Prevalence and Characterization of Staphylococcus aureus Strains in the Pork Chain Supply in Chile

Abstract

The detection of methicillin–resistant Staphylococcus aureus (MRSA) and other emerging strains in meat-producing animals and retail meat has increased the risk of contamination of food. The aim of this study was to determine the prevalence and characterize S. aureus strains isolated from the pork chain supply in Chile. A total of 487 samples were collected: 332 samples from pigs at farms and slaughterhouses (nasal, n = 155; skin, n = 177); 85 samples from carcasses at slaughterhouses; and 70 meat samples at supermarkets and retail stores. The isolation of S. aureus was carried out by selective enrichment and culture media. Biochemical testing (API^® Staph) and PCR (detection of the nuc and mecA genes) were used to confirm S. aureus and MRSA strains. The agglutination test was used to determine the protein PBP2′. Enterotoxins (SEA, SEB, SEC, SED) were determined by agglutination test and the se genes by PCR method. Oxacillin and cefoxitin susceptibility testing were carried out using the diffusion method. The overall prevalence of S. aureus in the pork meat supply was 33.9%. A higher prevalence was detected on carcasses (56.5%), in pigs sampled at farms (40.6%) than in pigs sampled at slaughterhouses (23.3%) and in nonpackaged retail meat (43.1%) than packaged retail meat (5.3%) (p ≤ 0.05). No significant differences (p > 0.05) were found between the prevalence in pigs (28.3%) and pork meat (32.9%) and between natural pig farming (33.3%) and conventional production (52.8%). The mecA gene and the protein PBP2′ were not detected in S. aureus strains. Two S. aureus strains exhibited oxacillin and cefoxitin resistance, and one S. aureus strain was resistant to cefoxitin. One S. aureus strain isolated from a meat sample was positive for enterotoxin SEB. Although the mecA gene was not detected, oxacillin-resistant and seb–producing S. aureus strains were detected, which represent a risk in the pork chain supply.

Introduction

S taphylococcus aureus is both a commensal bacterium and an opportunistic pathogen that can cause different diseases in humans, such as bacteremia, pneumonia, skin and soft tissue infections, and food poisoning (Argudín et al., 2010; Tong et al., 2015). The transmission can occur either through the direct contact with infected animals or people or with asymptomatic carriers (Center for Food Security and Public Health, 2011).

Methicillin–resistant Staphylococcus aureus (MRSA) has become an important cause of healthcare-associated MRSA (Tiemersma et al., 2004), community-associated MRSA (Kennedy et al., 2008), and livestock-associated MRSA infections (Golding et al., 2008).

It was assumed that pigs might be a potential zoonotic source for MRSA (Köck et al., 2009), since MRSA strains have been isolated from several food-producing animals, such as pigs, cattle, and poultry (de Neeling et al., 2007; Friese et al., 2013; Nemeghaire et al., 2014), and from retail raw meat (Hanson et al., 2011; Buyukcangaz et al., 2013). The ability of S. aureus to colonize the nares and the skin of humans and animals and the detection of MRSA and other emerging S. aureus strains in meat-producing animals and retail meat have increased the risk of food contamination during the different processing stages of the food production and supply chain (de Boer et al., 2009).

Methicillin is a β-lactam antibiotic, as well as penicillin, oxacillin, ampicillin, and cephalosporins. These antibiotics affect the cell wall synthesis in Gram-positive bacteria inhibiting the peptidoglycan synthesis called transpeptidation, which is catalyzed by transpeptidases and carboxypeptidases that are known as penicillin-binding proteins (PBPs). These proteins are able to bind penicillin in their active sites through a covalent bond between a serine and the β-lactam ring resulting in the inhibition of the transpeptidation (Stapleton and Taylor, 2002). Methicillin resistance is attributed to a modified PBP called PBP2′ or PBP2a encoded by the mecA gene. This protein gives MRSA strains a reduced affinity for β-lactam antibiotics resulting in a normal cross-linking of peptidoglycan strands during cell wall synthesis (Hartman and Tomasz, 1981; Van De Griend et al., 2009).

Staphylococcus aureus can produce a wide variety of virulence factors, including different toxins. Depending on the strain, S. aureus can express enterotoxins that cause gastroenteritis. Generally, five classical enterotoxins have been found in S. aureus, which are known as SE types (SEA to SEE) encoded by the se genes. In recent years, new SEs and SE-like toxins have been detected (Aydin et al., 2011).

Limited information about antimicrobial resistance (AR) in foodborne pathogens is available in Chile, as well as in many developing countries (Van et al., 2012). Moreover, no information about the prevalence of MRSA and other emerging S. aureus strains in the meat production chain is available in Chile. Therefore, the aim of this study was to determine the prevalence and the characterization of S. aureus strains isolated from the pork chain supply in Chile.

