Evaluation of Enterococcus spp. from Rainbow Trout ( Oncorhynchus mykiss,Walbaum),Feed,and Rearing Environment Against Fish Pathogens

Abstract

The use of lactic acid bacteria of aquatic origin as probiotics constitutes an alternative strategy to the antibiotic treatment for disease control in aquaculture. Enterococci are currently used as probiotics in human and animal health. In this study, we evaluated the safety of 64 enterococci isolated from rainbow trout (Oncorhynchus mykiss, Walbaum), feed and rearing environment, and their antimicrobial activity against 9 fish pathogens. The 64 enterococcal isolates were identified to the species level by polymerase chain reaction (PCR), using specific primers for the different enterococcal species, and confirmed by superoxide dismutase gene sequencing. Enterococcus faecium and E. hirae were the most common species (42.2 and 35.9%, respectively). A total of 48 isolates (75%) showed phenotypic resistance to at least 1 antibiotic determined by a disk-diffusion method, and 25 isolates (39.1%) harbored at least 1 antibiotic resistance gene [erm(B), tet(M), tet(S), tet(K), tet(L), tet(T), vanC2, and aad(E)], detected by PCR. One (1.6%) isolate produced gelatinase and none produced hemolysin, using a plate assay. The virulence genes gelE (46.9%), efaAfs (17.2%), agg (1.6%), and hyl (1.6%) were detected by PCR. A total of 48 isolates (75%) exerted antimicrobial activity against 1 or more of the tested fish pathogens, using a stab-on-agar test. From these isolates, 21 (43.8%) harbored at least 1 bacteriocin-encoding gene (entP, entL50A and entL50B, hirJM79, entSE-K4, entQ and entA), detected by PCR. None of the enterococci showed bile deconjugation and mucin degradation abilities. A total of 17 enterococcal isolates (26.6%) that did not harbor any antibiotic resistance or virulence factor were considered safe for application as probiotics, including 6 isolates (35.3%) that showed antimicrobial activity against at least 1 fish pathogen and harbored at least 1 bacteriocin-encoding gene. Rainbow trout, feed, and rearing environment constitute an appropriate source for the isolation of enterococci as potential probiotic for aquaculture.

Introduction

In recent years, aquaculture activity has expanded, becoming the fastest-growing food-producing sector worldwide; however, the emergence of a large variety of pathogens represents a significant limitation to the development of modern aquaculture (Bostock et al., 2010; Defoirdt et al., 2011). In order to prevent and control fish diseases, the use of veterinary drugs, especially antibiotics, has increased in the last few years (Mohapatra et al., 2012). The massive use of antibiotics enhanced the antibiotic resistance among pathogenic bacteria due to point mutations in the indigenous genes and to acquired and transmissible mechanisms of resistance, such as horizontal transfer of resistance genes (Cabello, 2006; Yousefian and Amiri, 2009). Moreover, vaccination cannot prevent disease outbreaks in immunologically immature individuals, and effective commercial vaccines against some fish pathogens are not yet available (Defoirdt et al., 2007). In this sense, the use of probiotics emerges as a serious alternative not only to prevent fish pathologies, but also to improve animal productivity and food quality and safety (Verschuere et al., 2000; Ringø et al., 2010; Defoirdt et al., 2011).

Enterococci, found naturally in food products, are considered normal human and animal commensals (Gaggìa et al., 2010). These microorganisms are used as (1) starter cultures in food products, such as cheese; (2) probiotic cultures for humans and animals; and (3) silage additives (Foulquié Moreno et al., 2006). As probiotic cultures, enterococci have been used in humans to (1) treat diarrhea, including antibiotic-associated diarrhea, and irritable bowel syndrome; (2) reduce the level of cholesterol in serum; and (3) modulate the immune response (Franz et al., 2011). Furthermore, enterococci cultures have been used as animal feed in slaughter animals (Franz et al., 2011). The enterococcal strains used currently as probiotics are Enterococcus faecium SF68^® (NCIMB 10415, produced by Cerbios-Pharma SA, Barbengo, Switzerland) and E. faecalis Symbioflor 1 (SymbioPharm, Herborn, Germany) (Franz et al., 2011). Nevertheless, the use of enterococci as probiotics remains a controversial issue due to the association of these bacteria with nosocomial infections and multiple antibiotic resistances (Gaggìa et al., 2010). According to the European Food Safety Authority (EFSA), the only safety qualification required for strains belonging to lactic acid bacteria (LAB) species regarded with the Qualified Presumption of Safety intended for use in animal feeding is the demonstration of the absence of acquired transmissible antibiotic resistance (EFSA, 2011). However, in the case of enterococci, a more meticulous, strain-specific evaluation is required to evaluate the risk associated with their use in the food chain (EFSA, 2012).

An interesting property enterococci must have to be considered as probiotic is the capability to produce bacteriocins (often termed as enterocins), which are small, ribosomally synthesized, extracellular, and heat-stable peptides, with antimicrobial activity against Gram-positive and Gram-negative bacteria (Cintas et al., 2001). According to Franz et al. (2007), enterocins can be categorized into four classes: (1) lantibiotic enterocins (Class I); (2) small, nonlantibiotic enterocins (Class II); (3) cyclic enterocins (Class III); and (4) large proteins (Class IV). Most enterocins identified were included in Class II (small, nonlantibiotic peptides), which was divided into three subgroups: class II.1, pediocin-like bacteriocins (including, among others, enterocin A [EntA], enterocin P [EntP], enterocin SE-K4 [EntSe-K4], and hiracin JM79 [HirJM79]); class II.2, enterocins synthesized without a leader peptide (enterocin L50 [EntL50A and EntL50B] and enterocin Q [EntQ]); and class II.3, other linear, non–pediocin-like enterocins (enterocin B [EntB]).

The objectives of this study were (1) the in vitro safety assessment of 64 Enterococcus spp. isolated from rainbow trout intestine, feed, and rearing environment; and (2) the evaluation of their antimicrobial activity against the main Gram-negative and Gram-positive fish pathogens.

Materials and Methods

Samples and bacterial isolates

The samples used in this study were obtained from a rainbow trout farm located in the south of Spain, and sampling procedures were previously described (Araújo et al., 2015). A total of 64 enterococci were isolated from independent composite samples from (1) the whole intestine of aquacultured rainbow trout (six pools composed of three specimens); (2) feed (four pools composed of three samples); and (3) rearing environment (tank vegetation [algae; seven pools composed of three samples] and tank water [seven pools composed of three samples]). Samples were 10-fold diluted in sterile peptone water (Oxoid, Ltd., Basingstoke, UK) and homogenized in a stomacher. Then, samples were diluted and plated in Slanetz-Bartley agar (Oxoid) and incubated at 35°C for 48 h (3 plates per dilution). Colonies with typical enterococcal characteristics were subjected to Gram stain, the catalase test, and the bile–aesculin reaction (BioMérieux, La Palme, France).

