Enterotoxin-Encoding Genes in Staphylococcus spp. from Food Handlers in a University Restaurant

Abstract

Food handlers carrying enterotoxin-producing Staphylococcus are a potential source of food poisoning. The aim of this study was to analyze genes encoding enterotoxins in coagulase-positive Staphylococcus (CoPS) and coagulase-negative Staphylococcus (CoNS) isolated from the anterior nostrils and hands of food handlers at a university restaurant in the city of Natal, Northeast Brazil. Thirty food handlers were screened for the study. The isolates were subjected to Gram staining, a bacitracin sensitivity test, mannitol fermentation, and catalase and coagulase tests. CoNS and CoPS strains were subsequently identified by a Vitek 2 System (BioMerieux, France) and various biochemical tests. Polymerase chain reaction was used to detect genes for enterotoxins A, B, C, D, E, G, H, and I (sea, seb, sec, sed, see, seg, seh, and sei) and a disc-diffusion method was used to determine susceptibility to several classes of antimicrobials. All food handlers presented staphylococci on their hands and/or noses. The study found 58 Staphylococcus spp., of which 20.7% were CoPS and 79.3% were CoNS. S. epidermidis was the most prevalent species. Twenty-nine staphylococci (50%) were positive for one or more enterotoxin genes, and the most prevalent genes were seg and sei, each with a frequency of 29.3%. Indeed, CoNS encoded a high percentage of enterotoxin genes (43.5%). However, S. aureus encoded even more enterotoxin genes (75%). Most isolates showed sensitivity to the antibiotics used for testing, except for penicillin (only 35% sensitive). The results from this study reinforce that coagulase-negative as well as coagulase-positive staphylococci isolated from food handlers are capable of genotypic enterotoxigenicity.

Introduction

University restaurants provide meals to all individuals in the university community, including the student body, servers, administrative staff, and teachers. These meals must be handled correctly, because food handlers carrying enterotoxin-producing Staphylococccus spp. can contaminate food, causing outbreaks of foodborne illness. In Brazil, there were 9719 outbreaks of foodborne illnesses between 2000 and 2014, which left 192,803 people sick. Thus, Staphylococcus aureus was considered the second most important etiological agent in Brazil during 2014 (Brasil, 2014). S. aureus is present in the microbiota of the skin and mucosal membranes, with 20–30% persistently colonizing and 60% intermittently colonizing these areas (Kluytmans et al., 2005). These bacteria frequently contaminate food as a result of inappropriate manipulation by food handlers who harbor these bacteria (Wieneke et al., 1993). Poisoning occurs through ingestion of enterotoxins produced by the bacteria, and symptoms usually appear one to six hours after ingestion of contaminated food. These symptoms consist mainly of nausea, vomiting, abdominal cramps and diarrhea (Loncarevic et al., 2005). Currently, 23 enterotoxins have been described. The five most well studied are considered classical enterotoxins (sea, seb, sec, sed, and see). However, one cannot ignore the other enterotoxins (seg, seh, and sei) because they may also be present in Staphylococcus spp. and could therefore potentially cause staphylococcal food poisoning (SFP) (Mclauchlin et al., 2000; Vasconcelos et al., 2011; Marcenovicz, 2012). Despite the many studies that equate SFP with S. aureus contamination alone, some coagulase-negative staphylococcal (CoNS) species are also capable of producing enterotoxins (Vernozy-Rozand et al., 1996; Cunha et al., 2006; Vasil, 2007; Veras et al., 2008). Since Staphylococcus spp. contamination is one of the main causes of food poisoning and food handlers serve as potential vehicles for bacterial spread, the aim of this study was to investigate the presence of genes encoding enterotoxigenicity in Staphylococcus spp. isolated from the nasal mucosa and hands of food handlers at a university restaurant in the city of Natal, Northeast Brazil.