Materials and Methods

Samples

A total of 487 samples were obtained from the pork meat supply, of which 332 samples were collected from pigs at four farms (nasal, n = 37; skin, n = 59) and two slaughterhouses (nasal, n = 118; skin, n = 118, each one from the same animal), 85 samples from carcasses at two slaughterhouses, and 70 meat samples from three supermarkets and eleven retail stores.

On farms, live pig sampling consisted of immobilizing each pig in a pen during sampling. Nasal swabs from both nostrils and skin swabs behind both ears (often considered as the cleanest zones of the pig) were taken using sterile swabs. In slaughterhouses, nasal and skin swabs were collected immediately after stunning, and surface samples from carcasses were collected, swabbing ham, belly, and jowl areas. Retail raw meat was randomly selected at supermarkets and retail stores. All samples were immediately placed on ice into coolers and processed within 12 h of collection.

Culture method

Staphylococcus aureus was isolated by selective enrichment followed by plating on selective agar. Briefly, nasal, skin, and carcasses swabs were placed directly in 9 mL Mueller-Hinton broth with 6.5% sodium chloride (MHB +6.5% NaCl) and incubated for 18–20 h at 37°C. One milliliter of the suspension was inoculated into 9 mL of phenol red mannitol broth (PHMB), followed by incubation for 18–20 h at 37°C. Meat samples (25 g) and MHB +6.5% NaCl (225 mL) were placed in a sterile filter bag and homogenized using a lab blender (BagMixer^®400 P; Interscience, St. Nom, France) at 8 strokes/s for 90 s and incubated for 18–20 h at 37°C. One millimeter of the suspension was inoculated into 9 mL of PHMB, followed by incubation for 18–20 h at 37°C. Then, a loopful of the suspension was struck directly to Baird-Parker medium with egg yolk tellurite supplement (BP) and incubated for 48 h at 37°C. Three presumptive S. aureus colonies (black colonies surrounded by 2- to 5-mm clear zones) on BP of each sample were transferred to trypticase soy agar (TSA) and incubated for 18–20 h at 37°C. Then, colonies were struck to a selective chromogenic MRSA agar (MRSASelect^™ II; Bio-Rad, Marnes-la-Coquette, France). Presumptive MRSA colonies (small pink colonies) were selected. All selected colonies were stored frozen at −80°C in brain-heart infusion broth containing 20% glycerol until use.

Biochemical identification

All presumptive S. aureus colonies were recovered onto Columbia agar +5% sheep blood, and the presence of β-hemolysis was observed after incubation for 18–24 h at 37°C. Presumptive S. aureus colonies were confirmed by a standardized system API^® Staph (bioMérieux, Marcy - l'Etoile, France), according to the manufacturer's recommendations. Identification was obtained using the apiweb^™ identification software.

Methicillin resistance was assessed by detecting the presence of PBP (PBP2′) using the MRSA latex agglutination test (Oxoid Ltd., Hants, United Kingdom) as recommended by the manufacturer and by detecting the mecA gene using PCR method (explained below).

In addition, the production of enterotoxins SEA, SEB, SEC, and SED during the growth of S. aureus strains isolated from pork meat was assessed using the Reversed Passive Latex Agglutination Kit (Oxoid Ltd.) according to the manufacturer's instructions and by detecting the se genes using PCR method (explained below).

Polymerase chain reaction

Staphylococcus aureus isolates stored at −80°C were subcultured twice in TSA plates for 18–20 h at 37°C. The boiling–freezing method was used for DNA extraction. One to five colonies were picked and suspended in 50 μL nuclease-free distilled water. Tubes were heated at 98–99°C for 10 min and immediately placed at −20°C for 10 min or until use (DNA template).

A PCR assay targeting the nuc gene (S. aureus-specific region of the thermonuclease) and the mecA gene (associated with methicillin resistance) was used for confirmation of S. aureus and MRSA strains (Table 1). Two S. aureus reference strains were used as positive controls: ATCC 43300 (MRSA, positive for the two genes) and ATCC 25923 (Methicillin-susceptible S. aureus, positive for the nuc gene). Two negative controls were used: one with no target DNA (nuclease-free distilled water) and other with the DNA from the reference strain ATCC 13076 (Salmonella enterica subsp. enterica).

Table 1.