Species identification

Species identification was carried out by polymerase chain reaction (PCR) using specific primers (Sigma-Genosys Ltd., Cambridge, UK) for the most common species of the genus Enterococcus (Torres et al., 2003). PCR amplifications were performed from total bacterial DNA obtained by the InstaGene Matrix resin (Bio-Rad Laboratories Inc., Hercules, CA) in 50-μL reaction mixtures with 5–50 ng of purified DNA, 0.7 μmol/L of each primer and 25 μL of MyTaq PCR mix (Bioline, London, UK). Samples were subjected to an initial cycle of denaturation (95°C for 1 min), followed by 35 cycles of denaturation (95°C for 15 s), annealing (46–65°C for 15 s) and elongation (72°C for 10 s), ending with an optional final extension step at 72°C for 5 min in an Eppendorf Mastercycler thermal cycler (Eppendorf, Hamburg, Germany). PCR products were analyzed by electrophoresis on 1.5% (wt/vol) agarose (Pronadisa, Madrid, Spain) gels stained with GelRed (Biotium, Hayward, CA) at 90 V for 45 min, and visualized with the Gel Doc 1000 documentation system (Bio-Rad). The molecular size markers used were the HyperLadder II (Bioline) and the 1Kb Plus DNA ladder (Invitrogen, Madrid, Spain). A second PCR, amplifying the superoxide dismutase (sodA) gene (Table 1), was performed in all the enterococcal isolates in order to confirm the taxonomical identification. The resulting PCR products were purified using the NucleoSpin Extract II kit (Macherey-Nagel GMBH & Co. KG, Düren, Germany) and sequenced at the Unidad de Genómica (Parque Científico de Madrid, Facultad de Ciencias Biológicas, Universidad Complutense de Madrid, Spain).

Table 1.

Oligonucleotide Primers Used in This Study

Target gene	Primer	5′–3′ sequence ^a	PCR fragment size (bp)	Annealing temperature (°C)	Reference
ddl_{E. faecalis}	ddl Enterococcus faecalis-F	ATCAAGTACAGTTAGTCT	941	54	Torres et al., 2003
	ddl E. faecalis-R	ACGATTCAAAGCTAACTG
ddl_{E. faecium}	ddl E. faecium-F	GCAAGGCTTCTTAGAGA	550	54	Torres et al., 2003
	ddl E. faecium-R	CATCGTGTAAGCTAACTTC
Enterococcus durans (mur2)	mur2-F	CGTCAGTACCCTTCTTTTGCAGAGTC	130	60	Torres et al., 2003
	mur2-R	GCATTATTACCAGTGTTAGTGGTTG
Enterococcus hirae (murG)	murG-F	GGCATATTTATCCAGCACTAG	521	60	Torres et al., 2003
	murG-R	CTCTGGATCAAGTCCATAAGTGG
sodA	d1	CCITAYICITAYGAYGCIYTIGARCC	480	50	Poyart et al., 2000
	d2	ARRTARTAIGCRTGYTCCCAIACRTC
aad(E)	aadEI	GCAGAACAGGATGAACGTATTCG	369	55	Klare et al., 2007
	aadEII	ATCAGTCGGAACTATGTCCC
cat(A)	CatpIP 501-1	GGATATGAAATTTATCCCTC	486	50	Aarestrup et al., 2000
	CatpIP 501-2	CAATCATCTACCCTATGAAT
erm(A)	A1	TCTAAAAAGCATGTAAAAGAA	645	52	Torres et al., 2003
	A2	CTTCGATAGTTTATTAATATTAGT
erm(B)	B1	GAAAAGGTACTCAACCAAATA	639	52	Torres et al., 2003
	B2	AGTAACGGTACTTAAATTGTTTAC
erm(C)	C1	TCAAAACATAATATAGATAAA	642	52	Torres et al., 2003
	C2	GCTAATATTGTTTAAATCGTCAAT
tetB(P)	TetB/P-FW	AAAACTTATTATATTATAGTG	169	46	Klare et al., 2007
	TetB/P-RV	TGGAGTATCAATAATATTCAC
tet(K)	tetKI	CAATACCTACGATATCTA	352	50	Klare et al., 2007
	tetKII	TTGAGCTGTCTTGGTTCA
tet(L)	tetLI	TGGTCCTATCTTCTACTCATTC	385	53	Klare et al., 2007
	tetLII	TTCCGATTTCGGCAGTAC
tet(M)	tetMI	GGTGAACATCATAGACACGC	401	45	Klare et al., 2007
	tetMII	CTTGTTCGAGTTCCAATGC
tet(O)	tetOI	AGCGTCAAAGGGGAATCACTATCC	1723	55	Klare et al., 2007
	tetOII	CGGCGGGGTTGGCAAATA
tet(Q)	TetQ-FW	AGAATCTGCTGTTTGCCAGTG	169	63	Klare et al., 2007
	TetQ-RV	CGGAGTGTCAATGATATTGCA
tet(S)	tetS-FW	ATCAAGATATTAAGGAC	573	55	Klare et al., 2007
	tetS-RV	TTCTCTATGTGGTAATC
tet(T)	TetT-FW	AAGGTTTATTATATAAAAGTG	169	46	Klare et al., 2007
	TetT-RV	AGGTGTATCTATGATATTTAC
tet(W)	tetWI	GGMCAYRTGGATTTYWTIGC	1187	64	Klare et al., 2007
	tetWII	TCIGMIGGIGTRCTIRCIGGRC
van(A)	VanA1	GGGAAAACGACAATTGC	732	54	Torres et al., 2003
	VanA2	GTACAATGCGGCCGTTA
van(B)	vanB-F	CAAAGCTCCGCAGCTTGCATG	484	58	Torres et al., 2003
	vanB-R	TGCATCCAAGCACCCGATATAC
vanC1	VANC1-1	GCTGAAATATGAAGTAATGACCA	811	58	Torres et al. 2003
	VANC1-2	CGGCATGGTGTTGATTTCGTT
vanC2	vanC2/3-1	CTCCTACGATTCTCTTG	439	54	Torres et al., 2003
	vanC2/3-2	CGAGCAAGACCTTTAAG
vat(A)	vatA-1	CAATGACCAT GGACCTGATC	619	52	Lina et al., 1999
	vatA-2	CTTCAGCATT TCGATATCTC
vat(B)	vatB-1	CCCTGATCCA AATAGCATAT ATCC	602	52	Lina et al., 1999
	vatB-2	CTAAATCAGA GCTACAAAGTG
agg	TE3	AAGAAAAAGAAGTAGACCAAC	1553	52	Muñoz-Atienza et al., 2013
	TE4	AAACGGCAAGACAAGTAAATA
cylLL–cylLS	cylLLSR1	GTGTTGAGGAAATGGAAGCG	324	60	Muñoz-Atienza et al., 2013
	cylLLSR2	TCTCAGCCTGAACATCTCCAC
cylLL–cylLS–cylM	RHCT1	GTACTAACAGAGAGTGC	2659	48	Muñoz-Atienza et al., 2013
	RHCT2	TAGGCATCTATTCAGAGC
efaAfs	TE5	GACAGACCCTCACGAATA	705	49	Muñoz-Atienza et al., 2013
	TE6	AGTTCATCATGCTGTAGTA
esp	TE34	TTGCTAATGCTAGTCCACGACC	933	64	Muñoz-Atienza et al., 2013
	TE36	GCGTCAACACTTGCATTGCCGAA
gelE	TE9	ACCCCGTATCATTGGTTT	419	57	Muñoz-Atienza et al., 2013
	TE10	ACGCATTGCTTTTCCATC
hyl	HYLn1	ACAGAAGAGCTGCAGGAAATG	276	58	Muñoz-Atienza et al., 2013
	HYLn2	GACTGACGTCCAAGTTTCCAA
IS16	IS16-F	CATGTTCCACGAACCAGAG	547	53	Werner et al., 2011
	IS16-R	TCAAAAAGTGGGCTTGGC
ef1097	EF1097-F3	GGCGATGGCATTACTAATGACATTAGG	408	65	Brandão et al., 2010
	EF1097-R3	CTTAGCCCACATTGAACTGCCCATAAAGC
ent1071A and ent1071B	CFr-1	ATAATTAGGGGGAACGATAA	403	51	Brandão et al., 2010
	CFr-2	ATACATTCTTCCACTTATTTTT
entA	EnterA-F	ATGAAACATTTAAAAATTTTGTCTATTAAAG	197	59	Brandão et al., 2010
	EnterA-R	TTAGCACTTCCCTGGAATTGCTCC
entB	EntB3	AGACCTAACAACTTATCTAAAG	126	50	Brandão et al., 2010
	EntB5	GTTGCATTTAGAGTATACATTTGC
entAS-48	AS48-R1	TCGGTATACCAGCAGCAGTT	125	59	Brandão et al., 2010
	AS48-R2	TGCTGCAGCGAGTAAAGAAA
entL	PCEL-F	CGATTTCTGTTGTAGGAACC	1770	51	Brandão et al., 2010
	PCEL-R	GTACATCTCCATATACTTTTCC
entL50A and entL50B	EntL50-R1	ATGGGAGCAATCGCAAAATTAGTAGC	286	65	Brandão et al., 2010
	EntL50-R2	TTAATGTCTTTTTAGCCATTTTTCAAT
entP	EntP1	ATGAGAAAAAAATTATTTAGTTTAGCTCTTATTGG	216	64	Brandão et al., 2010
	EntP2	TTAATGTCCCATACCTGCCAAACCAG
entqA	EntQ-R1	ATGAATTTTCTTAAAAATGGTATCGCAAAATG	105	57	Brandão et al., 2010
	EntQ-R2	TTAACAAGAAATTTTTTCCCATGGCAAG
entSE-K4	SEK4-FW	GCCACGTATTACGGAAATGGTGTC	146	53	Brandão et al., 2010
	SEK4-RV	TTATCTTCCACCTATACCACCTAACAC
hirJM79	HNZSC-FW	ATGAAAAAGAAAGTATTAAAACATTGTGTTATTCTAGG	250	61	Brandão et al., 2010
	HPJE-RV	ATAAGTTAAGCTTGTACTACCTTCTAGGTGCCCATGGACC