Materials and Methods

Sample collection and Staphylococcus identification

This study was conducted by collecting specimens from 30 food handlers working in a university restaurant between November 2012 and June 2013, after permission from the Ethics Committee on Research at the Federal University of Rio Grande do Norte and participant consent. The restaurant where the handlers worked serves approximately 4200 meals a day, providing for all individuals in the university community. A collection of biological samples from the anterior nostrils and hands (interdigital, subungual, and palm regions) of every food handler was made using a sterile swab moistened in sterile normal saline. The swabs were immediately placed in Brain Heart Infusion media (HiMedia, India) with 6.5% NaCl and incubated at 35°C for 24 to 48 h. Samples were then streaked on nutrient agar (HiMedia). Colonies were screened for Staphylococcus spp. by Gram staining, bacitracin sensitivity test (0.04 U; Newprov, Brazil), and catalase and coagulase tube tests. The CoNS and coagulase-positive Staphylococcus (CoPS) strains were identified by a Vitek 2 System (BioMerieux, France) and biochemical tests such as carbohydrate fermentation, urea degradation, Voges–Proskauer test, pyrrolidonyl arylamidase test, and novobiocin resistance (Murray et al., 2007). The strains were stored at −22°C in skim milk (BD Diagnostics, USA).

Antimicrobial susceptibility testing

Antimicrobial susceptibility testing was performed using a disk-diffusion method to penicillin G (10 U), cefoxitin (30 μg), erythromycin (15 μg), clindamycin (02 μg), linezolid (30 μg), trimethoprim–sulfamethoxazole (1.25/23.75 μg), chloramphenicol (30 μg), ciprofloxacin (05 μg), gentamicin (10 μg), rifampin (05 μg), and tetracycline (30 μg), according to the Clinical and Laboratory Standards Institute (CLSI, 2013). All isolates were further distinguished by a double-disk diffusion test (D-test) for the presence of inducible clindamycin resistance. The antibiotic discs were purchased from Newprov.

Detection of enterotoxin-encoding genes

DNA extraction was performed as described by Pacheco et al. (1997). Polymerase chain reaction (PCR) was used to analyze the following genes: sea, seb, sec, sed, see, seg, seh, and sei (Johnson et al., 1991; Mehrotra et al., 2000; Jarraud et al., 2002). Reactions were performed in a total volume of 25 μL containing 0.4 mM of each primer (Invitrogen, USA), 12.5 μL of 1X Master Mix (dNTP, MgCl₂, and Taq DNA polymerase; Promega, USA), nuclease-free water (Promega), and 100 ng genomic DNA. Primer details are shown in Table 1. PCR amplification was performed using a Bio-Rad thermocycler (Bio-Rad, USA) with the following cycles: initial denaturation for 5 min at 94°C and then 30 cycles at 94°C for 2 min (denaturation) and 72°C for 1 min (extension). The various temperatures used in the annealing step are shown in Table 1. Final extension was performed at 72°C for 5 min (Rall et al., 2010). The PCR-amplified samples were analyzed by electrophoresis for 50 min at 110 V through a 1.5% agarose gel (Invitrogen) in 0.5X Tris/Borate/EDTA (0.09 M Tris-HCl, 0.09 M boric acid, 2 mM EDTA, pH 8.3; Bio-Rad, USA). A 100-bp ladder (New England Biolabs, USA) was used for reference. The gel was stained in a solution of Gel Red 3X (Biotium, USA) for 30 min and visualized by a Gel Doc^™ EZ System (Bio-Rad). Positive controls used for comparison included S. aureus FRI 996 (sea, seb, and sed), S. aureus ATCC 19095 (sec, seh, and sei), S. aureus ATCC 27664 (see), and S. aureus ATCC 23235 (seg) (Fig. 1).

FIG. 1.

Agarose gel containing polymerase chain reaction–amplified products of enterotoxin-encoding genes in Staphylococcus spp. M, 100-pb DNA ladder; 1, positive control to sea (120 pb); 2, positive sample to sea (120 pb); 3, positive control to sec (257 pb); 4, positive sample to sec (257 pb); 5, positive control to see (209 pb); 6, positive control to seg (642 pb); 7, positive sample to seg (642 pb); 8, positive control to seh (376 pb); 9, positive sample to seh (376 pb); 10, positive control to sei (577 pb); 11, positive sample to sei (577 pb); 12, positive control to seb (478 pb); 13, positive sample to seb (478 pb); 14, positive control to sed (317 pb).