Primers Used for the Identification of nuc, mecA, mecC, and se Genes

Gene	Primer	Oligonucleotide sequence (5′-3′)	Amplicon size (bp)	References
nuc	nuc-1	GCGATTGATGGTGATACGGTT	279	Maes et al. (2002)
	nuc-2	AGCCAAGCCTTGACGAACTAAAGC		Brakstad et al. (1992)
mecA	mecA-1	AAAATCGATGGTAAAGGTTGGC	533	Maes et al. (2002)
	mecA-2	AGTTCTGCAGTACCGGATTTGC		Murakami et al. (1991)
mecC	mecC-1	GCTCCTAATGCTAATGCA	304	Cuny et al. (2011)
	mecC-2	TAAGCAATAATGACTACC
sea	sea-1	ACGATCAATTTTTACAGC	544	Marques et al. (2015)
	sea-2	TGCATGTTTTCAGAGTTAATC
seb	seb-1	ATTCTATTAAGGACACTAAGTTAGGGGA	404	Marques et al. (2015)
	seb-2	ATCCCGTTTCATAAGGCGAGT
sec	sec-1	GACATAAAAGCTAGGAATTT	257	Marques et al. (2015)
	sec-2	AAATCGGATTAACATTATCCA
sed	sed-1	CAAATATATTGATATAATGA	330	Marques et al. (2015)
	sed-2	AGTAAAAAAGAGTAATGCAA

A 50 μL final reaction mixture included: 1 × GoTaq^® Green Master mix (200 μM dNTPs, 3 mM MgCl₂ [Promega, Madison, WI]), 0.4 μM of each nuc primer, 0.6 μM of each mecA primer (Invitrogen Integrated DNA Technologies, Inc., Coralville, IA), and 5 μL DNA template (described above).

The PCRs were carried out in a thermocycler (MultiGene^™ OptiMax; Labnet International, Inc., Edison, NJ), and conditions were adjusted as follows: 94°C for 10 min (initial denaturation); 40 cycles of 94°C for 1 min (denaturation), 51°C for 1 min (annealing), 72°C for 2 min (extension), and 72°C for 5 min (final extension).

Strains that exhibited oxacillin and cefoxitin resistance and were mecA-negative were subjected to the detection of the mecC gene according to Cuny et al. (2011) (Table 1).

The se genes that encode enterotoxins SEA, SEB, SEC, and SED were determined by PCR technique according to Marques et al. (2015) (Table 1), with slight modifications. A 25 μL final reaction mixture included the following: 0.5 × GoTaq Green Master mix (200 μM dNTPs, 3 mM MgCl₂ [Promega]), 0.4 μM of each se primer (Invitrogen Integrated DNA Technologies, Inc.), and 2 μL DNA template (described above).

All PCR products (10 μL) were loaded in a 1.5% (w/v) agarose gel in 100 mL 1 × TAE buffer, using 10 μL SafeView as DNA-intercalating dye. A molecular weight marker 100-bp ladder (Maestrogen, Inc., Las Vegas, NV) was included on each gel. Electrophoresis was carried out in 1 × TAE buffer at 100 V, 300 mA for 1 h. Bands corresponding to each gene were visualized using a UV transilluminator (BIOTOP TU1002; Shangai Bio-Tech Co., Ltd., Shangai, China).

Oxacillin and cefoxitin susceptibility testing

Staphylococcus aureus strains stored at −80°C were inoculated on TSA plates and incubated at 37°C for 20–24 h. Ten microliters of a standard bacterial suspension prepared in a sterile saline solution (NaCl 0.85% w/v) equal to 0.5 McFarland (∼10⁸ colony-forming unit) was uniformly distributed on Mueller-Hinton agar (MHA), supplemented with 2% NaCl.

The Epsilometer test (Etest; Liofilchem^® s.r.l., Italy) was performed for quantitative oxacillin susceptibility testing (0.016–256 μg/mL). Etest strips were placed on the medium surface and incubated at 35°C for 24 h. The Etest minimal inhibitory concentration (MIC) results were read where the edge of the inhibition ellipse intersects the MIC scale on the strip.

The cefoxitin susceptibility testing was carried out using the disk diffusion method, placing sterile disks containing 30 μg of cefoxitin (BD BBL^™, Sensi-Disc^™) onto inoculated MHA (supplemented with 2% NaCl) plates. After the incubation, 35°C for 18–20 h, the inhibition halo was measured.

The interpretation of the oxacillin MIC breakpoints and cefoxitin susceptibility testing was carried out according to the Clinical and Laboratory Standards Institute guidelines (2014).

Statistical analysis

The chi-square test was used to assess the significance in proportion of positive samples between sample types, only if no more than 20% of the expected counts were <5, and all individual expected counts were 1 or greater. On the contrary, Fisher's exact test was used with two-sided p-values. The statistic software InfoStat^® (National University of Córdoba, Argentina) was used to assess significance (p ≤ 0.05).