K=G or T; R=A or G; W=A or T; Y=C or T; S=C or G; M=A or C; D=A, G, or T; N=A, G, C, or T.

PCR, polymerase chain reaction.

Analysis of DNA sequences was performed with the BLAST program, available at the National Center for Biotechnology Information (http://blast.ncbi.nlm.nih.gov/Blast.cgi).

Antibiotic susceptibility

Susceptibility for 11 antimicrobial agents (ampicillin, chloramphenicol, ciprofloxacin, erythromycin, gentamicin, kanamycin, quinupristin–dalfopristin, streptomycin, teicoplanin, tetracycline, and vancomycin) was performed by the disk-diffusion method according to the criteria of the Clinical and Laboratory Standards Institute (CLSI, 2011). High-level resistance was evaluated for aminoglycosides. The microbiological breakpoints (in millimeters) categorizing enterococci as resistant to a given antibiotic are the following: ampicillin ≤16, chloramphenicol ≤12, ciprofloxacin ≤15, erythromycin ≤13, gentamicin ≤6, kanamycin ≤6, quinupristin–dalfopristin ≤15, streptomycin ≤6, teicoplanin ≤10, tetracycline ≤14, and vancomycin ≤14. E. faecalis ATCC 29212 and Staphylococcus aureus ATCC 25923 strains were used for quality control.

Gelatinase and hemolysin production

Gelatinase production was determined as previously described (Eaton and Gasson, 2001; Muñoz-Atienza et al., 2013). Briefly, cultures grown in de Man, Rogosa and Sharpe (MRS, Oxoid) broth were streaked onto Todd-Hewitt (Oxoid) agar plates (1.5%, wt/vol) containing 30 g of gelatin per liter. After overnight incubation at 37°C, the plates were placed at 4°C for 5 h before examination for the presence of zones of turbidity (protein hydrolysis) around the colonies. In both assays, E. faecalis P4 was used as positive control (Eaton and Gasson, 2001). Hemolysin production by the 64 Enterococcus spp. strains was determined as previously described (Eaton and Gasson, 2001; Muñoz-Atienza et al., 2013). Briefly, cultures grown in MRS broth were streaked onto layered fresh horse-blood agar plates (BioMérieux, Marcy l'Étoile, France). After plate incubation at 37°C for 1–2 d, β-hemolysin was revealed by the visualization of clear zones of hydrolysis around the colonies.

Bile salt deconjugation

The ability of the 64 Enterococcus spp. to deconjugate primary and secondary bile salts was evaluated according to Noriega et al. (2006). Bile salt plates were prepared by adding 0.5% (wt/vol) sodium salts of taurocholate and taurodeoxycholate (Sigma-Aldrich Corp., St. Louis, MO) to MRS agar (1.5%, wt/vol) supplemented with 0.05% (wt/vol) l-cysteine (Merck KGaA, Darmstadt, Germany). Briefly, 10 μL of cultures grown in MRS broth were spotted onto agar plates and incubated at 37°C for 72 h under anaerobic conditions (Anaerogen; Oxoid). The presence of precipitated bile acid around the spotted-culture (opaque halo) was considered a positive result. A fresh fecal slurry of a healthy adult cow was used as positive control.

Mucin degradation

The ability of the 64 Enterococcus spp. to degrade gastric mucin was determined according to Zhou et al. (2001). Mucin from porcine stomach type III (Sigma-Aldrich) and agar were incorporated to medium B without glucose at concentrations of 0.5 and 1.5% (wt/vol), respectively. Briefly, 10 μL of cultures grown in MRS broth were spotted onto the surface of medium B with mucin. The plates were incubated anaerobically (Anaerogen; Oxoid) at 37°C for 72 h. After incubation, the plates were stained with a mixture of 0.1% (wt/vol) amido black (Merck KGaA) in 3.5 mol/L acetic acid for 30 min, and then washed with 1.2 mol/L acetic acid (Merck KGaA). The presence of a discolored zone around the colony was considered a positive result. A fresh fecal slurry of a healthy adult cow was used as positive control.

