Prevalence,Virulence Potential,and Antibiotic Susceptibility Profile of Listeria monocytogenes Isolated From Bovine Raw Milk Samples Obtained From Rajasthan,India

Abstract

Listeriosis is a serious foodborne disease of a global concern, and can effectively be controlled by a continuous surveillance of the virulent and multidrug-resistant strains of Listeria monocytogenes. This study was planned to investigate prevalence of L. monocytogenes in bovine raw milk samples. A total of 457 raw milk samples collected from 15 major cities in Rajasthan, India, were analyzed for the presence of L. monocytogenes by using standard microbiological and molecular methods. Five of the 457 samples screen tested positive for L. monocytogenes. Multiplex serotyping showed that 3/5 strains belonged to serotype 4b followed by one strain each to 1/2a and to 1/2c. Further virulence potential assessment indicated that all strains possessed inlA and inlC internalins, and, in addition, two strains also possessed the gene for inlB. All strains were positive for Listeriolysin O (LLO) and showed phosphatidylinositol-specific phospholipase C (PI-PLC) activity on an in vitro agar medium with variations in production levels among the strains. A good correlation between the in vitro pathogenicity test and the chick embryo test was observed, as the strains showing higher LLO and PI-PLC activity were found to be lethal to fertilized chick embryos. All strains were resistant to the majority of antibiotics and were designated as multidrug-resistant strains. However, these strains were susceptible to 9 of the 22 tested antibiotics. The maximum zone of inhibition (mm) and acceptable minimum inhibitory concentration were observed with azithromycin, and thus it could be the first choice of a treatment. Overall, the presence of multidrug-resistant L. monocytogenes strains in the raw milk of Rajasthan region is an indicator of public health hazard and highlighting the need of consumer awareness in place and implementation of stricter food safety regulations at all levels of milk production.

Introduction

Listeriosis is a bacterial disease of serious public health concern. Consumption of contaminated dairy food is as one of the main causes of listeriosis in humans (Barancelli et al., 2014). In humans, this foodborne pathogen may cause septicemia, stillbirth, and meningitis especially in elderly, pregnant, and immunocompromised individuals (Vázquez-Boland et al., 2001), whereas in animals it may cause mastitis, abortion, and gastroenteritis (Wesley, 1999). Listeria monocytogenes has been observed in several milk processing environments at various stages of production (Barancelli et al., 2014), leading to higher chances of cross-contamination of the finished products (Stessl et al., 2014).

Although pasteurization destroys the bacterium in raw milk, this process does not eliminate the risk of contamination in the dairy chain. In a study from Finland, it was noticed that the dairy products actually prepared from pasteurized milk might become contaminated with the cells of L. monocytogenes at various stages of production (Lyytikäinen et al., 2000). Besides, the ability of L. monocytogenes to survive under harsh conditions and to form biofilm further intensifies the threat to dairy industry. This in turn poses extra economical burden on the industry in terms of analysis cost and possible product recalls.

As on today, 13 serotypes of L. monocytogenes are prevalent, and majority (>95%) of those obtained from contaminated food and infected humans include the 1/2a, 1/2b, and 4b serotypes (Orsi et al., 2011); and of these, 4b is most virulent (Martins and Germano, 2011). Thus, the characterization of isolates at the serogroup level is crucial in the prevention of listeriosis spread.

Of the various available sero-grouping methods, polymerase chain reaction (PCR)-based method is convenient in operation and economical. However, nowadays more superior, accurate, fast, and better discriminatory methods based on whole genome sequencing (WGS) are becoming the method of choice in national reference laboratories to compare patient, food, and environmental isolates than conventional methods (Hyden et al., 2016). Likewise, the characterization of virulence genes (inlA, inlB, inlC and inlJ) responsible for establishing infectious cycle (Bierne et al., 2007) and assessing the production of toxic enzymes (Listeriolysin O, LLO) under in vitro and in vivo conditions in suitable infectious models help understand its virulence and pathogenic potential.

Generally, Listeria strains are susceptible to most of the antibiotics, but indiscriminate antibiotic use has led to the emergence of antibiotic-resistant Listeria spp., which has now become a public health risk. Resistant strains of L. monocytogenes have been obtained from raw milk samples (Jamali et al., 2013) and from dairy farms (Srinivasan et al., 2005). The monitoring of multidrug-resistant pathogens isolated from milk samples could be useful to update the present antibiotic resistance patterns.

India is the largest producer of milk in the world and Rajasthan holds second position among all the Indian states. Furthermore, only 15% of the total produced milk in the country is processed by dairy sector, rest 85% through informal channels (FAO, 2013). Thus, in such cases there are ample chances that the milk might be consumed as raw at homes or traditionally processed into different dairy foods (Doijad et al., 2011). Besides this, the prevalent hygiene levels in dairies and the awareness rate in milk handlers about the safe milk production in India, including Rajasthan are still below the satisfactory level (Lingathurai and Vellathurai, 2010; Sharma et al., 2015). There are no prerequisite standards for quality milk productions prescribed to the farmers in the country.

Earlier many reports concerning prevalence of L. monocytogenes have been published from other parts of India (Barbuddhe et al., 2016), but there is no such report from the state of Rajasthan. Therefore, the present study was designed to investigate (1) the presence of L. monocytogenes in raw bovine milk samples in Rajasthan, India, and (2) to characterize them into serogroups, their genetic variability and virulotypes, and (3) assessing their pathogenicity potential and antimicrobial resistance.

Materials and Methods

Sampling

A total of 457 raw milk samples were collected from different dairy farms situated in 15 major cities in Rajasthan, India, from May 2014 to November 2015. The samples were quickly transported to the laboratory at 4°C and analyzed immediately.