Table 1.

Primers and Temperature Used for the Detection of Staphylococcal Enterotoxin Genes

Gene	Primer	Sequence	Base pair	Annealing temperature	Reference
sea	SEA-F	ttggaaacggttaaaacgaa	120	52.3°C	Johnson et al. (1991)
	SEA-R	gaaccttcccatcaaaaaca
seb	SEB-F	tcgcatcaaactgacaaacg	478	52.3°C	Johnson et al. (1991)
	SEB-R	gcaggtactctataagtgcc
sec	SEC-F	gacataaaagctaggaattt	257	52.3°C	Johnson et al. (1991)
	SEC-R	aaatcggattaacattatcc
sed	SED-F	ctagtttggtaatatctcct	317	51.1°C	Johnson et al. (1991)
	SED-R	taatgctatatcttataggg
see	SEE-F	aggttttttcacaggtcatcc	209	50°C	Mehrotra et al. (2000)
	SEE-R	cttttttttcttcggtcaatc
seg	SEG-F	aattatgtgaatgctcaacccgatc	642	55°C	Jarraud et al. (2002)
	SEG-R	aaacttatatggaacaaaaggtactagttc
seh	SEH-F	caatcaactcatatgcgaaagcag	376	61.8°C	Jarraud et al. (2002)
	SEH-R	catctacccaaacattagcacc
sei	SEI-F	ctcaaggtgatattggtgtagg	577	61.8°C	Jarraud et al. (2002)
	SEI-R	aaaaaacttacaggcagtccatctc

Results and Discussion

Food handlers carrying enterotoxin-producing bacteria in their noses or on their hands are regarded as the main source of food contamination, either via manual contact or respiratory secretions. Out of a total of 60 samples (hand and nasal samples combined), 58 Staphylococcus species were isolated, 46 (79.3%) being CoNS and 12 (20.7%) being S. aureus. All food handlers tested positive for Staphylococcus, but only two had the bacteria only on their hands. The high colonization rate by Staphylococcus spp. detected in this research represents a foodborne disease risk for consumers at the studied restaurant due to inadequate personal hygiene or cross-contamination. In the study, the presence of S. aureus on food handlers was similar to data reported previously (Figueroa et al., 2002; Bresolin et al., 2005; Grando et al., 2008). Several researchers have reported the presence of S. aureus in nasal mucosa of food handlers where the rate of nasal colonization varied between 20% and 30% (Simsek et al., 2009; Dagnew et al., 2012; El-Shenawy et al., 2013; Ho et al., 2014). However, in this study, the prevalence of S. aureus in nasal mucosa was higher (40%) than in the studies cited above. The CoNS species S. epidermidis, S. hominis, S. caprae, S. warneri, S. lugdunensis, S. saprophyticus, S. capitis, S. cohnii, S. chromogenes, and S. simulans were isolated from the handlers.

The most prevalent species was S. epidermidis (45.6%), followed by S. hominis (21.7%). Previous studies have found different CoNS species colonizing food handlers, reflecting differences in the distribution of microbiota among populations of people (Udo et al., 1999; Rall et al., 2010). The presence of species not commonly isolated in humans can be explained by the food handlers' contact with various types of food, which could transfer staphylococcal species during handling (Fontes et al., 2013; Lyra et al., 2013). Most isolates showed a sensitivity profile to antimicrobials, although 65% were resistant to penicillin, 37.9% to erythromycin, 29.3% to tetracycline, and 25.9% to trimethoprim–sulfamethoxazole. Importantly, two S. aureus species were D-test positive, demonstrating a resistance to clindamycin, an antibiotic frequently used to treat S. aureus infections. Although no methicillin-resistant Staphylococcus aureus (MRSA) was found, it is important to monitor the presence of this lineage in healthy individuals because, according to a 2011 CDC report, the rate of community-associated Staphylococcus aureus (CA-MRSA) has increased in past years. In this study, 29 (50%) of staphylococci encoded genes for enterotoxins. Among the isolates positive for enterotoxins, 20 were positive for only one gene, 8 harbored two genes, and 2 were positive for three genes.