Direct antimicrobial activity

The 64 Enterococcus spp. were assayed for antimicrobial activity by a stab-on-agar test as previously described by Cintas et al. (1995) against 9 fish pathogens (see below). Briefly, The 64 Enterococcus spp. were stabbed onto MRS agar and incubated at 37°C for 5 h, and then 40 mL of the corresponding soft agar (0.8% wt/vol) medium containing about 1×10⁵ colony-forming units/mL of the pathogen strain was poured onto the plates. After incubation at 28–37°C for 16–24 h, depending on the optimum growth conditions for each tested pathogen, the plates were checked for inhibition zones (absence of visible microbial growth around the stabbed cultures), and only inhibition halos with diameters >3 mm were considered positive (Muñoz-Atienza et al., 2013). The Gram-positive pathogens Lactococcus garvieae JIP29-99, L. garvieae CECT5807, L. garvieae CF01144, L. garvieae CF00021, and Carnobacterium maltaromaticum LMG14716 were aerobically grown in MRS broth at 30°C, while Streptococcus iniae LMG14521 was aerobically grown in brain–heart infusion broth (Oxoid) at 37°C. The Gram-negative pathogens Yersinia ruckeri LMG3279 and Aeromonas salmonicida LMG3776 were aerobically grown in tryptone soya broth (TSB) (Oxoid) at 28°C, while Vibrio campbellii LMG21363 was aerobically grown in TSB supplemented with NaCl (1% wt/vol; Panreac Química S.A.U., Barcelona, Spain) at 28°C. Lactococcus lactis BB24 (nisin A producer) and E. faecium L50 (EntL50A and EntL50B, and EntQ producer) were used as antimicrobial activity controls (Cintas et al., 1995; Brandão et al., 2010).

PCR detection of antibiotic resistance genes, virulence genes and markers, and bacteriocin structural genes

The presence of antibiotic resistance, virulence, and bacteriocin structural genes was performed by PCR amplification with primers and conditions described previously (Table 1). The presence of transferable genetic determinants conferring resistance to chloramphenicol [cat(A)], erythromycin [erm(A), erm(B), and erm(C)], quinupristin–dalfopristin [vat(D) and vat(E)], streptomycin [aad(E)], tetracycline [tetB(P), tet(K), tet(L), tet(M), tet(O), tet(Q), tet(S), tet(T), and tet(W)], and vancomycin [van(A), van(B), vanC1, and vanC2] was determined in the enterococcal isolates that showed antibiotic resistance by the disk-diffusion method. Furthermore, detection of genes encoding the virulence factors aggregation substance (agg), cytolysin precursor (cylLL–cylLS), cytolysin precursor, and post-translational modifier (cylLL–cylLS-cylM), E. faecalis endocarditis antigen (efaAfs), enterococcal surface protein (esp), gelatinase (gelE), and hyaluronidase (hyl) was determined in all Enterococcus spp. isolates. In addition, the presence of the hospital strain marker IS16 was determined by PCR (Werner et al., 2011). The positive control strains for detection of potential virulence factors were the following: E. faecalis P4 for agg, cylLL–cylLS, cylLL–cylLS-cylM, efaAfs and gelE, E. faecalis P36 for esp, E. faecium C68 for hyl (Muñoz-Atienza et al., 2013), and E. faecium P2-5 (clonal complex 17 adapted to the hospital environment) for IS16 obtained from the Servicio de Microbiología, Instituto Ramón y Cajal de Investigación Sanitaria, Hospital Universitario Ramón y Cajal, Madrid, Spain. Moreover, the presence of enterocin 1071 (ent1071A and ent1071B), enterocin AS-48 (entAS-48), enterocin A (entA), enterocin B (entB), enterocin L50 (entL50A and entL50B), enterocin P (entP), enterocin Q (entqA), enterocin SE-K4 (entSE-K4), enterococcin V583 (ef1097), enterolysin A (entL), and hiracin JM79 (hirJM79) structural genes was evaluated in the enterococcal isolates, which showed direct antimicrobial activity against at least one fish pathogen. The positive control strains for detection of bacteriocin structural genes were the following: E. faecalis FAIR-E309 (ent1071A and ent1071B), E. faecalis INIA-4 (entAS-48), E. faecium T136 (entA and entB), E. faecium L50 (entL50A and entL50B and entqA), E. faecium P13 (entP), E. faecalis K-4 (entSE-K4), E. faecalis DBC5 (ef1097), E. faecalis DBH9 (entL), and E. hirae DCH5 (hirJM79) (Brandão et al., 2010). PCR-amplifications and PCR-product visualization and analysis were performed as described above.

Results

Genotypic identification

The taxonomic identification at the species level of the 64 enterococcal isolates showed that 27 isolates (42.2%) were identified as E. faecium, 23 isolates (35.9%) as E. hirae, 8 isolates (12.5%) as E. faecalis, 3 isolates (4.7%) as E. durans, and 3 isolates (4.7%) as E. casseliflavus (Table 2).

Table 2.

Safety Assessment and Bacteriocin Genotype Detected in the 64 Enterococcus spp. Isolates

		Antibiotic resistance		Virulence
Species	Isolate	Phenotype ^a	Genotype	Phenotype ^b	Genotype	Bacteriocin genotype
E. faecium	F1E-4	ERY	erm(B)	—^c	—	entL50A and entL50B+entP
E. faecium	F1E-5	ERY	erm(B)	—	gelE	entL50A and entL50B+entP
E. faecium	F1E-7	ERY	erm(B)	—	gelE	entL50A and entL50B+entP
E. faecium	F1E-8	ERY	erm(B)	—	—	entL50A and entL50B+entP
E. faecium	F1E-9	ERY	erm(B)	—	gelE	entL50A and entL50B+entP+entSE-K4+hirJM79
E. faecium	F1E-10	ERY	erm(B)	—	—	entL50A and entL50B+entP+entqA+entSE-K4
E. faecium	NF1E-17	ERY	—	—	gelE	entP
E. faecium	NF1E-18	ERY	erm(B)	—	gelE	entP
E. faecium	NF1E-19	ERY-TET	—	—	gelE	—
E. faecium	NF1E-20	ERY	—	—	gelE	entP
E. faecium	NF1E-21	ERY	erm(B)	—	gelE	entP
E. faecium	NF1E-22	CIP-ERY	—	—	gelE	entP
E. faecium	NF1E-23	CIP-ERY	—	—	gelE	entP
E. faecium	EJ1E-44	TET	tet(M)	—	—	—
E. faecium	EJ1E-45	TET	tet(M)	—	—	—
E. faecium	EJ1E-46	TET	tet(M)	—	—	—
E. faecium	EJ1E-49	CIP	—	—	gelE	—
E. faecium	EJ1E-51	TET-ERY	erm(B)+tet(M)+tet(T)	—	—	—
E. faecium	EJ1E-52	CHL-ERY-TET	erm(B)+tet(K)+tet(M)	—	gelE	—
E. faecium	WJ2E-56	QD	—	—	efaAfs	—
E. faecium	WJ2E-57	—	—	—	efaAfs	—
E. faecium	EJ2E-59	—	—	—	—	entL50A and entL50B+entP+hirJM79
E. faecium	EJ2E-60	—	—	—	—	entL50A and entL50B+entP
E. faecium	EJ2E-61	—	—	—	—	entL50A and entL50B+entP+hirJM79
E. faecium	A2E-62	CIP	—	—	gelE	entA; entL50A and entL50B+entP
E. faecium	A2E-63	ERY	erm(B)	—	gelE	entL50A and entL50B+entP+entqA
E. faecium	A2E-64	ERY	erm(B)	—	gelE	entL50A and entL50B+entqA+entSE-K4+hirJM79
E. hirae	WLE-1	—	—	—	—	entP
E. hirae	WLE-2	—	—	—	—	entP
E. hirae	WLE-3	—	—	—	—	entP
E. hirae	F1E-6	ERY	erm(B)	—	—	—
E. hirae	EF1E-14	TET	tet(L)+tet(S)	—	gelE	—
E. hirae	EF1E-15	TET	tet(L)+tet(S)	—	gelE	—
E. hirae	EF1E-16	TET	tet(L)+tet(S)	—	gelE	—
E. hirae	NF1E-24	—	—	—	—	—
E. hirae	NF1E-25	—	—	—	—	—
E. hirae	NF1E-26	—	—	—	—	—
E. hirae	EF2E-27	CIP-QD	—	—	—	—
E. hirae	EF2E-29	—	—	—	—	—
E. hirae	EF2E-34	—	—	—	—	—
E. hirae	EF2E-36	—	—	—	—	—
E. hirae	EF2E-37	—	—	—	—	—
E. hirae	EJ1E-38	—	—	—	efaAfs	—
E. hirae	EJ1E-40	—	—	—	—	—
E. hirae	EJ1E-41	—	—	—	efaAfs	—
E. hirae	EJ1E-42	—	—	—	efaAfs	—
E. hirae	EJ1E-43	—	—	—	—	—
E. hirae	EJ1E-47	TET	tet(M)	—	gelE	—
E. hirae	EJ1E-50	CHL-CIP-ERY-QD-STR-TET	aad(E)+erm(B)+tet(K)+tet(S)	—	gelE	—
E. hirae	WJ2E-58	QD	—	—	efaAfs	—
E. faecalis	EF1E-11	—	—	—	efaAfs+gelE	—
E. faecalis	EF1E-12	—	—	—	gelE	—
E. faecalis	EF1E-13	—	—	—	efaAfs+gelE	—
E. faecalis	EF2E-30	CIP	—	—	—	—
E. faecalis	EF2E-31	TET	tet(K)	—	gelE	—
E. faecalis	EF2E-35	CIP-ERY-QD-VAN	—	GelE	efaAfs+gelE	—
E. faecalis	EJ1E-39	—	—	—	efaAfs	—
E. faecalis	J2E-55	—	—	—	efaAfs+gelE	—
E. casseliflavus	EF2E-28	VAN	vanC2	—	agg+gelE+hyl	—
E. casseliflavus	EF2E-32	VAN	vanC2	—	gelE	—
E. casseliflavus	EF2E-33	CIP- QD-TET-VAN	vanC2	—	gelE	—
E. durans	EJ1E-48	CHL	—	—	gelE	—
E. durans	J2E-53	—	—	—	—	—
E. durans	J2E-54	—	—	—	—	—