Results

The overall prevalence of S. aureus in the pork meat supply was 33.9% (Table 2). A higher prevalence of S. aureus was found on carcasses (56.5%) (p ≤ 0.05). No significant difference (p > 0.05) was found between the prevalence of S. aureus in pigs (28.3%) and pork meat (32.9%).

Table 2.

Prevalence of Staphylococcus aureus and Methicillin–Resistant Staphylococcus aureus in Pigs, Carcasses, and Pork Meat

Sample type	No.	No. positive S. aureus (biochemical test) ^*	No. (%) positive S. aureus (PCR) ^†	No. (%) positive MRSA ^‡
Pigs
Nasal	155	68	50 (32.3)	0 (0.0)
Skin	177	64	44 (24.9)	0 (0.0)
Total	332	132	94 (28.3)^a	0 (0.0)
Carcasses
Total	85	51	48 (56.5)^b	0 (0.0)
Pork meat
Supermarkets	38	18	9 (23.7)	0 (0.0)
Retail stores	32	19	14 (43.8)	0 (0.0)
Total	70	37	23 (32.9)^a	0 (0.0)
Total samples	487	220	165 (33.9)	0 (0.0)

Different superscript letters indicate significant differences (Chi-square test) (p ≤ 0.05).

Identification ≥44.4%; ^†Positives for nuc gene; ^‡Positives for mecA gene and protein PBP2′.

MRSA, methicillin–resistant Staphylococcus aureus.

Other staphylococci strains were identified in samples from swine origin by biochemical testing (267/487): S. xylosus, S. epidermidis, S. lentus, S. warneri, S. simulans, S. saprophyticus, S. hominis, S. sciuri, S. haemolyticus, S. chromogenes, S. hyicus, and S. caprae (data not shown). No significant differences (p > 0.05) were found between the prevalence of S. aureus in natural pig farming system (33.3%) and conventional pig production system (52.8%). A higher prevalence of S. aureus was found in pigs sampled at farms (40.6%) than in pigs sampled at slaughterhouses (23.3%) and in nonpackaged retail meat (43.1%) than packaged retail meat (5.3%) (p ≤ 0.05).

The mecA gene and the protein PBP2′ were not detected in S. aureus strains (Table 2). Two S. aureus strains, one isolated from a carcass and the other isolated from a packaged pork meat, exhibited both oxacillin and cefoxitin resistance. In addition, one S. aureus strain isolated from a skin sample at a slaughterhouse was resistant to cefoxitin; however, it did not exhibit oxacillin resistance (Table 3). These three S. aureus strains did not harbor the mecC gene (data not shown).

Table 3.

Prevalence of Staphylococcus aureus and Oxacillin- and Cefoxitin–Resistant Staphylococcus aureus by Pig and Pork Meat Sampling Place

Sample type	No.	No. positive S. aureus (biochemical test) ^*	No. (%) positive S. aureus (PCR) ^†	No.(%) oxacillin–resistant S. aureus^‡	No. (%) cefoxitin–resistant S. aureus^‡
Pig production
Natural	60	25	20 (33.3)^a	0 (0.0)	0 (0.0)
Conventional	36	25	19 (52.8)^a	0 (0.0)	0 (0.0)
Pig sampling
Farms	96	50	39 (40.6)^b	0 (0.0)	0 (0.0)
Slaughterhouses	236	82	55 (23.3)^a	0 (0.0)	1 (4.2)
Pork meat
Carcasses	85	51	48 (56.5)^b	1 (2.1)	1 (2.1)
Packaged	19	4	1 (5.3)^a	1 (5.3)	1 (5.3)
Nonpackaged	51	33	22 (43.1)^b	0 (0.0)	0 (0.0)

Different superscript letters indicate significant differences (Chi-square test) (p ≤ 0.05).

Identification ≥44.4%; ^†Positives for nuc gene; ^‡Susceptibility to oxacillin ≥4.0 μg/mL; susceptibility to cefoxitin ≤21 mm.

Only one S. aureus strain was positive for enterotoxin B (SEB) and for the seb gene (data not shown), which was isolated from a retail store meat (nonpackaged).

Discussion

In this study, an agreement of 75% between API Staph test and PCR technique (detection of nuc gene) was determined in confirmation of S. aureus. Other studies have shown that the genotypic methods are superior to phenotypic identification of staphylococcal species (Heikens et al., 2005; Sasaki et al., 2010). However, the test API Staph has been demonstrated to be a reasonably reliable method for phenotypic characterization, as other methods have shown a lower precision (Heikens et al., 2005).

