	13.58±0.02%^a	SJTUF11267	Stool	+	+	ColE/IncFIIA	18.22±0.47%^a
SJTUF11252	Cake	+	+	ColE/IncFIIA	15.04±1.66%^a	SJTUF11268	Stool	+	+	ColE/IncFIIA	17.35±0.25%^a
SJTUF11253	Cake	+	+	ColE/IncFIIA	15.7±0.36%^a	SJTUF11269	Stool	+	+	ColE/IncFIIA	21.40±0.44%^a
SJTUF11254	Stool	+	+	ColE/IncFIIA	20.74±0.32%^a	SJTUF11270	Stool	+	+	ColE/IncFIIA	26.25±1.71%^a
SJTUF11255	Stool	+	+	ColE/IncFIIA	23.11±0.39%^a	ATCC13076		ND	ND	ND	3.40±0.14%

Significantly different from the survival rate of Salmonella Enteritidis reference strain ATCC 13076 as determined by Dunnett's test (p<0.05).

ND, not detected; +, positive result; –, negative result.

Antimicrobial susceptibility testing

Antimicrobial susceptibility was evaluated using the disk-diffusion method according to the criteria established by the Clinical and Laboratory Standards Institute (CLSI, 2013). The following antimicrobial agents, which represent five common types of antibiotics used to inhibit or inactivate Salmonella Enteritidis, were tested: chloramphenicol (30 μg), gentamicin (10 μg), kanamycin (30 μg), doxycycline (30 μg), norfloxacin (10 μg), nalidixic acid (30 μg), ceftazidime (30 μg), ciprofloxacin (5 μg), and trimethoprim–sulfamethoxazole (1.25/23.75 μg). Escherichia coli ATCC 25922 with known antibiotic susceptibility was used as a control strain.

Resistance to low-temperature stress

To determine the survival of a total of 31 Salmonella Enteritidis isolates at low temperature (–20°C and 4°C), the method described by Huang et al. (2013) was followed with minor modifications. Briefly, 0.1 mL of each overnight culture was inoculated into a 15-mL flask containing 10-mL precooled (4°C) Luria-Bertani (LB) medium (Oxoid, Cambridge, UK) at an initial population of ≈10⁶ colony-forming units/mL. Bacteria were then stored at −20°C for 24 h. The viability of the samples was then determined by plate count. Before the viability test, the frozen samples were pre-incubated to dissolve for subsequent sampling at 37°C for 5 min. Similarly, 0.1 mL of each overnight culture was inoculated into 10 mL of phosphate-buffered saline (Shanghai Lingfeng Chemical Reagent Co. Ltd., China) and stored at 4°C for 72 h. Samples were taken to determine viability using the plate-count method. The Salmonella Enteritidis reference strain ATCC 13076 was used as a control strain. All the tests were done in triplicate. The data were analyzed by SAS Version 8.0 via one-way analysis of variance. Comparison of mean values was processed by Dunnett's test. Significance was defined when p<0.05.

PFGE assay

A total of 31 Salmonella Enteritidis isolates were genotyped by PFGE using the PulseNet protocol (Ribot et al., 2006). Briefly, 0.5 mL of each overnight culture was embedded in an agarose block, lysed, and the intact genomic DNA was digested by the restriction enzyme XbaI (Takara, Japan). These blocks were loaded into the wells of a 1% agarose gel (Lonza, ME). Electrophoresis was performed in 0.5×Tris-borate-EDTA buffer for 18 h in a CHEF DR-III (Bio-Rad, Hercules, CA) under pulsed times of 2.2 to 63.8 s. XbaI-digested Salmonella Braenderup strain H9812 DNA was used as reference DNA marker.

MLVA

Extraction of DNA, the polymerase chain reaction (PCR) system, and PCR cycling were conducted according to the method described by Lindstedt et al. (2004). PCR primers for seven variable-number of tandem repeats (VNTR) were previously described in the Laboratory Standard Operating Procedure for PulseNet MLVA (http://www.pulsenetinternational.org/assets/Uploads/PNL28-MLVA-ABI-3500-Protocol.pdf). MLVA results are shown with a string of seven numbers (VNTR1-VNTR2-VNTR8-VNTR6-VNTR9-VNTR3-VNTR5).