Isolation and identification

A slightly modified method of McClain and Lee (1987) was used for the isolation of L. monocytogenes strains. Briefly, 25 mL of homogenized raw milk sample was added to 225 mL of Listeria enrichment broth (HiMedia, Mumbai India), mixed for 2 min and incubated at 37°C for 24 h. After that, 1 mL of sample was transferred to 9 mL of Fraser broth and incubated for 24 h at 37°C. At the end of incubation, 10-fold serial dilutions (10^–1 to 10^–5) were prepared in 0.1% sterile peptone water and a 100 μL aliquot from each dilution was poured on the Listeria chromogenic agar supplemented with Listeria selective supplement (HiMedia, Mumbai India). After 24–48 h of incubation at 37°C, typical bluish-green colonies with yellow halo were picked and transferred to brain heart infusion tubes to proceed for Gram staining and catalase test. Presumptive positive results were also tested by the API Listeria Kit (bioMérieux, Marcy-l'Étoile France) for confirmative purposes.

Molecular characterization

Only the presumptively identified L. monocytogenes were processed for PCR. For that, genomic DNA was extracted as described by Pospiech and Neumann (1995). U1/LI1 (938 bp) primers were used for the identification of Listeria spp. (Table 1), whereas primers LM1/LM2 (702 bp, Table 1) corresponding to Listeriolysin O were used for L. monocytogenes identification. The PCR cycling conditions were those as described by the respective authors. A T100™ Thermal cycler (Bio-Rad Laboratories, Gurgaon, Haryana, India) was used for all PCR applications during the whole study. Amplified PCR products were stained with ethidium bromide and visualized using a gel documentation system (Bio-Rad Laboratories).

Table 1.

Primers Used for Amplification of Listeria spp. (1), 16S rRNA Sequencing (2) Listeria monocytogenes (3), Serogrouping (4–7), and Virulence-Associated Genes (8–11)

S. No.	Target gene	Primer sequence (5′-3′)	Product size (bp)	Serogroup	Reference
1	16S rRNA(U1/LI1)	For: CAGCMGCCGCGGTAATWC	938	—	Border et al. (1990)
		Rev: CTCCATAAAGGTGACCCT
2	Bacterial universal primers (27F/519R)	For: AGAGTTTGATCCTGGCTCAG	∼550		Lane (1991)
		Rev: GWATTACCGCGGCKGCTG
3	hly(LM1/LM2)	For: CCTAAGACGCCAATCGAA	702	—	Border et al. (1990)
		Rev: AAGCGCTTGCAACTGCTC
4	lmo1118	For: AGGGGTCTTAAATCCTGGAA	906	1/2c, 3c	Doumith et al. (2004)
		Rev: CGGCTTGTTCGGCATACTTA
5	lmo0737	For: AGGGCTTCAAGGACTTACCC	691	1/2a, 3a	Doumith et al. (2004)
		Rev: ACGATTTCTGCTTGCCATTC
6	ORF2819	For: AGCAAAATGCCAAAACTCGT	471	1/2b, 3b, 4b, 4d, 4e	Doumith et al. (2004)
		Rev: CATCACTAAAGCCTCCCATTG
7	ORF2110	For: AGTGGACAATTGATTGGTGAA	597	4b, 4d, 4e	Doumith et al. (2004)
		Rev: CATCCATCCCTTACTTTGGAC
8	inlA	For: ACGAGTAACGGGACAAATGC	800	—	Liu et al. (2007)
		Rev: CCCGACAGTGGTGCTAGATT
9	inlB	For: TGGGAGAGTAACCCAACCAC	884	—	Liu et al. (2007)
		Rev: GTTGACCTTCGATGGTTGCT
10	inlC	For: AATTCCCACAGGACACAACC	517	—	Liu et al. (2007)
		Rev: CGGGAATGCAATTTTTCACTA
11	inlJ	For: TGTAACCCCGCTTACACAGTT	238	—	Liu et al. (2007)
		Rev: AGCGGCTTGGCAGTCTAATA

16S rRNA sequencing

For further confirmation, all PCR identified L. monocytogenes isolates were subjected to 16S rRNA region sequencing by using the bacterial universal primers (Lane, 1991; Table 1) and PCR protocol described by (Rao et al., 2015). The sequencing facility was outsourced from Eurofins Genomics, Bengaluru, India. As per supplied information the amplified PCR products were purified by sodium acetate–ethanol precipitation and a 2 μL of product was sequenced for both primers using the Big Dye Terminator Cycle Sequencing Kit (Applied Biosystem, Foster City, CA, USA). The reactions were performed on an Applied Biosystem ABI 3730 (Applied Biosystem) automated genetic analyzer. The generated partial sequences were then searched for percent homology on NCBI by doing nBLAST and finally submitted to NCBI GenBank for accession number.

Serogrouping

Serogroups were categorized based on the multiplex PCR method (Doumith et al., 2004). The primer pairs used are mentioned in Table 1.

Pulsed-field gel electrophoresis

Subtyping of L. monocytogenes isolates was performed by pulsed-field gel electrophoresis (PFGE) as per CDC PulseNet procedure (Graves and Swaminathan, 2001). The prepared agarose plugs were digested with 25 U of AscI (Thermo Scientific, Waltham, MA, USA) at 37°C for 3 h and 50 U of ApaI (Thermo Scientific). The plugs were then loaded on 1% PFGE certified agarose gel and run in 0.5 × TBE buffer on a CHEF-Mapper System (Bio-Rad Laboratories). A lambda DNA (λ) ladder (Bio-Rad Laboratories) was used as molecular DNA marker. The gels were stained with ethidium bromide and images were captured by Syngene G-Box imagining system (Syngene Bioimaging Private Ltd., Gurgaon, Haryana, India). The obtained PFGE patterns were analyzed using BioNumerics (version 7.6) software package (Applied Maths, Sint-Martens-Latem, Belgium). Dendrogram was prepared by using the Dice band-based similarity coefficient (position tolerance 1.0%) and the unweighted pair group method with arithmetic averages as cluster analysis method.