A higher prevalence of S. aureus in pigs and pork meat has been determined in other studies, with values ranging from 45% to 65% (O'Brien et al., 2012; Buyukcangaz et al., 2013; Pu et al., 2015). However, Tanih et al. (2015) detected a prevalence of S. aureus in carcasses of around 13.0%, which is much lower than the prevalence found in this study.

In this study, there were no significant differences in the prevalence of S. aureus between nasal and skin samples in pigs (p > 0.05) (Table 2). Agersø et al. (2014) reported that the ear-skin swab sampling is more sensitive for MRSA detection than nasal swab sampling. However, other studies have considered only nasal swab sampling to detect MRSA in pigs (Tenhagen et al., 2009; van den Broek et al., 2009).

The types of pig production systems did not affect the prevalence of S. aureus obtained in animals (p > 0.05) (Table 3). It might be expected that a higher prevalence of S. aureus exists in conventional pig production system than natural pig farming system, due to a higher risk of spread of microorganisms between pigs by direct contact when animals are confined in a limited indoor area (Crombé et al., 2013). In addition, naturally raised pigs spend time outdoors and have access to larger pen areas, which can reduce infection intensity (Edwards, 2005).

A higher prevalence of S. aureus was detected in pigs sampled in farms compared with pigs sampled in slaughterhouses (p ≤ 0.05). It might be thought that the prevalence of S. aureus in animals could be higher in slaughterhouses due to the risk of transmission during transportation or in resting pens, where animals from different herds could have contact (O'Connor et al., 2006; de Neeling et al., 2007; Agersø et al., 2014). In this study, nasal and skin swabs were taken after the stunning; however, live animals were rinsed by shower to remove external solid waste before the entrance to the process, which could reduce the impurities in the skin.

In this study, nonpackaged meat samples were more contaminated than packaged meat (p ≤ 0.05), which could be expected since nonpackaged meat is more exposed to bacterial contamination, due to the direct contact with air, humans, and other sources during processing and commercialization in meat counter at supermarkets and retail stores.

Both the mecA gene and its product PBP2′ were not detected in S. aureus strains isolated in this study. However, two pork meat samples presented strains that were nuc gene negative and mecA gene positive, which could be due to false positive results in the biochemical testing for S. aureus. In addition, coagulase-negative staphylococci can also carry the mecA gene (Higashide et al., 2006; Thomas et al., 2007). Other studies have reported a prevalence of MRSA in pigs ranging from 6% to 71% (Khalid et al., 2009; van de Vijver et al., 2014), with a lower prevalence in organic than conventional pig herds. In pork meat, the prevalence of MRSA has been reported to be <10% in other studies (O'Brien et al., 2012; Buyukcangaz et al., 2013). In Chile, there is no information regarding the prevalence of MRSA in food-producing animals as most information and monitoring and control systems are focused in MRSA associated disease in humans. The data generated in this article represent some of the first studies to examine livestock-associated MRSA in production swine in Chile.

The detection of the mecA gene by the PCR technique is used as the “gold standard” method to detect MRSA strains. In addition, the detection of PBP2′ by the latex agglutination test has an accuracy as high as the PCR method and greater than susceptibility testing method (Sakoulas et al., 2001). In this study, oxacillin and cefoxitin susceptibility testing were also carried out. Two S. aureus strains were both oxacillin- and cefoxitin resistant, and one S. aureus strain exhibited only cefoxitin resistance. However, those strains were mecA- and PBP2′ negative. The cefoxitin disk diffusion method can be used in addition to oxacillin susceptibility testing (Clinical and Laboratory Standards Institute, 2014); however, it can also be used as a surrogate for the oxacillin disk diffusion method, since it is easier to interpret and has a higher sensitivity (Broekema et al., 2009). The S. aureus strains that are mecA-negative and exhibit oxacillin- or cefoxitin resistance did not harbor the mecC gene; therefore, they could carry other variations of the mecA gene that are not as well known (Banerjee et al., 2010; Stegger et al., 2011; Velasco et al., 2015) or could present uncommon phenotypes such as borderline oxacillin resistance (Nadarajah et al., 2006; Stefani et al., 2012). Therefore, the whole-genome sequencing is always necessary to understand the mechanism of resistance.

In Chile, the use of antibiotics as growth promoters and for prevention of disease in animal farming has been banned since 2007 (Res. SAG No. 3447, 2006); therefore, antibiotics can be used only for the disease treatment. This could explain the low prevalence of oxacillin-resistant S. aureus strains in the pork chain supply, but warrants continued monitoring to assure food safety.