The most prevalent genes were seg and sei (29.3% each), which highlights the importance of nonclassical enterotoxins. The distribution of enterotoxin genes by species found in this study is shown in Table 2. There is much ongoing research into the occurrence of Staphylococcus aureus on food handlers and its relationship to food-poisoning outbreaks, but the CoNS species are often neglected, as they are not considered human pathogens. In this study, the frequency of enterotoxin-encoding CoNS was significant (43.5%). However, S. aureus showed a higher frequency of enterotoxin-encoding genes (75%). There are few studies evaluating the enterotoxins in CoNS isolated from food handlers, but some authors have detected genes for enterotoxins as well as enterotoxins at the protein level in this group (Udo et al., 1999; Veras et al., 2008; Rall et al., 2010; Lyra et al., 2013). The colonization of enterotoxin-encoding Staphylococcus on the hands and noses of food handlers is troublesome because of its link to outbreaks of foodborne illness and suggestion of poor hygiene among these workers. Considering the classic enterotoxin-encoding genes found in this study, the gene sec had a high frequency (26.8%). Lyra et al. (2013) and Loncarevic et al. (2005) also observed a similarly high frequency, a stark contrast to other studies where the gene sec was present at a low frequency and sea was the most prevalent (Figueroa et al., 2002; Holecková et al., 2002; Cha et al., 2006).

Table 2.

Staphylococcal Enterotoxin Gene Distribution Between Species

	Enterotoxins genes
									Multiple genes
	sea	seb	sec	sed	see	seg	seh	sei	Two genes	Three genes
Species (total /SE genes for positive %)	H/N	H/N	H/N	H/N	H/N	H/N	H/N	H/N	H/N	H/N
S. aureus (12/75)	1/–	–	–/1	–	–	1/5	–/2	–/6	1/2	–/2
S. epidermidis (21/38)	–/1	–/1	2/1	–	–	1/1	–	1/2	1/1	–
S. hominis (10/40)	–	–	1/1	–	–	–/1	1/–	1/–	–/1	–
S. caprae (5/40)	–	–	1/–	–	–	1/–	–	1/–	1/–	–
S. warneri (3/33.3)	–	–	1/–	–	–	–	–	–	–	–
S. saprophyticus (1/100)	–	–	1/–	–	–	–	–	–	–	–
S. capitis (1/100)	–	–	1/–	–	–	–	–	1/–	1/–	–
S. cohnii (1/100)	–	–	1/–	–	–	–	–	–	–	–
S. chromogenes (1/0)	–	–	–	–	–	–	–	–	–	–
S. simulans (1/0)	–	–	–	–	–	–	–	–	–	–
S. lugdunensis (2/100)	–	–	–	–	–	2/–	–	–	–	–
Total	41								8	2

H, hands; n, nostrils; SE, staphylococcal enterotoxin.

Likewise, in a study conducted in Brazil with food handlers, researchers found a low percentage of the sec gene in CoNS (Rall et al., 2010). The results from this study demonstrate that coagulase-negative as well as coagulase-positive staphylococci isolated from food handlers harbor enterotoxin-encoding genes. Although enterotoxin production has not been investigated here, the ability of these strains to produce enterotoxins cannot be excluded.

Footnotes

Acknowledgments

The authors would like to acknowledge the financial support received from the FAPERN (Fundação de apoio à Pesquisa do Estado Rio Grande do Norte)/CNPq (Conselho Nacional de Desenvolvimento Científico e Tecnológico) and Dr. Celso José Bruno de Oliveira from the Federal University of Paraiba (UFPB) for providing the standard bacterial strain used as a positive control (S. aureus ATCC 23235).

Disclosure Statement

No competing financial interests exist.