Plasmid extraction and plasmid replicon typing

The Salmonella Enteritidis isolates were grown overnight in 5 mL LB medium (Oxoid) at 37°C with 200 rpm shaking. Plasmid DNAs were extracted by an alkaline lysis method (Feliciello and Chinali, 1993) and separated by electrophoresis on a 0.8% agarose gel with 1×Tris-acetate-EDTA buffer. In addition, plasmid replicon typing was examined by PCR assays with six singleplex primer pairs (Table 2) for six replicon types, including FIIA (FIIS), H1, L/M, ColE, IncU, and IncR.

Table 2.

Polymerase Chain Reaction Primers Used in This Study

Gene	Primer sequence (5′-3′)	Product size (bp)	Reference	Use
invH	AGCAACTGGCCAACGCAAAT	153	Zou et al., 2011	Amplification of virulence-associated genes in Salmonella
	TGCAGTCTTTCATGGGCAGCAA
sopE	ATTGTTGTGGCGTTGGCATCGT	186
	AATGCGAGTAAAGATCCGGCCT
rhuM	CATCGGCTGTACCCGACTAT	222
	CAGCACGCTGATGAATGAGT
spi4H	CGCTGACGGTCGTTATCG	154	Courtney et al., 2006
	TCAATGCTCAGACGGACTTC
ttrB	ATGTGGACGGGAGTCAATATGG	608
	GTGGCGATGCGGCTATGG
spvC	ACTCCTTGCACAACCAAATGCGGA	571	Karasova et al., 2009
	TGTCTCTGCATTTCGCCACCATCA
spvB	CGGTTATAGAAGAGCTCCTGT	434
	CCGGTATACGACTCTGTGATC
oricolE	GTTCGTGCATACAGTCCA	187	Garcia-Fernandez et al., 2009	ColE plasmids
	GGCGAAACCCGACAGGAC
IncR	TCGCTTCATTCCTGCTTCAGC	251		IncR plasmids
	GTGTGCTGTGGTTATGCCTCA
IncU	TCACGACACAAGCGCAAGGG	843		IncU plasmids
	TCATGGTACATCTGGGCGC
FIIA (FIIS)	CTGTCGTAAGCTGATGGC	270	Johnson et al., 2007	rep A
	CTCTGCCACAAACTTCAGC
H1	GGAGCGATGGATTACTTCAGTAC	471		par A-par B
	TGCCGTTTCACCTCGTGAGTA
L/M	GGATGAAAACTATCAGCATCTGAAG	785		rep A, B, C
	CTGCAGGGGCGATTCTTTAGG

PCR detection of virulence-associated genes

All the isolates were tested for the presence of virulence-associated genes using the primers listed in Table 2. The genomic DNAs of a total of 31 Salmonella Enteritidis isolates were extracted according to the method described by Liu et al. (2011). All the simplex PCR assays were carried out in 25-μL volumes: 2.5 μL of PCR buffer (10×, free Mg²⁺), 2.0 μL of MgCl₂ (25 mM), 2.0 μL of dNTP (2.5 mM), 0.5 μL of each primer set (10 μM), 1.0 μL of Taq DNA polymerase (1 U/μL, Fermentas, Thermo Fisher Scientific, Lithuania), and 100 ng of template DNA. The PCR cycling was the same for all of the gene targets, consisting of an initial denaturation of 95°C for 3 min, 35 cycles of 94°C for 20 s, 58°C for 20 s, and 72°C for 30 s, with a final extension at 72°C for 5 min. Amplification products were analyzed by electrophoresis in 1.5% agarose gel, stained with ethidium bromide, and visualized under ultraviolet light.

Results

Most of the isolates (30/31) had the same PFGE pattern consisting of 13 bands, while 1 clinical isolate (SJTUF11262) was missing the approximately 55-kb band (Fig. 1). The PFGE fingerprint analysis showed that the isolates from most of the clinical (stool) samples (22/23) and all the mousse-cake samples were the same. Moreover, all of the isolates from this outbreak shared the same MLVA profile: 4-4-1-10-3-3-11. These highly similar PFGE patterns, together with the identical MLVA profile, suggest that this outbreak of gastroenteritis was caused by mousse cakes contaminated with Salmonella Enteritidis.

FIG. 1.

Pulsed-field gel electrophoresis fingerprints of selected Salmonella Enteritidis isolates. M, Salmonella Braenderup strain H9812; Lanes 1–8, Salmonella Enteritidis food isolates (SJTUF11248-SJTUF11253; SJTUF11265, SJTUF11266); Lanes 9–16, Salmonella Enteritidis clinical strains (SJTUF11241-SJTUF11244; SJTUF11261-SJTUF11263).