Staphylococcal food poisoning is due to the adsorption of staphylococcal enterotoxins preformed in the food (Le Loir et al., 2003). In this study, one enterotoxin–producing S. aureus strain from pork meat was positive for enterotoxin SEB and for the seb gene. It should also be noted that enterotoxins can resist heat treatment and low pH conditions that can easily destroy the bacteria; therefore, the enterotoxins can remain present in the meat and potentially cause staphylococcal food poisoning (Le Loir et al., 2003).

Conclusions

Staphylococcus aureus is present in the pork chain supply in Chile with a low prevalence. Methicillin–resistant S. aureus was not detected in this study; however, oxacillin-resistant and seb–producing S. aureus strains were found. Further analysis is needed to expand the knowledge and comprehension of the molecular characterization and the mechanisms of AR in S. aureus.

Footnotes

Acknowledgment

This work was supported by the Research Project Fondecyt No. 11140379.

Disclosure Statement

No competing financial interests exist.

References

Agersø

, Vigre

, Cavaco

, Josefsen

. Comparison of air samples, nasal swabs, ear-skin swabs and environmental dust samples for detection of methicillin-resistant Staphylococcus aureus (MRSA) in pigs herds. Epidemiol Infect, 2014; 142:1727–1736.

Argudín

MÁ

, Mendoza

, Rodicio

. Food poisoning and Staphylococcus aureus enterotoxins. Toxins, 2010; 2:1751–1773.

Aydin

, Muratoglu

, Sudagidan

, Bostan

, Okuklu

, Harsa

. Prevalence and antibiotic resistance of foodborne Staphylococcus aureus isolates in Turkey. Foodborne Pathog Dis, 2011; 8:63–69.

Banerjee

, Gretes

, Harlem

, Basuino

, Chambers

. A mecA-negative strain of methicillin-resistant Staphylococcus aureus with high-level β-lactam resistance contains mutations in three genes. Antimicrob Agents Chemother, 2010; 54:4900–4902.

Brakstad

, Aasbakk

, Maeland

. Detection of Staphylococcus aureus by polymerase chain reaction amplification of the nuc gene. J Clin Microbiol, 1992; 30:1654–1660.

Broekema

, Van

, Monson

, Marshall

, Warshauer

. Comparison of cefoxitin and oxacillin disk diffusion methods for detection of mecA-mediated resistance in Staphylococcus aureus in a large-scale study. J Clin Microbiol, 2009; 47:217–219.

Buyukcangaz

, Velasco

, Sherwood

, Stepan

, Koslofsky

, Logue

. Molecular typing of Staphylococcus aureus and methicillin-resistant Staphylococcus aureus (MRSA) isolated from retail meat and animals in North Dakota, USA. Foodborne Pathog Dis, 2013; 10:608–617.

Center for Food Security and Public Health (CFSPH). Methicillin-Resistant Staphylococcus aureus MRSA. Ames, IA: Iowa State University, 2011, pp. 1–25.

Clinical and Laboratory Standards Institute (CLSI). Performance Standards for Antimicrobial Susceptibility Testing. Twenty-Fourth Informational Supplement; Wayne, PA: CLSI, 2014, pp. M100-S124.

10.

Crombé

, Argudín

, Vanderhaeghen

, Hermans

, Haesebrouck

, Butaye

. Transmission dynamics of methicillin-resistant Staphylococcus aureus in pigs. Front Microbiol, 2013; 4:1–21.

11.

Cuny

, Layer

, Strommenger

, Witte

. Rare occurrence of methicillin-resistant Staphylococcus aureus CC130 with a novel mecA homologue in humans in Germany. PLoS One, 2011; 6:e24360.

12.

de Boer

, Zwartkruis-Nahuis

JTM

, Wit

, Huijsdens

, de Neeling

, Bosch

, van Oosterom

RAA

, Vila

, Heuvelink

. Prevalence of methicillin-resistant Staphylococcus aureus in meat. Int J Food Microbiol, 2009; 134:52–56.

13.

de Neeling

, van den Broek

, Spalburg

, van Santen-Verheuvel

, Dam-Deisz

, Boshuizen

, van de Giessen

, van Duijkeren

, Huijsdens

. High prevalence of methicillin resistant Staphylococcus aureus in pigs. Vet Microbiol, 2007; 122:366–372.

14.

Edwards

. Product quality attributes associated with outdoor pig production. Livestock Prod Sci, 2005; 94, 5–14.

15.

Friese

, Schulz

, Zimmermann

, Tenhagen

, Fetsch

, Hartung

, Rösler

. Occurrence of livestock-associated methicillin-resistant Staphylococcus aureus in turkey and broiler barns and contamination of air and soil surfaces in their vicinity. Appl Environ Microbiol, 2013; 79: 2759–2766.

16.