Virulence determinants

The standardized multiplex PCR method (Liu et al., 2007) was used to determine the virulence genes. The primers used for inlA, inlB, inlC, and inlJ virulence genes are listed in Table 1.

Hemolytic activity

The hemolytic activity in the supernatant of isolates was quantified as described by Sampathkumar et al. (1998) and Upadhyay et al. (2012) with minor modification. The concentration of culture was adjusted to McFarland standard 1.0. Percent hemolysis was calculated as per the formula provided by Bhakdi et al. (1984).

%Hemolysis = (1 − OD_s/OD_t) × 100, where OD_s and OD_t represents the differences in optical density at 600 nm between the sample and positive control (100% hemolysis) and between negative control (nonhemolyzed) and positive control, respectively.

Phosphatidylinositol-specific phospholipase C activity

A slightly modified method of Leclercq (2004) was used to ascertain the phosphatidylinositol-specific phospholipase C (PI-PLC) activity of L. monocytogenes. A single colony was streaked on L. mono differential agar (HiMedia, Mumbai, India), and analyzed for the presence of light greenish centered colonies with yellow to transparent halo after 24–48 h (37°C) of incubation (Negi et al., 2015).

Chick embryo toxicity test

The in vivo pathogenicity of the strains was assessed by performing chick embryo toxicity test with minor modifications (Olier et al., 2002). Ten-day-old fertilized eggs were purchased from Khatipura Poultry Farm, Jaipur, India and five eggs were used for one strain. Eggs inoculated only with phosphate-buffered saline (pH 7.2) were taken as control. Strains were considered pathogenic, if they caused mortality within 5 days postinoculation.

Antibiotic susceptibility

Following antibiotic E-strips (bioMérieux, Marcy-l'Etoile, France); penicillin G, vancomycin, ciprofloxacin, rifampicin, gatifloxacin, chloramphenicol, teicoplanin, amikacin, ampicillin, azithromycin, amoxicillin–clavulanic acid, nalidixic acid, gentamicin, piperacillin, oxacillin, kanamycin, tetracycline, ceftazidime, ceftriaxone, norfloxacin, linezolid, and streptomycin were used to determine the minimum inhibitory concentration (MIC) by following the manufacturer's instructions. Briefly, cultures were grown to 0.5 McFarland turbidity; thereafter, a sterile swab soaked in the bacterial suspension was streaked on the Mueller-Hinton agar plates (HiMedia, Mumbai, India). The E-strips were gently placed on the plates and incubated at 37°C for 18–24 h. The strains were categorized resistant (R), intermediately resistant (I) and sensitive (S) on the basis of zone of inhibition(s) (mm) (Clinical and Laboratory Standards Institute (CLSI), 2015). As CLSI has given breakpoints for fewer antimicrobials such as ampicillin and penicillin; therefore guidelines given for Staphylococci and Enterococcus were employed (Conter et al., 2009; Li et al., 2007). The MIC values were interpreted based on the manufacturer's instructions.

Results

Isolation and identification of L. monocytogenes

Of the 457 raw milk samples, 5 samples (1.1%) were found presumably positive for L. monocytogenes on the basis of colony color characteristic and API identification (Table 2). The PCR confirmation of five isolates revealed that all were L. monocytogenes as they give band at the expected size in independent PCR assays.

Table 2.

Identification of Listeria spp. by the API Listeria Kit

		Reactions
		Strains
Tests	Active ingredients	LMRM28	LMRMSH66	LRMJPC185	LMRM79	LMRMBP2
DIM	Enzymatic substrate	−	−	−	−	−
ESC	Esculin ferric citrate	+	+	+	+	+
αMAN	4-nitrophenyl-αd-mannopyranoside	+	+	+	+	−
DARL	d-Arabitol	+	+	+	−	+
XYL	d-Xylose	−	−	−	−	−
RHA	l-Rhamnose	+	+	+	−	+
MDG	Methyl-αd-glucopyranoside	+	+	+	+	+
RIB	d-Ribose	−	−	−	−	−
G1P	Glucose-1-phosphate	−	−	−	−	−
TAG	d-Tagatose	−	−	−	−	−

16S rRNA sequencing

The nBLAST results showed a sequence similarity of 92–97% and all isolates were found closely related to L. monocytogenes (GeneBank Accession Numbers: KX911246–KX911250).

Multiplex PCR serogrouping

Of the five L. monocytogenes, three strains belonged to serogroup “4b, 4d, 4e” and subsequently one each to “1/2c, 3c” and” 1/2a 3a” (Table 3).

Table 3.

Prevalence of Listeria monocytogenes in Raw Milk Samples, Their Serogrouping and Pathogenicity Profile

					Pathogencity profile of L. monocytogenes isolates
Isolate	Sample	Source	Region	Serotype	Hemolysis (LLO) (%)	PI-PLC	inlA	inlB	inlC	inlJ	CET ^a
LMRMBP2^b,c	RMBP2	Buffalo milk	Bharatpur	1/2a, 3a	83.80	+++	+	+	+	−	+
LMRM79	RM79	Cow milk	Bhilwara	1/2c, 3c	28.17	+	+	+	+	−	−
LMRM28^b,d	RM28	Cow milk	Jaipur	4b, 4d, 4e	62.92	++	+	−	+	−	+
LMRMSH66^b,c	RMSH66	Cow milk	Sirohi	4b, 4d, 4e	58.33	++	+	−	+	−	+
LMRMJPC185	RMJPC185	Cow milk	Jaipur	4b, 4d, 4e	58.04	+	+	−	+	−	−

Chick embryo test in vivo.

Strains caused mortality in fertilized chick embryos.

Does mortality after 3 days of inoculation.

Does mortality after 4 days of inoculation.