All stool isolates and food isolates had the same antibiotic susceptibility pattern. They were susceptible to all the drugs tested. Meanwhile, no differences were found in the growth rates in LB medium or LB supplemented with 20% sucrose (the typical sucrose concentration in mousse cakes) and motility of these isolates (data not shown). After 24-h freezing treatment, the survival rates of these Salmonella Enteritidis isolates were approximately between 10% and 30% (Table 1), meaning that the population of all these isolates was reduced by <1 log after freezing (–20°C). Moreover, the isolates displayed more resistance (p<0.05) to low temperature than the Salmonella Enteritidis reference strain ATCC 13076, which demonstrated an approximate 3.4% survival rate (Table 1). After refrigeration storage (4°C for 72 h, the general time period between manufacture and consumption of mousse cakes), the survival rates of these Salmonella Enteritidis isolates exhibited no significant (p>0.05) population reduction (data not shown).

Large plasmids were present in all of the Salmonella Enteritidis isolates except for the clinical isolate SJTUF11262 (selected strains are shown in Fig. 2). The results of replicon typing showed that all isolates carried a ColE plasmid (Table 1). All of the isolates also carried an IncFIIA incapability group plasmid except the clinical isolate SJTUF11262 (Fig. 3A and Table 1). Thus, the missing plasmid in clinical isolate SJTUF11262 probably belonged to the IncFIIA incapability group.

FIG. 2.

Plasmid analysis of selected Salmonella Enteritidis isolates. M, HindIII-digested λ DNA; Lanes 1–10, Salmonella Enteritidis strains SJTUF11241, SJTUF11243, SJTUF11247, SJTUF11255, SJTUF11258, SJTUF11262, SJTUF11263, SJTUF11264, SJTUF11266, SJTUF11268.

FIG. 3.

Polymerase chain reaction detection of (A) IncFIIA plasmid replicon, (B) spvB, and (C) spvC for selected Salmonella Enteritidis isolates. M1, DL2000 DNA marker; M2, 100-bp DNA marker; –, Negative control; Lanes 1–8: Salmonella Enteritidis food isolates (SJTUF11248-SJTUF11253; SJTUF11265, SJTUF11266); Lanes 9–15: Salmonella Enteritidis clinical isolates (SJTUF11241-SJTUF11244; SJTUF11261-SJTUF11263).

All isolates possessed invH (SPI-1), sopE (SPI-1), ttrB (SPI-2), rhuM (SPI-3), and spi4H (SPI-4) genes as revealed by PCR (Table 1). Most isolates (n=30, 96.8%) possessed the spvB and spvC genes, while clinical isolate SJTUF11262 lacked both the spvB and spvC genes (Table 1 and Fig. 3B and C).

Discussion

A number of factors may have contributed to the occurrence of this outbreak, including inappropriate manufacturing and storage processes, the use of contaminated ingredients, and cross-contamination by food handlers. A refrigeration or freezing treatment instead of baking is used during production and storage of mousse cake and its raw ingredients. Many reports show that raw ingredients such as eggs and poultry that are stored under refrigeration can be a serious food safety threat, because Salmonella outbreak isolates can survive very well under refrigeration and frozen storage (Pintar et al., 2007; Anderson et al., 2010; Pradhan et al., 2012). Also in the current study, the survival rates of these Salmonella Enteritidis isolates at the extremely low temperature treatment (freezing at −20°C) showed that they had greater cold tolerance than the reference strain ATCC 13076 (Table 1). After freezing, less than a 1-log decline of bacterial population was found in all of these isolates. Moreover, after storage at refrigerator temperatures (4°C) for 72 h, the bacterial population of these isolates remained almost unchanged (data not shown). Furthermore, short-term room temperature storage (at least 2 h) in the hands of the consumer was verified in this outbreak. These results suggest that mousse cake (a type of condensing dessert) manufacturers should make every effort to avoid introducing pathogenic bacteria such as Salmonella Enteritidis into their products because storage at room temperature by accident could give Salmonella Enteritidis an opportunity for logarithmic/secondary growth. In addition, it has been frequently reported that Salmonella Enteritidis infections are commonly associated with eggs (Patrick et al., 2004; Zhang et al., 2011). Eggs are indispensable ingredients for mousse cakes; moreover, raw eggs are generally used in cake making in China, and thus might have been the vehicle of infection for this outbreak. Unfortunately, implicated eggs were unavailable for further analysis because the processing site had been cleaned and the ingredients had been discarded. We cannot rule out the possibility of cross-contamination from one or more food handlers. Thus, mousse cake manufacturers should be educated to regard the risks of foodborne pathogenic bacteria during producing foods not subjected to thermal process. For example, pasteurized eggs should be used, raw products should be kept separate from the cooked ingredients, and all the food handlers should wash their hands after handling unprocessed ingredients.