Antibiotics: CHL, chloramphenicol; CIP, ciprofloxacin; ERY, erythromycin; QD, quinupristin–dalfopristin; STR, streptomycin; TET, tetracycline; VAN, vancomycin.

GelE refers to gelatinase activity.

—, not detected.

Antibiotic susceptibility

The results of the antibiotic susceptibility revealed that a total of 48 enterococcal isolates (75%) displayed phenotypic acquired antibiotic resistance to at least 1 antibiotic (Table 2). In this respect, 20 isolates were resistant to erythromycin (41.7%), 13 isolates to tetracycline (27.1%), 8 isolates to ciprofloxacin (16.7%), 6 isolates to quinupristin–dalfopristin (12.5%), 4 isolates to vancomycin (8.3%), 3 isolates to chloramphenicol (6.25%), and 1 isolate to streptomycin (2.1%). Moreover, multiple antibiotic resistance (2–6 antibiotics) was found in 9 enterococcal isolates (18.8%). Phenotypic resistance to ampicillin, gentamicin, kanamycin, and teicoplanin was not identified in this study.

Detection of antibiotic resistance genes

The enterococcal isolates showing phenotypic antibiotic resistances were further submitted to PCR in order to identify the presence of the respective antibiotic resistance genes. A total of 25 of 48 isolates (52.1%) harbored at least 1 antibiotic resistance gene: erm(B) (14 isolates, 56%), tet(M) (6 isolates, 24%), tet(S) (4 isolates, 16%), tet(K) (3 isolates, 12%), tet(L) (3 isolates, 12%), tet(T) (1 strain, 4%), vanC2 (3 isolates, 12%), and aad(E) (1 strain, 4%) (Table 2). The genes involved in the horizontal transfer of resistance to chloramphenicol [cat(A)], quinupristin–dalfopristin [vat(D) and vat(E)], vancomycin [van(A), van(B)], as well as some genes involved in the resistance of erythromycin [erm(A) and erm(C)] and tetracycline [tetB(P), tet(O), tet(Q), and tet(W)] were not detected.

Gelatinase and hemolysin production, bile salt deconjugation, and mucin degradation

The production of gelatinase was phenotypically detected in one isolate (Table 2). Hemolysin production, bile salts deconjugation, and mucin degradation abilities were not found in any of the tested isolates.

Detection of virulence genes and markers

The presence of at least 1 virulence gene was detected in 37 of 64 enterococci (57.8%) (Table 2). From these, a total of 30 isolates (81.1%) harbored the gene gelE, 11 (29.7%) harbored efaAfs, 1 (2.7%) harbored agg, and 1 (2.7%) harbored hyl.

Direct antimicrobial activity and detection of bacteriocin structural genes

Analysis of the direct antimicrobial activity of the 64 enterococcal isolates against 9 indicator strains showed that 48 isolates (75%) inhibited the growth of at least 1 of the fish pathogens tested. The most sensitive pathogen tested was L. garvieae CECT5807, inhibited by a total of 22 enterococci (34.4%) corresponding to the following species: 11 E. hirae isolates (50%), 9 E. faecium isolates (41%), 1 E. faecalis isolate (4.5%), and 1 E. casseliflavus isolate (4.5%) (Table 3). With respect to L. garvieae, it should be noted that 36 of the 48 isolates (75%) showed antimicrobial activity against at least 1 strain of this pathogen species. Conversely, none of the Enterococcus spp. isolates inhibited the Gram-negative indicator Vibrio campbellii. Furthermore, E. durans isolates did not show antimicrobial activity against any of the tested pathogens.

Table 3.

Antimicrobial Activity of 64 Enterococcal Isolates Against the 9 Fish Pathogens Tested

	Number of enterococci with antimicrobial activity
Indicator strains	E. faecium (n=27)	E. hirae (n=23)	E. faecalis (n=8)	E. casseliflavus (n=3)	E. durans (n=3)	Total (n=64)
Lactococcus garvieae CF00021	7	2	3	1	0	13
L. garvieae CF01144	7	2	3	1	0	13
L. garvieae CECT5807	9	11	1	1	0	22
L. garvieae JIP29-99	7	3	2	1	0	13
Carnobacterium maltaromaticum LMG14716	18	1	0	1	0	20
Streptococcus iniae LMG14521	4	9	4	2	0	19
Yersinia ruckeri LMG3279	5	0	2	1	0	8
Aeromonas salmonicida LMG3776	4	2	2	2	0	10
Vibrio campbellii LMG21363	0	0	0	0	0	0

