Development and In-House Validation of a Real-Time Polymerase Chain Reaction for the Detection of Listeria monocytogenes in Meat

The disease caused by Listeria monocytogenes can range from a mild febrile illness to a systemic (invasive) listeriosis. Raw meat can be a source for L. monocytogenes dissemination in the environment of retail markets or consumers' kitchens, and can cause cross-contamination with ready-to-eat (RTE) products (Luo et al., 2017). Traditional methodologies to search for L. monocytogenes in food are sensitive and remain the “gold standard” as compared with other methods (Gasanov et al., 2005). However, real-time polymerase chain reaction (RT-PCR) is being increasingly applied for the detection of L. monocytogenes in food (Junge et al., 2012). The aims of this work were, therefore, (1) to develop and validate an in-house RT-PCR to detect L. monocytogenes and (2) to determine L. monocytogenes prevalence with the RT-PCR developed in raw ground beef samples from 53 butcheries that also sell RTE foods.

One set of primers and one hydrolysis probe were designed for hly gene detection (encoding the pore-forming cytolysin listeriolysin). The DNA sequences of hly from L. monocytogenes strains were recovered from GenBank and aligned using PriSM software (Broad Institute, Cambridge, MA). For the design, a conserved sequence region was selected, based on multiple alignments of the genes using Primer Express 3.0 software. The primer and hydrolysis probe sequences designed were (5′–3′): Forward CACAAGTGGTAAGTTCCGGTCA, Reverse TTGCCAGGTAACGCGAGAAA, and Probe FAM-CCGTTCTCCACCATTCCCAAGC-3IABkFQ. All primers and probes were purchased from Integrated DNA Technologies (IDT, Coralville, IA).

The RT-PCR designed was challenged with 12 L. monocytogenes strains, 3 Listeria seeligeri, 3 Listeria welshimeri, and 3 Listeria innocua strains. The detection was successful for all L. monocytogenes strains analyzed and negative for all non-L. monocytogenes strains. To define the limit of detection (LOD), DNA of 12 L. monocytogenes strains at 10¹ to 10⁴ colony forming unit (CFU) was analyzed. LOD was 10 CFU/mL for all strains, consistent with a previous report (Gattuso et al., 2014). Robustness was determined by the amplification of DNA extracts from tubes containing 10² CFU/mL of 12 L. monocytogenes strains, in three alternate days and by two operators with different training level. The same results were obtained when the previously mentioned variables were introduced.

For RT-PCR validation, 43 strains of L. monocytogenes and 30 strains of non-L monocytogenes (Table 1) belonging to the collection of IGEVET (Instituto de Genética Veterinaria “Ing. Fernando Noel Dulout”; UNLP-CONICET) were used. They were stored at −70°C and grown in 4 mL brain heart infusion broth (Biokar, Zac de Ther, France) at 37 ± 1°C for 18–24 h. Serial strain dilutions were performed in buffered peptone water (Biokar) and the inoculum level was confirmed by plating on plate count agar (Britania, BA, Argentina). Plates were incubated at 37°C for 18–24 h. DNA extraction was made according to Leotta et al. (2005). The reaction mixture contained 10 μL of Master mix qPCR Probe (PB-L, Buenos Aires, Argentina), 0.4 μL of 10 μM of each forward and reverse primers, 0.2 μL of 100 μM probe, and 4 μL of DNA in a final volume of 20 μL. Strain ATCC 19115 and molecular biology grade water were included as external positive and no-template control in each run. Cycling used was initial hot-start step at 95°C for 3 min, followed by 40 cycles of a denaturation step at 95°C for 15 s and an annealing/extension step at 60°C for 30 s. Fluorescence was recorded only at the end of the annealing/extension step. The cycle threshold value was <34.

A total of 118 portions of 10 g raw ground beef were obtained from a commercial retail or store, in the same day and confirmed to be L. monocytogenes-free according to ISO 11290-1:1996/Amd.1:2004(E). Serial dilutions of 43 L. monocytogenes strains and 30 non-L. monocytogenes strains (Table 1) were done as described previously. Meat samples were inoculated with 10 (n = 43) and 100 (n = 43) CFU of L. monocytogenes per gram, and 30 meat samples were inoculated with 10³ CFU of non-L. monocytogenes per gram. Two samples were mock-inoculated with 1 mL of sterile Half Fraser Broth (HFB) (Becton Dickinson, Le Pont de Claix, France). Then, each sample was pre-enriched in 90 mL HFB for 24 h at 30°C and subsequently analyzed according to the reference culture method ISO 11290-1:1996/Amd.1:2004(E) and the in-house developed RT-PCR. DNA extraction was performed by foodproof^® Short Prep II (Biotecon Diagnostics, Postdam, Germany) after the pre-enrichment step. Then the PCR analysis was done following the protocol already described. Inclusivity, exclusivity, and analytical accuracy were 100%. These results are in line with other RT-PCR methods for L. monocytogenes detection validated in meat products (Garrido et al., 2012; Heo et al., 2014).

L. monocytogenes can multiply at refrigeration temperatures, form biofilms on different materials and under various conditions, and resist a range of environmental stresses (Law et al., 2015). Thus, the presence of this bacterium in retail shop environments is a risk due to the possibility of cross-contamination with food products (Leotta et al., 2016). We, therefore, conducted a field study to apply and validate the RT-PCR developed. Raw ground beef samples from 53 butcheries that also sell RTE foods including cooked products, cheeses, vegetables, and/or cold meats were analyzed. Raw ground beef samples were analyzed according to ISO 11290-1:1996/Amd.1:2004(E) and the RT-PCR developed. L. monocytogenes was simultaneously detected by RT-PCR and isolated from raw ground beef in 22 of the 53 butcheries analyzed (41.5%). The prevalence of L. monocytogenes obtained in this study was higher than that reported in Algeria (8.9%) and Malaysia (9.0%), but lower than that obtained in Turkey (45.0%) and Brazil (48.7%) (Du et al., 2017).

The RT-PCR developed showed adequate performance with pure strains, artificially contaminated raw ground beef samples, and naturally contaminated samples. This screening could allow a rapid intervention on contaminated food and the environment where it is produced. Moreover, the short time required to obtain a negative result could allow a fast verification on the procedures of meat and meat products or a fast commercialization of ground beef. In the future, the evaluation of this assay on other food matrices may also extend its application in food safety analyses.