Rapid methods for tracking of outbreak isolates are needed for food safety surveillance and clinical diagnosis. PCR-based methods have shown promise over the past few decades, which has had a revolutionary impact on the diagnosis and epidemiology of foodborne diseases. MLVA is a PCR-based subtyping method using seven multiplex primer panels for amplifying repeated sequences from seven different loci. An important advantage of MLVA used in outbreak studies is that the data can be obtained in a shorter amount of time (<24 h) than from methods such as PFGE. Moreover, the MLVA data can easily be shared among laboratories by a standardized allele string or MLVA type number. The MLVA type number acquired in this outbreak would be compared with that of other outbreaks to identify the prevalent MLVA type. In addition, PFGE (XbaI) analysis was performed and similar profiles were found for these isolates (Fig. 1). Although PFGE is currently the gold standard for subtyping of Salmonella Enteritidis, it requires skilled personnel, and it usually takes longer than 24 h to complete. Since MLVA is easier and faster than PFGE (Kurosawa et al., 2012), MLVA may be used as the preferable subtyping method. However, differences in plasmids cannot be displayed by MLVA, suggesting that a combination of two or more genotyping methods that rely on different parameters may be required to better distinguish among isolates in an outbreak.

In this study, all isolates harbored the SPI-related genes (Table 1), which are important virulence factors that help the pathogen in adhesion and invasion mechanisms. For example, SOP proteins (SOP A–E) serve as effector proteins (Wallis and Galyov, 2000; van Asten and van Dijk, 2005) that are involved in the pathogenesis of salmonellosis. In addition, the inv A–H gene products function during invasion of the intestinal mucosa (Fluit, 2005; Chuanchuen et al., 2010) and are important systemic infection-related factors of Salmonella. Moreover, some virulence genes are located on large virulence plasmids, such as pSTV that encodes the spv operon involved in bacterial replication in extraintestinal sites (Gebreyes et al., 2009; Hur et al., 2011). In addition, the spvB/C genes were observed in most of the isolates (Fig. 3 and Table 1). Taken together, the presence of these virulence or virulence-related genes suggests that these isolates could give rise to public health problems if they were dispersed in the general human population.

Bichler et al. (1994) demonstrated that the spvB/C genes are associated with a plasmid of 54–57 kb in Salmonella Enteritidis. In our study, most of the isolates carried an Inc/FIIA plasmid of this size. These results correlated with a previous study by Rychlik et al. (2006). It is puzzling that one clinical isolate (SJTUF 11262) did not carry this common 55-kb Inc/FIIA plasmid. Whether or not the loss of this plasmid (or spvB/C genes) could influence the infection or/and pathogenicity of this isolate needs further investigation.

Conclusions

Antimicrobial susceptibility testing and two genotyping schemes (MLVA and PFGE) were employed to examine the relatedness of the outbreak-associated clinical and food isolates. Phenotypic analysis data and subtyping results showed that this Salmonella Enteritidis outbreak in Ningbo (China) was caused by Salmonella Enteritidis–contaminated mousse cake. Furthermore, the possession of virulence-associated genes in these outbreak strains indicated that these isolates could cause infection in humans. This study provided further insights into the use and handling of raw ingredients during the manufacture of foods without thermal processing, as Salmonella Enteritidis can survive very well under refrigerated and frozen treatment and improper storage could support its survival and growth, which may be a serious food safety threat.

Footnotes

Acknowledgments

This research was supported by the National Natural Science Foundation of China (31230058) and the Ministry of Science and Technology of China (2012AA101601, 2012BAK17B10, and 2012BAD29B02).

Disclosure Statement

No competing financial interests exist.

References

Anderson

, Hume

, Byrd

, Hernandez

, Stevens

, Stringfellow

, Caldwell

. Molecular analysis of Salmonella serotypes at different stages of commercial turkey processing. Poult Sci, 2010; 89:2030–2037.