The 48 isolates with direct antimicrobial activity were further investigated for the presence of enterocins. From these isolates, 21 (43.8%) harbored at least 1 enterocin-encoding gene; entP was the most common (20 isolates, 95.2%) (Table 2). In addition, others enterocins such as entL50A and entL50B (12 isolates, 57.1%), hirJM79 (4 isolates, 19%), entSE-K4 (3 isolates, 14.3%), entqA (3 isolates, 14.3%), and entA (1 strain, 4.8%) were found (Table 2). The presence of enterocin 1071, enterocin AS-48, enterocin B, enterococcin V583, and enterolysin A was not detected. Regarding the occurrence of different enterocin structural gene combinations in the tested isolates, the one with the highest occurrence was entP with entL50A and entL50B (5 E. faecium isolates, 23.8%). The occurrence of the combination of 4 structural genes was found in 4 E. faecium isolates (19%) (entL50A and entL50B, entP, and hirJM79, 9.5%; entL50A and entL50B, entP, and entQ, 4.8%; entA, entL50A and entL50B and entP, 4.8%). The presence of 5 different structural genes was found in 3 E. faecium isolates (14.3%) (entL50A and entL50B, entqA, entSE-K4 and hirJM79, 4.8%; entL50A and entL50B, entP, entSE-K4 and hirJM79, 4.8%; entL50A and entL50B, entP, entqA, and entSE-K4, 4.8%). Moreover, from the 21 isolates harboring enterocins encoding-genes, 18 (85.7%) were identified as E. faecium and 3 (14.3%) isolates as E. hirae (Table 2).

Safety aspects and antimicrobial activity of potential probiotic candidates

A total of 17 (26.6%) enterococcal isolates did not harbor any detrimental enzymatic activity, antibiotic resistance, or virulence factor. From these enterococci, 12 isolates (70.6%) were identified as E. hirae, 3 isolates (17.6%) were E. faecium, and 2 isolates (11.8%) were E. durans. Moreover, 9 of 17 isolates (52.9%) showed antimicrobial activity against at least 1 fish pathogen, whereas only 6 of 17 (35.3%) harbored at least 1 enterocin-encoding gene.

Discussion

In this work, the in vitro safety of 64 enterococcal isolates and their antimicrobial activity against fish pathogens have been assayed in order to identify and select the most suitable candidates to be further evaluated as probiotics for a sustainable aquaculture. E. faecium and E. hirae were the most common species (42.2 and 35.9%, respectively), which is in agreement with a previous study with mullet fish (Liza ramada) (Silva et al., 2012).

The use and the recurrent abuse of antibiotics in aquaculture has resulted in the emergence and spread of antibiotic-resistant bacteria in the fish-farming environment (Muñoz-Atienza et al., 2013). According to EFSA, bacterial strains intended for use as probiotics should not harbor any acquired resistance to antibiotics of importance in clinical and veterinary medicine (EFSA, 2011). The tested antimicrobials used in this study were selected following the recommendations of the CLSI for the genus Enterococcus (CLSI, 2011). In this work, 14 of the 20 (70%) erythromycin-resistant isolates harbored the erm(B) gene. Previous studies have shown that erm(B) is the most frequently resistant gene found among erythromycin-resistant enterococci (Barreto et al., 2009; Santos et al., 2013). The antibiotic resistance determinants erm(A) and erm(C) were not found in the enterococci isolates tested; however, other mechanisms of resistance, such as drug efflux pumps encoded by the gene mef(A/E) and enzymatic inactivation of the antibiotic encoded by the erythromycin esterases genes, ere(A) and ere(B), may be present in those isolates in which no tested macrolide-resistant genes were found. Eleven of 13 (84.5%) tetracycline-resistant isolates harbored at least 1 gene encoding resistance to this antibiotic, tet(M) being the most commonly occurring gene and supporting the evidence that this gene is the most widespread among tetracycline-resistant LAB (Ammor et al., 2007). The gene aad(E) responsible for high-level streptomycin resistance was detected in one E. hirae isolate with phenotypic-resistance streptomycin. A total of four isolates were phenotypically resistant to vancomycin, including three E. casseliflavus, which are intrinsic resistant, and one E. faecalis, which did not harbor any of the tested vancomycin-resistant genetic determinants. Moreover, none of the isolates resistant to ciprofloxacin, quinupristin–dalfopristin, and chloramphenicol harbored any of the respective resistance genes. This finding suggests the presence of further mechanisms of resistance to these antibiotics.

Enterococci harboring virulence factors have the ability to colonize and invade host tissue, displace through epithelial cells, and elude the host's immune response (Johnson, 1994). In our study, the virulence genes gelE, efaAfs, agg, and hyl were detected. A total of 30 enterococcal isolates carried the virulence factor gelE, which encodes for an extracellular zinc endopeptidase that hydrolyzes gelatin, collagen, hemoglobin, and other bioactive compounds (Muñoz-Atienza et al., 2013). However, only one E. faecalis isolate expressed gelatinase activity, indicating the carriage of a nonfunctional gelE gene by all the other isolates, which is agreement with previous studies (Eaton and Gasson, 2001; Muñoz-Atienza et al., 2013). From the 11 isolates harboring the E. faecalis endocarditis antigen (EfaAfs), 5 were E. faecalis isolates, 4 were E. hirae, and 2 were E. faecium isolates. On the other hand, the virulence factors hyl and agg, which encode a hyaluronidase enzyme and a surface-bound glycoprotein, respectively, were only found in one E. casseliflavus isolate, also harboring gelE. Recently, and based on previous studies, the EFSA (2012) has published a method to assess the safety and to identify E. faecium strains of clinical origin, which was based on the presence of three virulence marker genes (esp, hyl_Efm or IS16) and the resistance to ampicillin. The mobile IS16 element (designated as a mutator-type transposase) was previously proposed as a specific marker to recognize hospital-associated E. faecium strains (Werner et al., 2011). The absence of IS16 element among our enterococci is in agreement with Werner et al. (2011), who suggested a limited host range of IS16-bearing plasmids only among hospital-associated strains. None of our E. faecium isolates harbored the virulence marker genes esp and hyl or showed resistance to ampicillin.

The deconjugation of bile salts by probiotic strains could be unfavorable in fish farming due to unconjugated bile acids, which are less efficient than their conjugated counterparts in the emulsification of dietary lipids. In addition, the formation of micelles, lipid digestion, and absorption of fatty acids and monoglycerides could be decreased by deconjugated bile salts (Begley et al., 2005). In this respect, none of the 64 enterococcal isolates tested deconjugated bile salts, revealing the suitableness of these isolates for application in animal production, which is in agreement with a previous study with LAB strains isolated from aquatic animals regarded as human food (Muñoz-Atienza et al., 2013). Moreover, the 64 Enterococcus spp. isolates tested did not display mucinolytic activity, indicating their low invasive and toxigenic potential at the mucosal barrier, thus supporting the data previously published that LAB do not degrade mucin in vitro (Zhou et al., 2001).

With regard to the safety assessment, and according to the precautionary principle, we did not consider as safe the 47 (73.4%) enterococcal isolates showing phenotypic or genotypic acquired antibiotic resistance and/or virulence factors, even if the isolates presumably did not harbor genes encoding antibiotic resistance or virulence factors.