Golding

, Campbell

, Spreitzer

, Veyhl

, Surynicz

, Simor

, Mulvey

, Canadian Nosocomial Infection Surveillance Program. A preliminary guideline for the assignment of methicillin-resistant Staphylococcus aureus to a Canadian pulsed-field gel electrophoresis epidemic type using spa typing. Can J Infect Dis Med Microbiol, 2008; 19:273–281.

17.

Hanson

, Dressler

, Harper

, Scheibel

, Wardyn

, Roberts

, Kroeger

, Smith

. Prevalence of Staphylococcus aureus and methicillin-resistant Staphylococcus aureus (MRSA) on retail meat in Iowa. J Infect Pub Health, 2011; 4:169–174.

18.

Hartman

, Tomasz

. Altered penicillin-binding proteins in methicillin-resistant strains of Staphylococcus aureus . Antimicrob Agents Chemother, 1981; 19:726–735.

19.

Heikens

, Fleer

, Paauw

, Florijn

, Fluit

. Comparison of genotypic and phenotypic methods for species-level identification of clinical isolates of coagulase-negative staphylococci. J Clin Microbiol, 2005; 43:2286–2290.

20.

Higashide

, Kuroda

, Ohkawa

, Ohta

. Evaluation of a cefoxitin disk diffusion test for the detection of mecA-positive methicillin-resistant Staphylococcus saprophyticus . Int J Antimicrob Agents, 2006; 27:500–504.

21.

Kennedy

, Otto

, Braughton

, Whitney

, Chen

, Mathema

, Mediavilla

, Byrne

, Parkins

, Tenover

, Kreiswirth

, Musser

, DeLeo

. Epidemic community-associated methicillin-resistant Staphylococcus aureus: Recent clonal expansion and diversification. Proc Natl Acad Sci U S A, 2008; 105:1327–1332.

22.

Khalid

, Zakaria

, Toung

, McOrist

. Low levels of methicillin-resistant Staphylococcus aureus in pids in Malaysia. Vet Rec, 2009; 164:626–627.

23.

Köck

, Harlizius

, Bressan

, Laerberg

, Wieler

, Witte

, Deurenberg

, Voss

, Becker

, Friedrich

. Prevalence and molecular characteristics of methicillin-resistant Staphylococcus aureus (MRSA) among pigs on German farms and import of livestock-related MRSA into hospitals. Eur J Clin Microbiol Infect Dis, 2009; 28:1375–1382.

24.

Le Loir

, Baron

, Gautier

. Staphylococcus aureus and food poisoning. Genet Mol Res, 2003; 2: 63–76.

25.

Maes

, Magdalena

, Rottiers

, De Gheldre

, Struelens

. Evaluation of a triplex PCR assay to discriminate Staphylococcus aureus from coagulase-negative staphylococci and determine methicillin resistance from blood cultures. J Clin Microbiol, 2002; 40:1514–1517.

26.

Marques

JdL

, Volcão

, Funck

, Kroning

, da Silva

, Fiorentini

, Ribeiro

. Antimicrobial activity of essential oils of Origanum vulgare L., and Origanum majorana L. against Staphylococcus aureus isolated from poultry meat. Ind Crops Prod, 2015; 77:444–450.

27.

Murakami

, Minamide

, Wada

, Nakamura

, Teraoka

, Watanabe

. Identification of methicillin-resistant strains of staphylococci by polymerase chain reaction. J Cli Microbiol, 1991; 29:2240–2244.

28.

Nadarajah

, Lee

MJS

, Louie

, Jacob

, Simor

, Louie

, McGavin

. Identification of different clonal complexes and diverse amino acid substitutions in penicillin-binding protein 2 (PBP2) associated with borderline oxacillin resistance in Canadian Staphylococcus aureus isolates. J Med Microbiol, 2006; 55:1675–1683.

29.

Nemeghaire

, Argudín

, Haesebrouck

, Butaye

. Epidemiology and molecular characterization of methicillin-resistant Staphylococcus aureus nasal carriage isolates from bovines. BMC Vet Res, 2014; 10:153.

30.

O'Brien

, Hanson

, Farina

, Wu

, Simmering

, Wardyn

, Forshey

, Kulick

, Wallinga

, Smith

. MRSA in conventional and alternative retail pork products. PLoS One, 2012; 7:e30092.

31.

O'Connor

, Gailey

, McKean

, Hurd

. Quantity and distribution of Salmonella recovered from three swine lairage pens. J Food Prot, 2006; 69:1717–1719.

32.

, Han

, Ge

. Isolation and characterization of methicillin-resistant Staphylococcus aureus strains from Louisiana retail meats. Appl Environ Microbiol, 2015; 75:265–267.

33.