BP, Bharatpur; JPC, Jaipur; LLO, Listeriolysin O; LM, Listeria monocytogenes; PI-PLC, phosphatidylinositol-specific phospholipase C; RM, Raw milk; SH, Sirohi.

PFGE analysis

PFGE analysis by AscI and ApaI enzymes revealed five distinct pulsotypes (Fig. 1). The isolates were considered to have similar pulsotypes when the numbers and position of bands were indistinguishable (Gianfranceschi et al., 2009).

FIG. 1.

Dendrogram obtained from PFGE profile of AscI and ApaI macrorestriction among Listeria monocytogenes isolates obtained from raw milk samples. PFGE, pulsed-field gel electrophoresis.

Determination of virulence genes

The results demonstrated that all five L. monocytogenes isolates were harboring inlA and inlC genes. In two isolates, besides the aforementioned genes, inlB gene was also present. No isolate was found to have inlJ gene (Table 3).

Hemolysis and PI-PLC activity

Of the five strains, one strain was found to be highly hemolytic (>66% hemolysis), whereas three strains showed moderate hemolysis (>33–66% hemolysis). The remaining one strain showed low hemolysis (below 33% hemolysis) (Table 3). Likewise, strong PI-PLC activity was also demonstrated by one strain only and by others mild to weak activity was shown (Table 3).

Chick embryo pathogenicity test

Out of the five isolates, three were considered as pathogenic as they caused mortality in the chick embryos within 5 days after inoculation (Table 3).

Antimicrobial resistance

Overall, all strains showed 100% resistance to four antibiotics (Table 4) Four, three, and one of the strains showed resistance to three, one, and five antibiotics, respectively. One out of five strains exhibited intermediate level of resistance to three antibiotics. All strains were susceptible to other antibiotics.

Table 4.

Antibiotic Resistance Profile of L. monocytogenes Isolated from Raw Milk Samples

	L. monocytogenes strains					Number of isolates (%)
Antibiotic(s)	LMRMBP2	LMRMSH66	LMRM79	LMRM28	LMRMJPC185	Susceptible	Intermediate	Resistant
Penicillin G	R	R	R	R	R	0	0	5/5 (100)
Vancomycin	S	S	S	S	S	5/5 (100)	0	0
Ciprofloxacin	S	S	S	S	S	5/5 (100)	0	0
Rifampicin	S	R	S	S	S	4/5 (80)	0	1/5 (20)
Gatifloxacin	S	S	S	S	S	5/5 (100)	0	0
Chloramphenicol	S	R	S	S	S	4/5 (80)	0	1/5 (20)
Teicoplanin	S	R	S	S	S	4/5 (80)	0	1/5 (20)
Amikacin	S	S	S	S	S	5/5 (100)	0	0
Ampicillin	R	I	R	R	R	0	1/5 (20)	4/5 (80)
Azithromycin	S	S	S	S	S	5/5 (100)	0	0
Amoxicillin–Clavulanic acid	R	I	R	R	R	0	1/5 (20)	4/5 (80)
Nalidixic acid	R	S	R	R	R	1/5 (20)	0	4/5 (80)
Gentamicin	S	S	S	S	S	5/5 (100)	0	0
Piperacillin	R	R	R	R	R	0	0	5/5 (100)
Oxacillin	R	R	R	R	R	0	0	5/5 (100)
Kanamycin	S	S	S	S	S	5/5 (100)	0	0
Tetracycline	R	S	S	S	S	4/5 (80)	0	1/5 (20)
Ceftazidime	R	S	I	R	R	1/5 (20)	1/5 (20)	3/5 (60)
Ceftriaxone	R	R	R	R	R	0	0	5/5 (100)
Norfloxacin	S	S	S	S	S	5/5 (100)	0	0
Linezolid	S	R	S	S	S	4/5 (80)	0	1/5 (20)
Streptomycin	S	S	S	S	S	5/5 (100)	0	0

Antibiotic concentration impregnated in E-strips: Pencillin G to Gatifloxacin 0.002–32; Chloramphenicol to Linezolid 0.016–256; Streptomycin 0.064–1024.

I, intermediate resistant; R, resistant; S, susceptible.

Discussion

Milk and milk products get inadvertently contaminated with L. monocytogenes at various stages of production; and consumption of such products might always be a risk factor for listeriosis (Jamali et al., 2013). In the present study, L. monocytogenes were isolated, identified, and confirmed from bovine raw milk samples using microbiological media plating, PCR, and 16S rRNA approaches. Earlier, many authors (Cetinkaya et al., 2014; Soni and Dubey, 2014: Jamali et al., 2013) have used these ideal approaches for the isolation, genotypic identification, and validation of L. monocytogenes from different sources and coincide with our findings.

Herein, 1.1% of the tested samples were found to be contaminated with L. monocytogenes. This concords with earlier findings from India on raw milk samples that reported presence of L. monocytogenes (Bhilegaonkar et al., 1997; Barbuddhe et al., 2002; Kalorey et al., 2008; Doijad et al., 2011; Karthikeyan et al., 2015). However, the noticed prevalence is lower than the mentioned studies. Several factors, such as soil, milking equipments, milking environment, sick animals, manure, and poor forage quality at dairy farms, have been recognized as the source of Listeria contamination in raw milk (Oliver et al., 2005).

Serogrouping is important for two reasons: first, it helps epidemiologists screen the involvement of a serogroup in an outbreak; and second in linking the evidences with cases. In the present study, most strains belonged to the serogroup “4b, 4d, 4e” and few to other serogroups (“1/2a, 3a” and “1/2c, 3c”). Similar variations in serogroups among L. monocytogenes strains have been observed in earlier studies (Aurora et al., 2009; Cetinkaya et al., 2014). The very high percentage reported in the present study concerning serogroup “4b, 4d, 4e” concords well with Hamdi et al. (2007), where all of the analyzed raw milk L. monocytogenes isolates belonged to serogroup “4b, 4d, 4e.” Similarly, Karthikeyan et al. (2015) observed that out of 15 L. monocytogenes isolates, eight belonged to serogroup “4b, 4d, 4e.” However, Jamali et al. (2013) reported that majority of L. monocytogenes strains isolated in their case were of serogroup “1/2a, 3a” type.