LAB isolated from rainbow trout have shown antimicrobial activity against fish pathogens and have been proposed as probiotics to prevent bacterial fish diseases (Verschuere et al., 2000; Ringø et al., 2010; Pérez-Sánchez et al., 2011). Seventy-five percent of the enterococcal isolates of this study exerted antimicrobial activity against at least one of the tested fish pathogens, which indicates that the production of antimicrobial compounds, such as bacteriocins, is a common probiotic property among enterococci isolated in this study. In fish farming, lactococcosis caused by the zoonotic agent L. garvieae, causing hemorrhagic septicemia and meningoencephalitis, is one of the most serious diseases affecting several marine and freshwater fish species (Vendrell et al., 2006). With regard to this, our work shows that active enterococci against fish pathogen are common among rainbow trout intestine, feed, and rearing environment (36 isolates, 56.3%). A previous study, with enterococcal isolates from visceral wastes of freshwater Indian major carps (Catla, Catla catla; Mrigal, Cirrhinus mrigala; and Rohu, Labeo rohita), reported a lower rate of enterococci (27.7%) with antimicrobial activity against fish pathogens (Ramakrishnan et al., 2012). Nevertheless, from the 48 enterococcal isolates exerting antimicrobial activity, 27 isolates did not harbor any bacteriocin structural gene, which suggests the production of antimicrobial compounds such as organic acids (mainly lactic and acetic acids), hydrogen peroxide, or different bacteriocins not tested in this study. According to our results, the bacteriocin structural genes found among our enterococcal isolates belonged to subclass II.1, the pediocin-like bacteriocins (EntP, HirJM79, EntSe-K4, and EntA) and to subclass II.2, enterocins synthesized without a leader peptide (EntL50A and EntL50B, and EntQ). Interestingly, the potential bacteriogenic E. hirae only harbored entP, which was also detected previously in an isolate from pets (Brandão et al., 2010). A previous study suggested that EntA and EntB act synergistically (Casaus et al., 1997), although we found an E. faecium isolate containing entA, but not entB. Concerning the presence of different combinations of enterocin structural genes, our results reveal a high incidence of isolates harboring more than 1 gene (12 isolates, 57.1%), an indication of the high genetic potential of enterococci to produce various bacteriocins, a fact supported by other studies (Casaus et al., 1997; Poeta et al., 2007; Brandão et al., 2010). However, not all enterocin genes are expressed simultaneously in the multiple bacteriocin-producing strains (Casaus et al., 1997) and silent bacteriocin genes, which may become activated by external factors, were reported previously in enterococci (Eaton and Gasson, 2001; Poeta et al., 2007).

Conclusions

A total of 17 (26.6%) enterococcal isolates that did not harbor any antibiotic resistance or virulence factor were considered safe, including 3 E. faecium and 3 E. hirae (35.3%) that showed antimicrobial activity against at least 1 fish pathogen, and harbored at least 1 bacteriocin-encoding gene. These results reveals that the rainbow trout feed and rearing environment are an interesting and appropriate source to isolate enterococci with a potential application as probiotics for a sustainable aquaculture. However, in vivo safety assessment of their absence of toxicity and undesirable effects must be also carried out in rainbow trout before proposal of these isolates as probiotics.

Footnotes

Acknowledgments

The authors express their gratitude to Dr. Nes, Department of Chemistry, Biotechnology and Food Science, Norwegian University of Life Sciences, Ås (Norway); Dr. Eaton, Division of Food Safety Sciences, Institute of Food Research (IFR), Norwich Research Park, Norwich (UK); Dr. Núñez, Departamento de Tecnología de los Alimentos, Instituto Nacional de Investigaciones Agrarias (INIA), Madrid (Spain); Dr. Franz, Federal Research Centre for Nutrition and Food, Institute for Hygiene and Toxicology, Karlsruhe (Germany); Dr. del Campo, Servicio de Microbiología, Hospital Ramón y Cajal, Madrid (Spain); Dr. Doi, Laboratory of Applied Microbial Genetics, Faculty of Agriculture, Graduate Schools, Kyushu University, Fukuoka (Japan), Dr. V. Vankerckhoven, University of Antwerp (Belgium), and Dr. Courvalin, Unité des Agents Antibacteriéns, Institute Pasteur, Paris (France) for kindly supplying bacterial strains used as PCR-positive controls. We acknowledge to Dr. C. Michel, Institut National de la Recherche Agronomique (INRA), Jouy-en-Josas, France, for providing some of the fish pathogens. This work was partially supported by project AGL2012-34829 from Ministerio de Economía y Competitividad (MINECO, Madrid, Spain), and by grants S-2009/AGR-1489 and P2013/ABI-2747 from Dirección General de Universidades e Investigación, Consejería de Educación, Comunidad de Madrid (CAM, Madrid, Spain). C. Araújo holds a predoctoral fellowship granted by Fundação para a Ciência e a Tecnologia (FCT, Portugal) and European Social Fund (ESF) (SFRH/BD/62416/2009). E. Muñoz-Atienza holds a predoctoral fellowship from the Universidad Complutense de Madrid (Madrid, Spain).

Disclosure Statement

No competing financial interests exist.

References

Aarestrup

, Agerso

, Gerner-Smidt

, Madsen

, Jensen

. Comparison of antimicrobial resistance phenotypes and resistance genes in Enterococcus faecalis and Enterococcus faecium from humans in the community, broilers, and pigs in Denmark. Diagn Microbiol Infect Dis, 2000; 37:127–137.

Ammor

, Belén Flórez

, Mayo

. Antibiotic resistance in non-enterococcal lactic acid bacteria and bifidobacteria. Food Microbiol, 2007; 24:559–570.

Araújo

, Muñoz-Atienza

, Nahuelquín

, Poeta

, Igrejas

, Hernández

, Herranz

, Cintas

. Inhibition of fish pathogens by the microbiota from rainbow trout (Oncorhynchus mykiss, Walbaum) and rearing environment. Anaerobe, 2015; 32:7–14.

Barreto

, Guimarães

, Radhouani

, Araújo

, Gonçalves

, Gaspar

, Rodrigues

, Igrejas

, Poeta

. Detection of antibiotic resistant E. coli and Enterococcus spp. in stool of healthy growing children in Portugal. J Basic Microbiol, 2009; 49:503–512.

Begley

, Gahan

, Hill

. The interaction between bacteria and bile. FEMS Microbiol Rev, 2005; 29:625–651.

Bostock

, McAndrew

, Richards

, Jauncey

, Telfer

, Lorenzen

, Little

, Ross

, Handisyde

, Gatward

, Corner

. Aquaculture: Global status and trends. Philos Trans R Soc Lond B Biol Sci, 2010; 365:2897–2912.

Brandão

, Almeida

, Muñoz-Atienza

, Torres

, Igrejas

, Hernández

, Cintas

, Poeta

, Herranz

. Antimicrobial activity and occurrence of bacteriocin structural genes in Enterococcus spp. of human and animal origin isolated in Portugal. Arch Microbiol, 2010; 192:927–936.

Cabello

. Heavy use of prophylactic antibiotics in aquaculture: A growing problem for human and animal health and for the environment. Environ Microbiol, 2006; 8:1137–1144.

Casaus

, Nilsen

, Cintas

, Nes

, Hernández

, Holo

. Enterocin B, a new bacteriocin from Enterococcus faecium T136 which can act synergistically with enterocin A. Microbiology, 1997; 143:2287–2294.

10.

Cintas

, Casaus

, Herranz

, Nes

, Hernández

. Bacteriocins of lactic acid bacteria. Food Sci Technol Int, 2001; 7:281–305.

11.