References

Brasil. Vigilância Epidemiológica das Doenças Transmitidas por Alimentos VE-DTA [Epidemiological Surveillance of Foodborne Diseases]. 2014. Available at: http://www.anrbrasil.org.br/new/pdfs/2014/3_PAINEL_1_ApresentacaoRejaneAlvesVigilanciaEpidemiologica-VE-DTA-Agosto_2014_PDF.pdf, accessed November 11, 2014 . (in Portuguese.)

Bresolin

BMZ

, Dall'Stella

, Silva

SEF

. Pesquisa sobre a bactéria Staphylococcus aureus na mucosa nasal e mãos de manipuladores de alimentos em Curitiba/Paraná/Brasil [Nasal and hands carriage of Staphylococcus aureus in food handlers in Curitiba/Parana State, Brazil]. Estudos Biol, 2005; 27:27–32. (in Portuguese.)

Cha

, Lee

, Jung

, Yoo

, Park

, Kim

, Lee

. Molecular analysis of Staphylococcus aureus isolates associated with staphylococcal food poisoning in South Korea. J Appl Microbiol, 2006; 101:864–871.

[CLSI] Clinical and Laboratory Standards Institute. Performance Standards for Antimicrobial Susceptibility Testing: Twenty-Second Information Supplement. CLSI Document M100-S22. Wayne, PA: CLSI, 2013.

Cunha

MLRS

, Peresi

, Calsolari

RAO

, Araujo

JJP

. Detection of enterotoxins genes in coagulase-negative staphylococci isolated from foods. Braz J Microbiol, 2006; 37:64–69.

Dagnew

, Tiruneh

, Moges

, Tekeste

. Survey of nasal carriage of Staphylococcus aureus and intestinal parasites among food handlers working at Gondar University, Northwest Ethiopia. BMC Public Health, 2012; 12:837.

El-Shenawy

, El-Hosseiny

, Tawfeek

, El-Shenawy

, Baghdadi

, Saleh

, Mañes

, Soriano

. Nasal carriage of enterotoxigenic Staphylococcus aureus and risk factors among food handlers—Egypt. Food Public Health, 2013; 3:284–288.

Figueroa

, Caro

, Troncoso

, Faundez

. Carriage of enterotoxin Staphylococcus aureus in food handlers. Rev Med Chile, 2002; 130:859–864.

Fontes

, Silva

, Paiva

MRB

, Garcia

, Resende, Machado

ABF

, Diniz

. Prevalence, antimicrobial resistance, and virulence characteristics of mecA-encoding coagulase-negative staphylococci isolated from soft cheese in Brazil. J Food Sci, 2013; 78:4.

10.

Grando

, Scapin

, Malheiros

, Rossi

, Tondo

. Suscetibilidade a antimicrobianos de Staphylococcus aureus isolados de manipuladores da indústria de laticínios [Antimicrobial susceptibility of Staphylococcus aureus isolated from handlers of dairy industry]. Aliment Nutrição, 2008; 19:467–471. (in Portuguese.)

11.

, O'Donoghue

, Boost

. Occupational exposure to raw meat: A newly-recognized risk factor for Staphylococcus aureus nasal colonization amongst food handlers. Int J Hygiene Environ Health, 2014; 217:347–353.

12.

Holecková

, Holoda

, Fotta

, Kalinácová

, Gondol

, Grolmus

. Occurrence of enterotoxigenic Staphylococcus aureus in food. Ann Agric Environ Med, 2002; 9:179–182.

13.

Jarraud

, Mougel

, Thioulouse

, Lina

, Meugnier

, Forey

, Nesme

, Etienne

, Vandenesch

. Relationships between Staphylococcus aureus genetic background, virulence factors, agr groups (alleles), and human disease. Infect Immun, 2002; 70:631–641.

14.

Johnson

, Tyler

, Ewan

, Ashton

, Pollard

, Rozee

. Detection of genes for enterotoxins, exfoliative toxins, and toxic shock syndrome toxin 1 in Staphylococcus aureus by the polymerase chain reaction. J Clin Microbiol, 1991; 29:426–430.

15.

Kluytmans

JAJW

, Wertheim

HFL

. Nasal carriage of Staphylococcus aureus and prevention of nosocomial infections. Infection, 2005; 33:3–8.

16.