Bichler

, Nagaraja

, Pomeroy

. Plasmid diversity in Salmonella Enteritidis of animal, poultry and human origin. J Food Prot, 1994; 57:4–11.

[CDC] Centers for Disease Control and Prevention. Investigation Update: Multistate Outbreak of Human Salmonella Enteritidis Infections Associated with Shell Eggs. 2010. Available at: http://www.cdc.gov/salmonella/enteritidis/index.html, accessed December 3, 2013 .

Chuanchuen

, Ajariyakhajorn

, Koowatananukul

, Wannaprasat

, Khemtong

, Samngamnim

. Antimicrobial resistance and virulence genes in Salmonella enterica isolates from dairy cows. Foodborne Pathog Dis, 2010; 7:63–69.

[CLSI] Clinical and Laboratory Standards Institute. Performance Standards for Antimicrobial Disk and Dilution Susceptibility Tests; Twenty-Third Informational Supplement. Wayne, PA: CLSI, 2013.

Courtney

, Mossoba

, Hammack

, Keys

, Al-Khaldi

. Using PCR amplification to increase the confidence level of Salmonella typhimurium DNA microarray chip hybridization. Mol Cell Probes, 2006; 20:163–171.

Feliciello

, Chinali

. A modified alkaline lysis method for the preparation of highly purified plasmid DNA from Escherichia coli . Anal Biochem, 1993; 212:394–401.

Fluit

. Towards more virulent and antibiotic-resistant Salmonella?. FEMS Immunol Med Microbiol, 2005; 43:1–11.

García-Fernández

, Fortini

, Veldman

, Mevius

, Carattoli

. Characterization of plasmids harbouring qnrS1, qnrB2 and qnrB19 genes in Salmonella . J Antimicrob Chemother, 2009; 63:274–281.

10.

Gebreyes

, Thakur

, Dorr

, Tadesse

, Post

, Wolf

. Occurrence of spvA virulence gene and clinical significance for multidrug-resistant Salmonella strains. J Clin Microbiol, 2009; 47:777–780.

11.

Huang

, Cheng

, Yu

, Chou

. Effect of ethanol shock pretreatment on the tolerance of Cronobacter sakazakii BCRC 13988 exposed to subsequent lethal stresses. Foodborne Pathog Dis, 2013; 10:165–170.

12.

Hur

, Kim

, Park

, Lee

. Molecular and virulence characteristics of multi-drug resistant Salmonella Enteritidis strains isolated from poultry. Vet J, 2011; 189:306–311.

13.

Johnson

, Wannemuehler

, Johnson

, Logue

, White

, Doetkott

, Nolan

. Plasmid replicon typing of commensal and pathogenic Escherichia coli isolates. Appl Environ Microbiol, 2007; 73:1976–1983.

14.

Karasova

, Havlickova

, Sisak

, Rychlik

. Deletion of sodCI and spvBC in Salmonella enterica serovar Enteritidis reduced its virulence to the natural virulence of serovars Agona, Hadar and Infantis for mice but not for chickens early after infection. Vet Microbiol, 2009; 139:304–309.

15.

, Sun

, He

, Li

, Liang

, Ke

. Serovar distribution, antimicrobial resistance profiles, and PFGE typing of Salmonella enterica strains isolated from 2007–2012 in Guangdong, China. BMC Infect Dis, 2014; 14:338.

16.

Kilic

, Bedir

, Kocak

, Levent

, Eyigun

, Tekbas

, Gorenek

, Baylan

, Basustaoglu

. Analysis of an outbreak of Salmonella enteritidis by repetitive-sequence-based PCR and pulsed-field gel electrophoresis. Intern Med, 2010; 49:31–36.

17.

Kurosawa

, Imamura

, Tanaka

, Tamamura

, Uchida

, Kobayashi

, Hata

, Kanno

, Akiba

, Yukawa

, Tamura

. Molecular typing of Salmonella enterica serotype Typhimurium and serotype 4,5,12:i:- isolates from cattle by multiple-locus variable-number tandem-repeats analysis. Vet Microbiol, 2012; 160:264–268.

18.

Lindstedt

, Vardund

, Aas

, Kapperud

. Multiple-locus variable-number tandem-repeats analysis of Salmonella enterica subsp. enterica serovar Typhimurium using PCR multiplexing and multicolor capillary electrophoresis. J Microbiol Methods, 2004; 59:163–172.

19.