It has been reported that at a global level, serogroups 1/2a, 1/2b, and 4b are involved in >98% of human foodborne listeriosis (Liu, 2006). Despite the fact that serotype 1/2a is largely retrieved from food samples; the majority of human listeriosis cases have a preponderance of serotype 4b. The disparity noticed between the occurrence of serotype 4b in food and human listeriosis cases suggests that serotype 4b is more virulent. Other serotypes (3a, 3b, 4d, and 4e) have also often been reported from food samples (Cetinkaya et al., 2014). Here, one strain was also found to belong to serogroup 1/2c, which is not frequently detected in early milk epidemiological studies.

To have deeper epidemiological insight among the isolates, all strains were subjected for their genetic diversity analysis using PFGE. From long ago, worldwide PFGE is used by several researchers and diagnostic laboratories for subtyping and comparison of L. monocytogenes strains obtained from diverse regions and sources (Negi et al., 2015). Because of the high discriminatory power and reproducibility of PFGE it is considered as gold standard method for the subtyping of L. monocytogenes (Gerner-Smidt et al., 2006). In this study, PFGE investigation provides discrimination among the isolates of the same serogroup as well as among different serogroups isolated from different regions. Furthermore, the dendrogram analysis revealed that two isolates (LMRM28 and LMRMSH66) belonging to serogroup 4b, 4d, and 4e isolated were very closer in genetic similarity provided the fact that they were isolated from different places. These observations pointed a possible epidemiological association between these strains.

Similar findings were reported by pervious investigators (Aurora et al., 2009; Fox et al., 2012; Negi et al., 2015) who found close similarity among the L. monocytogenes strains of the same serogroup. On the other hand, two isolates (LMRMJPC185 and LMRM79) having closer PFGE profile belonging to different serogroups (4b, 4d, 4e and 1/2c, 3c) were isolated from different areas. Similar findings were reported from others (Mazurier and Wernars, 1992; Aurora et al., 2009), where strains belonged to different sergroups and were isolated from different areas having identical profiles. The remaining one isolate recovered from different area has a totally different PFGE profile than other four isolates. Thus, our results clearly demonstrate the contamination by genetically different strains to the raw milk from surveyed region and that may cause disease in animals and humans. In fact such strains may be liable for posing illness in humans and animals, and their adjoining environment. In future, analyzing of such strains by current modern techniques based on WGS will surely help us in getting a clear-cut resolution that enhance outbreak detection and investigation due to better interpretation, as PFGE only provides limited genetic resolution (Jackson et al., 2016).

Generally, L. monocytogenes strains are considered pathogenic, but their virulence potential varies from one strain to another and depends on certain genetic determinants (Neves et al., 2008). Several methods have been developed to analyze the virulence potential, but among them, PCR-based identification of virulent genes has emerged as a preferable one due to some added advantages. Genes (inlA and inlB) help the bacterium internalize mammalian cells, whereas inlC promotes the intracellular spread of infection. The exact function of inlJ is still unknown. Liu et al. (2007) suggested that inlJ helps in discriminating virulent L. monocytogenes from avirulent ones. However, others have reported some strains in which no inlJ gene is present, but still they cause mortality in mouse through intraperitoneal route (Liu et al., 2006; Roberts et al., 2006). The presence of these genes in strains, however, does not certainly indicate that these strains will cause infections in humans through conventional oral ingestion.

In our study, genes for invasiveness and infection process were present in all five isolates (Table 3). Indeed, in two isolates an additional internalin gene inlB was also present that further increases their affinity for liver and spleen tissues (Bierne et al., 2007). Surprisingly, gene inlJ was not detected among the tested strains; this might be due to a defect or mutation present at primer binding sites resulting in the failure of the primers to amplify the concerned gene (Lomonaco et al., 2013; Negi et al., 2015). Similar findings have also been observed in other studies dealing with different virulence genes (Lomonaco et al., 2013). The present results indicate that these strains have the potential to establish human listeriosis and thereby may cause mortality, if enter through the intraperitoneal route.

Earlier we have noted the presence of hemolysin/LLO-producing gene (hly) by means of PCR, but it might be possible that the protein formed by this gene is truncated. Functional LLO helps the bacterium escape from the phagosomes into the cytosol of the infected cell and protects it from the extracellular immune response. However, this vacuolar disruption is facilitated by PI-PLC group of proteins: PLC-A and PLC-B (Poussin et al., 2009). In this study, all analyzed isolates showed the ability to produce LLO and PI-PLC proteins, which further affirms them being pathogenic. We observed variations in the LLO- and PI-PLC-producing abilities of strains; this disparity in activities might be due to noncoordination of genes responsible for these functions (Shakuntala et al., 2006; Kaur et al., 2010). In addition, hemolysin activity is also interfered during successive subculturing through culture media (Dudhe et al., 2014). The obtained results were in full agreement with those of earlier studies (Momtaz and Yadollahi, 2013; Dudhe et al., 2014; Osman et al., 2014).

We observed that some of the strains tested presented lethal activity in chicken embryos after 5 days of inoculation. Thus these strains indirectly reflected their potential to cause human infections. Similar findings have also been reported by others (Shoukat et al., 2014; Negi et al., 2014).