Loncarevic

, Jorgensen

, Lovseth

, Mathisen

, Rorvik

. Diversity of Staphylococcus aureus enterotoxin types within single samples of raw milk and raw milk products. J Appl Microbiol, 2005; 98:344–350.

17.

Lyra

, Sousa

FGC

, Borges

, Givisiez

PEN

, Queiroga

RCRE

, Souza

, Gebreyes

, Oliveira

CJB

. Enterotoxin-encoding genes in Staphylococcus spp. from bulk goat milk. Foodborne Pathog Dis, 2013; 10:126–130.

18.

Marcenovicz

. Avaliação da influência da etapa de salga do abate Shechita na população de S. aureus em carcaça de frango—Caracterização feno e genotípica dos isolados [Evaluation of the influence of salting step of Shechita slaughter in the population of S. aureus in poultry carcasses]. Master's thesis—Faculty of Pharmaceutical Sciences, University of São Paulo, São Paulo State, Brazil, 2012. (in Portuguese.)

19.

Mclauchlin

, Narayanan

, Mithani

, O'Neill

. The detection of enterotoxins and toxic shock syndrome toxin genes in Staphylococcus aureus by polymerase chain reaction. J Food Prot, 2000; 63:479–488.

20.

Mehrotra

, Wang

, Johnson

. Multiplex PCR for detection of genes for Staphylococcus aureus enterotoxins, exfoliative toxin, toxic shock syndrome toxin 1, and methicillin resistance. J Clin Microbiol, 2000; 38:1032–1035.

21.

Murray

, Baron

, et al. Manual of Clinical Microbiology, 9^th ed. Washington, DC: ASM Press, 2007.

22.

Pacheco

, Guth

, Soares

, Nishimura

, Almeida

, Ferreira

. Random amplification of polymorphic DNA reveals serotype-specific clonal clusters among enterotoxigenic Escherichia coli strains isolated from humans. J Clin Microbiol, 1997; 35:1521–1525.

23.

Rall

VLM

, Sforcin

, Augustini

VCM

, Watanabe

, Fernandes

Jr , Rall

, Silva

, Araújo

Jr . Detection of enterotoxin genes of Staphylococcus sp. isolated from nasal cavities and hands of food handlers. Braz J Microbiol, 2010; 41:59–65.

24.

Simsek

, Koruk

, Kopur

, Gurses

. Prevalence of Staphylococcus aureus and intestinal parasites among food handlers in Sanliurfa, Southeastern Anatolia. J Public Health Manag, 2009; 15:518–523.

25.

Udo

, Al-Bustan

, Jacob

, Chugh

. Enterotoxin production by coagulase-negative staphylococci in restaurant workers from Kuwait City may be a potential cause of food poisoning. J Med Microbiol, 1999; 48:819–823.

26.

Vasconcelos

, Pereira

, Araújo Júnior

, Da Cunha

. Molecular detection of enterotoxins E, G, H and I in Staphylococcus aureus and coagulase negative staphylococci isolated from clinical samples of newborns in Brazil. J Appl Microbiol, 2011; 111:749–762.

27.

Vasil

. Etiology of mastites and enterotoxin production by Staphylococcus sp. isolated from milk of two sheep herds. Slovak J Anim Sci, 2007; 40:189–195.

28.

Veras

, Carmo

, Tong

, Shupp

, Cummings

, Santos

, Cerqueira

MOP

, Cantini

, Nicoli

, Jett

. A study of the enterotoxigenicity of coagulase-negative and coagulase-positive staphylococcal isolates from food poisoning outbreaks in Minas Gerais, Brazil. Int J Infect Dis, 2008; 12:410–415.

29.

Vernozy-Rozand

, Mazuy

, Prevost

, Lapeyre

, Bes

, Brun

, Fleurette

. Enterotoxin production by coagulase negative staphylococcal isolated from goats and cheese. Int J Food Microbiol, 1996; 30:271–280.

30.

Wieneke

, Robberts

, Gilbert

. Staphylococcal food poisoning in the United Kingdom, 1969–90. Epidemiol Infect, 1993; 110:519–531.