Cintas

, Rodríguez

, Fernández

, Sletten

, Nes

, Hernández

, Holo

. Isolation and characterization of pediocin L50, a new bacteriocin from Pediococcus acidilactici with a broad inhibitory spectrum. Appl Environ Microbiol, 1995; 61:2643–2648.

12.

[CLSI] Clinical and Laboratory Standards Institute. Performance Standards for Antimicrobial Susceptibility Testing: Twenty-first Informational Supplement. CLSI Document M100–S21. Wayne, PA: CLSI, 2011.

13.

Defoirdt

, Boon

, Sorgeloos

, Verstraete

, Bossier

. Alternatives to antibiotics to control bacterial infections: Luminescent vibriosis in aquaculture as an example. Trends Biotechnol, 2007; 25:472–479.

14.

Defoirdt

, Sorgeloos

, Bossier

. Alternatives to antibiotics for the control of bacterial disease in aquaculture. Curr Opin Microbiol, 2011; 14:251–258.

15.

Eaton

, Gasson

. Molecular screening of Enterococcus virulence determinants and potential for genetic exchange between food and medical isolates. Appl Environ Microbiol, 2001; 67:1628–1635.

16.

[EFSA] European Food Safety Authority. Maintenance of the list of QPS biological agents intentionally added to food and feed (2011 update). EFSA J, 2011; 9:1–82.

17.

EFSA. Guidance on the safety assessment of Enterococcus faecium in animal nutrition. EFSA J, 2012; 10:2682.

18.

Foulquié Moreno

, Sarantinopoulos

, Tsakalidou

, De Vuyst

. The role and application of enterococci in food and health. Int J Food Microbiol, 2006; 106:1–24.

19.

Franz

, Huch

, Abriouel

, Holzapfel

, Gálvez

. Enterococci as probiotics and their implications in food safety. Int J Food Microbiol, 2011; 151:125–140.

20.

Franz

, Van Belkum

, Holzapfel

, Abriouel

, Gálvez

. Diversity of enterococcal bacteriocins and their grouping in a new classification scheme. FEMS Microbiol Rev, 2007; 31:293–310.

21.

Gaggìa

, Mattarelli

, Biavati

. Probiotics and prebiotics in animal feeding for safe food production. Int J Food Microbiol, 2010; 141:S15–S28.

22.

Johnson

. The pathogenicity of enterococci. J Antimicrob Chemother, 1994; 33:1083–1089.

23.

Klare

, Konstabel

, Werner

, Huys

, Vankerckhoven

, Kahlmeter

, Hildebrandt

, Müller-Bertling

, Witte

, Goossens

. Antimicrobial susceptibilities of Lactobacillus, Pediococcus and Lactococcus human isolates and cultures intended for probiotic or nutritional use. J Antimicrob Chemother, 2007; 59:900–912.

24.

Lina

, Quaglia

, Reverdy

, Leclercq

, Vandenesch

, Etienne

. Distribution of genes encoding resistance to macrolides, lincosamides, and streptogramins among staphylococci. Antimicrob Agents Chemother, 1999; 43:1062–1066.

25.

Mohapatra

, Chakraborty

, Kumar

, Deboeck

, Mohanta

. Aquaculture and stress management: A review of probiotic intervention. J Anim Physiol Anim Nutr, 2012; 97:405–430.

26.

Muñoz-Atienza

, Gómez-Sala

, Araújo

, Campanero

, del Campo

, Hernández

, Herranz

, Cintas

. Antimicrobial activity, antibiotic susceptibility and virulence factors of lactic acid bacteria of aquatic origin intended for use as probiotics in aquaculture. BMC Microbiol, 2013; 13:15.

27.

Noriega

, Cuevas

, Margolles

, de los Reyes-Gavilán

. Deconjugation and bile salts hydrolase activity by Bifidobacterium strains with acquired resistance to bile. Int Dairy J, 2006; 16:850–855.

28.

Pérez-Sánchez

, Balcázar

, Merrifield

, Carnevali

, Gioacchini

, de Blas

, Ruiz-Zarzuela

. Expression of immune-related genes in rainbow trout (Oncorhynchus mykiss) induced by probiotic bacteria during Lactococcus garvieae infection. Fish Shellfish Immunol, 2011; 31:196–201.

29.

Poeta

, Costa

, Rojo-Bezares

, Zarazaga

, Klibi

, Rodrigues

, Torres

. Detection of antimicrobial activities and bacteriocin structural genes in faecal enterococci of wild animals. Microbiol Res, 2007; 162:257–263.

30.

Poyart

, Quesnes

, Trieu-Cuot

. Sequencing the gene encoding manganese-dependent superoxide dismutase for rapid species identification of enterococci. J Clin Microbiol, 2000; 38:415–418.

31.

Ramakrishnan

, Balakrishnan

, Rai

, Narayan

, Halami

. Concomitant production of lipase, protease and enterocin by Enterococcus faecium NCIM5363 and Enterococcus durans NCIM5427 isolated from fish processing waste. Int Aquat Res, 2012; 4:14.

32.

Ringø

, Løvmo

, Kristiansen

, Bakken

, Salinas

, Myklebust

, Olsen

, Mayhew

. Lactic acid bacteria vs. pathogens in the gastrointestinal tract of fish: A review. Aquac Res, 2010; 41:451–467.

33.

Santos

, Silva

, Igrejas

, Rodrigues

, Micael

, Rodrigues

, Resendes

, Gonçalves

, Marinho

, Gonçalves

, Cunha

, Poeta

. Dissemination of antibiotic resistant Enterococcus spp. and Escherichia coli from wild birds of Azores Archipelago. Anaerobe, 2013; 24:25–31.

34.

Silva

, Igrejas

, Gonçalves

, Poeta

. Commensal gut bacteria: Distribution of Enterococcus species and prevalence of Escherichia coli phylogenetic groups in animals and humans in Portugal. Ann Microbiol, 2012; 62:449–459.

35.

Torres

, Tenorio

, Portillo

, Garcia

, Martinez

, Del Campo

, Ruiz-Larrea

, Zarazaga

. Intestinal colonization by vanA- or vanB2-containing enterococcal isolates of healthy animals in Spain. Microb Drug Resist, 2003; 9(Suppl 1):S47–S52.

36.

Vendrell

, Balcázar

, Ruiz-Zarzuela

, de Blas

, Gironés

, Múzquiz

. Lactococcus garvieae in fish: A review. Comp Immunol Microbiol, 2006; 29:177–198.

37.

Verschuere

, Rombaut

, Sorgeloos

, Verstraete

. Probiotic bacteria as biological control agents in aquaculture. Microbiol Mol Biol Rev, 2000; 64:655–671.

38.

Werner

, Fleige

, Geringer

, van Schaik

, Klare

, Witte

. IS element IS16 as a molecular screening tool to identify hospital-associated strains of Enterococcus faecium . BMC Infect Dis, 2011; 11:80.

39.

Yousefian

, Amiri

. A review of the use of prebiotic in aquaculture for fish and shrimp. Afr J Microbiol Res, 2009; 8:7313–7318.

40.

Zhou

, Gopal

, Gill

. Potential probiotic lactic acid bacteria Lactobacillus rhamnosus (HN001), Lactobacillus acidophilus (HN017) and Bifidobacterium lactis (HN019) do not degrade gastric mucin in vitro. Int J Food Microbiol, 2001; 63:81–90.