A successful treatment of listeriosis lies in the early administration of antibiotics with a good bactericidal activity (Hof, 2004). The present observations revealed that the isolates were having high resistance to penicillin G, azithromycin, piperacillin, oxacillin, ceftriaxone, ampicillin, amoxicillin–clavulanic acid, and nalidixic acid and to a lesser extent to ceftazidime, linezolid, tetracycline, teicoplanin, chloramphenicol, and rifampicin (Table 4). These antibiotics are routinely used in the clinical management of listeriosis (Nwachukwu et al., 2010). It can be inferred that this high resistance profile might be due to frequent use of these antibiotics in veterinary practices in controlling infections and to cure human diseases in Rajasthan. The acquisition of mobile genetic elements like self-transferable plasmids and conjugative transposons can be considered as most probable cause of resistance development among these strains.

In addition, environmental factors that bring about mutations in the chromosomal genes might also aid in conferring resistance to L. monocytogenes. Results concerning the resistance of these strains to the aforementioned antibiotics are in line with the earlier findings (Rahimi et al., 2010; Soni et al., 2013; Dudhe et al., 2014). However, all isolates were sensitive to most of the tested antibiotics, similar to other reports (Aureli et al., 2003; Arslan and Özdemir, 2008; Filiousis et al., 2009; Cetinkaya et al., 2014). Interestingly, some authors have also reported vancomycin-resistant strains of L. monocytogenes (Harakeh et al., 2009; Yan et al., 2010). The importance of these antibiotics in the treatment of infections in humans and animals adds to our findings a great value. Furthermore, multidrug-resistant strains of L. monocytogenes have been reported in many previous studies (Jamali et al., 2013; Soni et al., 2013; Dudhe et al., 2014) and again our results in this respect are consistent with those. Importantly, the presence of multidrug-resistant strains in this region puts a question mark about listeriosis treatment and warns a potential threat to public health.

Conclusion

The presence of virulent strains of L. monocytogenes in raw milk samples indicates that unpasteurized milk and traditional dairy products could serve as a vehicle for foodborne listeriosis especially in high-risk groups. The PFGE results obtained in this study may be helpful in reinterpreting the epidemiological prevalence of L. monocytogenes in the studied region and India. Besides, multiple drug resistance noticed against commonly used clinical antimicrobials for listeriosis treatment poses a serious threat to public health. The information generated in this study is highly useful for the veterinarians engaged in controlling the risks of L. monocytogenes and tackling antibiotic resistance among strains.

Footnotes

Acknowledgment

This study was part of a project on milk quality and safety, funded by Rashtriya Krishi Vikas Yojana (RKVY), Government of Rajasthan, India.

Disclosure Statement

No competing financial interests exist.

References

Arslan

, Özdemir

. Prevalence and antimicrobial resistance of Listeria spp. in homemade white cheese. Food Control, 2008; 19:360–363.

Aureli

, Ferrini

, Mannoni

, Hodzic

, Wedell-Weergaard

, Oliva

. Susceptibility of Listeria monocytogenes isolated from food in Italy to antibiotics. Int J Food Microbiol, 2003; 83:325–330.

Aurora

, Prakash

. Genotypic characterization of Listeria monocytogenes isolated from milk and ready-to-eat indigenous milk products. Food Control, 2009; 20:835–839.

Barancelli

, Camargo

, Gagliardi

, et al. Pulsed-field gel electrophoresis characterization of Listeria monocytogenes isolates from cheese manufacturing plants in São Paulo, Brazil. Int J Food Microbiol, 2014; 173:21–29.

Barbuddhe

, Chaudhari

, Malik

. The occurrence of pathogenic Listeria monocytogenes and antibodies against listeriolysin‐O in buffaloes. J Vet Med, 2002; 49:181–184.

Barbuddhe

, Doijad

, Goesmann

, et al. Presence of a widely disseminated Listeria monocytogenes serotype 4b clone in India. Emerg Microbes Infect, 2016; 5:e55.

Bhakdi

, Roth

, Sziegoleit

, Tranum-Jensen

. Isolation and identification of two hemolytic forms of streptolysin-O. Infect Immun, 1984; 46:394–400.

Bhilegaonkar

, Kulshrestha

, Kapoor

, Kumar

, Agarwal

, Singh

. Isolation of Listeria monocytogenes from milk. J Food Sci Tech, 1997; 34:248–250.

Bierne

, Sabet

, Personnic

, Cossart

. Internalins: A complex family of leucine-rich repeat-containing proteins in Listeria monocytogenes . Microb Infect, 2007; 9:1156–1166.

10.

Border

, Howard

, Plastow

, Siggens

. Detection of Listeria species and Listeria monocytogenes using polymerase chain reaction. Lett Appl Microbiol, 1990; 11:158–162.

11.

Cetinkaya

, Elal Mus

, Yibar

, Guclu

, Tavsanli

, Cibik

. Prevalence, serotype identification by multiplex polymerase chain reaction and antimicrobial resistance patterns of Listeria monocytogenes isolated from retail foods. J Food Safety, 2014; 34:42–49.

12.

Clinical and Laboratory Standards Institute. Performance Standards for Antimicrobial Susceptibility Testing; 25th Informational Supplement. CLSI Document M100-S24. Wayne, PA: Clinical and Laboratory Standards Institute, 2015.

13.

Conter

, Paludi

, Zanardi

, Ghidini

, Vergara

, Ianieri

Characterization of antimicrobial resistance of foodborne Listeria monocytogenes . Int J Food Microbiol, 2009; 128:497–500.

14.

Doijad

, Barbuddhe

, Garg

, et al. Incidence and genetic variability of Listeria species from three milk processing plants. Food Control, 2011; 22:1900–1904.

15.

Doumith

, Buchrieser

, Glaser

, Jacquet

, Martin

. Differentiation of the major Listeria monocytogenes serovars by multiplex PCR. J Clin Microbiol, 2004; 42:3819–3822.

16.