Liu

, Zhang

, Zhu

, Shi

, Chen

, Liu

, He

, Shi

. PCR identification of Salmonella serogroups based on specific targets obtained by comparative genomics. Int J Food Microbiol, 2011; 144:511–518.

20.

Liu

, Schmid

, Voss

, Kasper

, Lassnig

, Ableitner

, Kornschober

, Karnthaler

, Allerberger

. A 2010 Austrian Salmonella enteritidis PT4 outbreak associated with a laying hen holding previously involved in an S. enteritidis PT4 cluster: Pitfalls of regulatory responses in risk management. J Infect Public Health, 2012; 5:332–339.

21.

, Zhao

, Sun

, Liu

, Zhou

, Beier

, Wu

, Hou

. Characterization of multidrug-resistant Salmonella enterica serovars Indiana and Enteritidis from chickens in Eastern China. PLoS ONE, 2014; 9:e96050.

22.

Mertens

, Kreher

, Rabsch

, Bornhofen

, Alpers

, Burckhardt

. Severe infections caused by Salmonella Enteritidis PT8/7 linked to a private barbecue. Epidemiol Infect, 2013; 141:277–283.

23.

Niehaus

, Apalata

, Coovadia

, Smith

, Moodley

. An outbreak of foodborne salmonellosis in rural KwaZulu-Natal, South Africa. Foodborne Pathog Dis, 2011; 8:693–697.

24.

Patrick

, Adcock

, Gomez

, Altekruse

, Holland

, Tauxe

. Salmonella Enteritidis infections, United States, 1985–1999. Emerg Infect Dis, 2004; 10:1–7.

25.

Pintar

, Cook

, Pollari

, Ravel

, Lee

, Odumeru

. Quantitative effect of refrigerated storage time on the enumeration of Campylobacter, Listeria, and Salmonella on artificially inoculated raw chicken meat. J Food Prot, 2007; 70:739–743.

26.

Pradhan

, Li

, Kelso

, Costello

, Johnson

. A modified Weibull model for growth and survival of Listeria innocua and Salmonella Typhimurium in chicken breasts during refrigerated and frozen storage. Poult Sci, 2012; 91:1482–1488.

27.

Ribot

, Fair

, Gautom

, Cameron

, Hunter

, Swaminathan

, Barrett

. Standardization of pulsed field gel electrophoresis protocols for the subtyping of Escherichia coli O157:H7, Salmonella, and Shigella for PulseNet. Foodborne Pathog Dis, 2006; 3:59–67.

28.

Rychlik

, Gregorova

, Hradecka

. Distribution and function of plasmids in Salmonella enterica . Vet Microbiol, 2006; 112:1–10.

29.

Tokuzaki

, Takahashi

. An outbreak of nalidixic acid-resistant Salmonella enterica serovar Enteritidis at a nursery school in Kitakyushu City, Japan. Jpn J Infect Dis, 2007; 60:62–63.

30.

van Asten

, van Dijk

. Distribution of “classic” virulence factors among Salmonella spp. FEMS Immunol Med Microbiol, 2005; 44:251–259.

31.

Wallis

, Galyov

. Molecular basis of Salmonella-induced enteritis. Mol Microbiol, 2000; 36:997–1005.

32.

Ward

, Threlfall

, Smith

, O'Brien

. Salmonella enteritidis epidemic. Science, 2000; 287:1753–1754.

33.

Xia

, Hendriksen

, Xie

, Huang

, Zhang

, Guo

, Xu

, Ran

, Aarestrup

. Molecular characterization and antimicrobial susceptibility of Salmonella isolates from infections in humans in Henan Province, China. J Clin Microbiol, 2009; 47:401–409.

34.

Yang

, Qu

, Zhang

, Shen

, Cui

, Shi

, Xi

, Sheng

, Zhi

, Meng

. Prevalence and characterization of Salmonella serovars in retail meats of marketplace in Shaanxi, China. Int J Food Microbiol, 2010; 141:63–72.

35.

Zhang

, Zheng

, Xu

. Toward better control of Salmonella contamination by taking advantage of the egg's self-defense system: A review. J Food Sci, 2011; 76:76–81.

36.

Zou

, Al-Khaldi

, Branham

, Han

, Fuscoe

, Han

, Foley

, Xu

, Fang

, Cerniglia

, Nayak

. Microarray analysis of virulence gene profiles in Salmonella serovars from food/food animal environment. J Infect Dev Ctries, 2011; 5:94–105.