Res. SAG No. 3447. Modifica resolución No. 1992 de 2006. Agriculture Department of Chile. 2006. Available at: https://www.sag.gob.cl/sites/default/files/RES_3447_MODIF_1992_INSUMOS.pdf Accessed January 1, 2018 .

34.

Sakoulas

, Gold

, Venkataraman

, Degirolami

, Eliopoulos

, Qian

. Methicillin-resistant Staphylococcus aureus: Comparison of susceptibility testing methods and analysis of mecA-positive susceptible strains. J Clin Microbiol, 2001; 39:3946–3951.

35.

Sasaki

, Tsubakishita

, Tanaka

, Sakusabe

, Ohtsuka

, Hirotaki

, Kawakami

, Fukata

, Hiramatsu

. Multiplex-PCR method for species identification of coagulase-positive staphylococci. J Clin Microbiol, 2010; 48:765–769.

36.

Stapleton

, Taylor

. Methicillin resistance in Staphylococcus aureus: Mechanisms and modulation. Sci Prog, 2002; 85:57–72.

37.

Stefani

, Chung

, Lindsay

, Friedrich

, Kearns

, Westh

, MacKenzie

. Methicillin-resistant Staphylococcus aureus (MRSA): Global epidemiology and harmonization of typing methods. Int J Antimicrob Agents, 2012; 39:273–282.

38.

Stegger

, Andersen

, Kearns

, Pichon

, Holmes

, Edwards

, Laurent

, Teale

, Skov

, Larsen

. Rapid detection, differentiation and typing of methicillin-resistant Staphylococcus aureus harbouring either mecA or the new mecA homologue mecALGA251 . Clin Microbiol Infect, 2011; 18:385–400.

39.

Tanih

, Sekwadi

, Ndip

, Bessong

. Detection of pathogenic Escherichia coli and Staphylococcus aureus from cattle and pigs slaughtered in abattoirs in Vhembe District, South Africa. ScientificWorldJournal, 2015; 2015:1–8.

40.

Tenhagen

, Fetsch

, Stührenberg

, Schleuter

, Hammerl

, Herwig

, Kowall

, Kämpe

, Schroeter

, Bräunig

, Käsbohrer

, Appel

. Prevalence of MRSA types in slaughter pigs in different German abattoirs. Vet Rec, 2009; 165:589–593.

41.

Thomas

, Gidding

, Ginn

, Olma

, Iredell

. Development of a real-time Staphylococcus aureus and MRSA (SAM-) PCR for routine blood culture. J Microbiol Methods, 2007; 68:296–302.

42.

Tiemersma

, Bronzwaer

SLAM

, Lyytikäinen

, Degener

, Schrijnemakers

, Bruinsma

, Monen

, Witte

, Grundmann

, European Antimicrobial Resistance Surveillance System Participants. Methicillin-resistant Staphylococcus aureus in Europe, 1999–2002. Emerg Infect Dis, 2004; 10:1627–1634.

43.

Tong

SYC

, Davis

, Eichenberger

, Holland

, Fowler

Jr.

Staphylococcus aureus infections: Epidemiology, pathophysiology, clinical manifestations, and management. Clin Microbiol Rev, 2015; 28:603–661.

44.

Van

, Nguyen

, Smooker

, Coloe

. The antibiotic resistance characteristics of non-typhoidal Salmonella enterica isolated from food-producing animals, retail meat and humans in South East Asia. Int J Food Microbiol, 2012; 154:98–106.

45.

Van De Griend

, Herwaldt

, Alvis

, DeMartino

, Heilmann

, Doern

, Winokur

, Vonstein

, Diekema

. Community-associated methicillin-resistant Staphylococcus aureus, Iowa, USA. Emerg Infect Dis, 2009; 15:1582–1589.

46.

van de Vijver

LPL

, Tulinski

, Bondt

, Mevius

, Verwer

. Prevalence and molecular characteristics of methicillin-resistant Staphylococcus aureus (MRSA) in organic pig herds in The Netherlands. Zoonoses Public Health, 2014; 61:338–345.

47.

Van den Broek

IVF

, Van Cleef

BAGL

, Haenen

, Broens

, Van der Wolf

, Van den Broek

MJM

, Huijsdens

, Kluytmans

JAJW

, Van de Giessen

, Tiemersma

. Methicillin-resistant Staphylococcus aureus in people living and working in pig farms. Epidemiol Infect, 2009; 137:700–708.

48.

Velasco

, Buyukcangaz

, Sherwood

, Stepan

, Koslofsky

, Logue

. Characterization of Staphylococcus aureus from humans and a comparison with isolates of animal origin, in North Dakota, United States. PLoS One, 2015; 10:e0140497.