Dudhe

, Chaudhary

, Pantawane

, Namdeorao

, Hirde

TPR

, Zade

. In vitro characterization of Listeria monocytogenes isolates by Haemolysis, Camp, Piplc Assay with protein profiling and antibiotic resistance recovered from Nagpur region. Adv Anim Vet Sci, 2014; 2:321–328.

17.

FAO. (2013). A report on milk and milk products. Food and agricultural organization, United States. Available at: www.milkproduction.com/Library/Editorial-articles/FAO-Food-Outlook-Nov-2013---Milk-and-Milk-products/, accessed March 25, 2016

18.

Filiousis

, Johansson

, Frey

, Perreten

. Prevalence, genetic diversity and antimicrobial susceptibility of Listeria monocytogenes isolated from open-air food markets in Greece. Food Control, 2009; 20:314–317.

19.

Fox

, Garvey

, McKeown

, Cormican

, Leonard

, Jordan

. PFGE analysis of s isolates of clinical, animal, food and environmental origin from Ireland. J Med Microbiol, 2012; 61:540–547.

20.

Gianfranceschi

, D'Ottavio

, Gattuso

, Bella

, Aureli

. Distribution of serotypes and pulsotypes of Listeria monocytogenes from human, food and environmental isolates (Italy 2002–2005). Food Microbiol, 2009; 26:520–526.

21.

Gerner-Smidt

, Hise

, Kincaid

, et al. PulseNet USA: A five-year update. Foodbourne Pathog Dis, 2006; 3:9–19.

22.

Graves

, Swaminathan

. PulseNet standardized protocol for subtyping Listeria monocytogenes by macrorestriction and pulsed-field gel electrophoresis. Int J Food Microbiol, 2001; 65:55–62.

23.

Harakeh

, Saleh

, Zouhairi

, Baydoun

, Barbour

, Alwan

. Antimicrobial resistance of Listeria monocytogenes isolated from dairy-based food products. Sci Total Environ, 2009; 407:4022–4027.

24.

Hof

An update on the medical management of listeriosis. Expert Opin Pharmacother, 2004; 5:1727–1735.

25.

Hyden

, Pietzka

, Lennkh

, et al. Whole genome sequence-based serogrouping of Listeria monocytogenes isolates. J Biotechnol, 2016; 235:181–186.

26.

Jackson

, Tarr

, Strain

, et al. Implementation of nationwide real-time whole-genome sequencing to enhance Listeriosis outbreak detection and investigation. Clin Infect Dis, 2016; 63:380–386.

27.

Jamali

, Radmehr

, Thong

. Prevalence, characterisation, and antimicrobial resistance of Listeria species and Listeria monocytogenes isolates from raw milk in farm bulk tanks. Food Control, 2013; 34:121–125.

28.

Kalorey

, Warke

, Kurkure

, Rawool

, Barbuddhe

. Listeria species in bovine raw milk: A large survey of Central India. Food Control, 2008; 19:109–112.

29.

Karthikeyan

, Gunasekaran

, Rajendhran

. Molecular serotyping and pathogenic potential of Listeria monocytogenes isolated from milk and milk products in Tamil Nadu, India. Foodborne Pathog Dis, 2015; 12:522–528.

30.

Kaur

, Malik

, Bhilegaonkar

, Vaidya

, Barbuddhe

. Use of a phospholipase-C assay, in vivo pathogenicity assays and PCR in assessing the virulence of Listeria spp. Vet J, 2010; 184:366–370.

31.

Lane

16S/23S rRNA Sequencing. Nucleic Acid Techniques in Bacterial Systematics. Chichester, UK: John Wiley and Sons. 1991, pp. 125–175.

32.

Leclercq

Atypical colonial morphology and low recoveries of Listeria monocytogenes strains on Oxford, PALCAM, Rapid'L. mono and ALOA solid media. J Microbiol Methods, 2004; 57:251–258.

33.

, Sherwood

, Logue

Antimicrobial resistance of Listeria spp. recovered from processed bison. Lett Appl Microbiol, 2007; 44:86–91.

34.

Lingathurai

, Vellathurai

. Bacteriological quality and safety of raw cow milk in Madurai, South India. Bangladesh J Sci Ind Res, 2010; 48:1–10.

35.

Liu

Identification, subtyping and virulence determination of Listeria monocytogenes, an important foodborne pathogen. J Med Microbiol, 2006; 55:645–659.

36.

Liu

, Lawrence

, Austin

, Ainsworth

. A multiplex PCR for species- and virulence-specific determination of Listeria monocytogenes . J Microbiol Methods, 2007; 71:133–140.

37.

Liu

, Lawrence

, Wiedmann

, et al. Listeria monocytogenes subgroups IIIA, IIIB, and IIIC delineate genetically distinct populations with varied pathogenic potential. J Clin Microbiol, 2006; 44:4229–4233.

38.

Lomonaco

, Verghese

, Gerner-Smidt

, et al. Novel epidemic clones of Listeria monocytogenes, United States, 2011. Emerg Infect Dis, 2013; 19:147–150.

39.

Lyytikäinen

, Autio

, Maijala

, et al. An outbreak of Listeria monocytogenes serotype 3a infections from butter in Finland. J Infect Dis, 2000; 181:1838–1841.

40.

Martins

, Germano

PML

. Listeria monocytogenes in ready-to-eat, sliced, cooked ham and salami products, marketed in the city of São Paulo, Brazil: Occurrence, quantification, and serotyping. Food Control, 2011; 22:297–302.

41.

Mazurier

S-I

, Wernars

. Typing of Listeria strains by random amplification of polymorphic DNA. Res Microbiol, 1992; 143:499–505.

42.

McClain

, Lee

. Development of USDA-FSIS method for isolation of Listeria monocytogenes from raw meat and poultry. J AOAC Int, 1987; 71:660–664.

43.

Momtaz

, Yadollahi

. Molecular characterization of Listeria monocytogenes isolated from fresh seafood samples in Iran. Diagn Pathol, 2013; 8:1–6.

44.

Negi

, Vergis

, Vijay

, et al. Genetic diversity, virulence potential and antimicrobial susceptibility of Listeria monocytogenes recovered from different sources in India. Pathog Dis, 2015; 73:ftv093.

45.

Negia

, Rawoola

, Vergisa

, et al. Isolation and identification of pathogenic Listeria monocytogenes from diarrhoeal cases in human infants and young animals. Adv Anim Vet Sci, 2014; 2014:2:5–10.

46.

Neves

, Silva

, Roche

, Velge

, Brito

. Virulence of Listeria monocytogenes isolated from the cheese dairy environment, other foods and clinical cases. J Med Microbiol, 2008; 57:411–415.

47.

Nwachukwu

, Orji

, Iheukwumere

, Ekeleme

. Antibiotic resistant environmental isolates of Listeria monocytogenes from anthropogenic lakes in Lokpa-Ukwu, Abia State of Nigeria. Aust J Basic Appl Sci, 2010; 4:1571–1576.

48.

Olier

, Pierre

, Lemai^tre

J-P

, Divies

, Rousset

, Guzzo

. Assessment of the pathogenic potential of two Listeria monocytogenes human faecal carriage isolates. Microbiology, 2002; 148:1855–1862.

49.

Oliver

, Jayarao

, Almeida

. Foodborne pathogens in milk and the dairy farm environment: Food safety and public health implications. Foodborne Pathog Dis, 2005; 2:115–129.

50.

Orsi

, den Bakker

, Wiedmann

. Listeria monocytogenes lineages: Genomics, evolution, ecology, and phenotypic characteristics. Int J Med Microbiol, 2011; 301:79–96.

51.

Osman

, Samir

, Orabi

, Zolnikov

. Confirmed low prevalence of Listeria mastitis in she-camel milk delivers a safe, alternative milk for human consumption. Acta Trop, 2014; 130:1–6.

52.

Pospiech

, Neumann

A versatile quick-prep of genomic DNA from gram-positive bacteria. Trends Genet, 1995; 11:217–218.

53.

Poussin

, Leitges

, Goldfine

. The ability of Listeria monocytogenes PI-PLC to facilitate escape from the macrophage phagosome is dependent on host PKCβ. Microb Pathog, 2009; 46:1–5.

54.

Rahimi

, Ameri

, Momtaz

. Prevalence and antimicrobial resistance of Listeria species isolated from milk and dairy products in Iran. Food Control, 2010; 21:1448–1452.

55.

Rao

K.P.

, Chennappa

, Suraj

, Nagaraja

, Raj

A.C.

, Sreenivasa

Probiotic potential of Lactobacillus strains isolated from sorghum-based traditional fermented food. Probiotics and antimicrobial proteins, 2015; 7:146–156.

56.

Roberts

, Nightingale

, Jeffers

, Fortes

, Kongo

, Wiedmann

. Genetic and phenotypic characterization of Listeria monocytogenes lineage III. Microbiology, 2006; 152:685–693.

57.

Sampathkumar

, Tsougriani

, Yu

, Khachatourians

. A quantitative microtiter plate hemolysis assay for Listeria monocytogenes . J Food Saf, 1998; 18:197–203.

58.

Shakuntala

, Malik

, Barbuddhe

, Rawool

. Isolation of Listeria monocytogenes from buffaloes with reproductive disorders and its confirmation by polymerase chain reaction. Vet Microbiol, 2006; 117:229–234.

59.

Sharma

, Khan

, Dahiya

, Jain

, Sharma

. Prevalence, identification and drug resistance pattern of Staphylococcus aureus and Escherichia coli isolated from raw milk samples of Jaipur city of Rajasthan. J Pure Appl Microbiol, 2015; 9:341–348.

60.

Shoukat

, Malik

, Rawool

, et al. A study on detection of pathogenic Listeria monocytogenes in Ovine's of Kashmir region having abortion or history of abortion. Proc Natl A Sci India B, 2014; 84:311–316.

61.

Soni

, Dubey

. Phylogenetic analysis of the Listeria monocytogenes based on sequencing of 16S rRNA and hlyA genes. Mol Biol Rep, 2014; 41:8219–8229.

62.

Soni

, Singh

, Dubey

. Characterization of Listeria monocytogenes isolated from Ganges water, human clinical and milk samples at Varanasi, India. Infect Genet Evol, 2013; 14:83–91.

63.

Srinivasan

, Nam

, Nguyen

, Tamilselvam

, Murinda

, Oliver

. Prevalence of antimicrobial resistance genes in Listeria monocytogenes isolated from dairy farms. Foodborne Pathog Dis, 2005; 2:201–211.

64.

Stessl

, Fricker

, Fox

, et al. Collaborative survey on the colonization of different types of cheese-processing facilities with Listeria monocytogenes . Foodborne Pathog Dis, 2014; 11:8–14.

65.

Vázquez-Boland

, Kuhn

, Berche

, et al. Listeria pathogenesis and molecular virulence determinants. Clin Microbiol Rev, 2001; 14:584–640.

66.

Upadhyay

, Johny

, Amalaradjou

MAR

, Baskaran

, Kim

, Venkitanarayanan

. Plant-derived antimicrobials reduce Listeria monocytogenes virulence factors in vitro, and down-regulate expression of virulence genes. Int J Food Microbiol, 2012; 157:88–94.

67.

Wesley

IV.

Listeriosis in animals. In: Listeria, Listeriosis and Food Safety, Edition 2. Ryser

, Marth

(eds.). New York: Marcel Dekker, 1999, pp. 39–74.

68.

Yan

, Neogi

, Mo

, et al. Prevalence and characterization of antimicrobial resistance of foodborne Listeria monocytogenes isolates in Hebei province of Northern China, 2005–2007. Int J Food Microbiol, 2010; 144:310–316.