Functional bla KPC-2 Sequences Are Present in U.S. Beef Cattle Feces Regardless of Antibiotic Use

Abstract

Carbapenems are classified as critically important antibiotics since they are employed when resistant Gram-negative bacterial infections fail to respond to other antibiotic therapies. Carbapenem-resistant bacteria (CRB) were traditionally understood to be rare in the U.S. food-producing animals. Recently, using quantitative polymerase chain reaction (qPCR), our group detected bla _KPC-2 in all 72 metagenomic DNA (mgDNA) samples prepared from the feces of 36 lots of beef cattle “raised without antibiotics” (RWA) and 36 lots raised “conventionally” (CONV). Since a small internal fragment of the bla _KPC-2 gene was targeted by the qPCR detection method, we sought to determine if functional bla _KPC-2-like sequences are present in beef cattle feces. Full-length bla _KPC-2 sequences were amplified from 18 mgDNA samples (9 CONV and 9 RWA), cloned into pCR4Blunt-TOPO vectors, and transformed into Escherichia coli TOP10 cells. All 14 of the samples with bla _KPC-2 cloned in the same orientation as the P_lac promoter had carbapenemase activity and imipenem minimum inhibitory concentrations ≥32 μg/mL. We conclude that the bla _KPC-2 genes detected in our previous study were functional, which indicates that CRB were present in those fecal samples. Identification of functional Klebsiella pneumoniae carbapenemases in fecal samples from both CONV and RWA cattle strongly suggests that CRB are more common in U.S. beef cattle feces than previously believed. Critically, more research using similar qPCR methods to determine the levels of carbapenem-resistant genes in human feces, feces from other food animal species, wildlife, companion animals, and the environment are required to accurately assess public health implications.

Introduction

Carbapenems are considered “critically important” and “last-resort” antibiotics for multidrug-resistant Gram-negative bacterial infections (WHO, 2017). In the United States, carbapenem-resistant bacteria (CRB) were traditionally understood to be “rare” in food-producing animals and not routinely surveilled (CDC, 2013; FDA, 2015). Repeated isolation of CRB from food animals in Europe and Asia raised concerns that the U.S. food-producing animals, including beef cattle, could harbor CRB (Fischer et al., 2012, 2013; Poirel et al., 2012; Laube et al., 2013; Zhang et al., 2013; Guerra et al., 2014). These concerns were supported by isolation, although at low frequency, of CRB from the U.S. dairy cattle feces (Webb et al., 2016) and environmental samples taken at a U.S. swine production facility (Mollenkopf et al., 2017).

Klebsiella pneumoniae carbapenemases (KPC) are class A serine β-lactamases (encoded by the bla _KPC gene) that can hydrolyze a wide variety of β-lactam antimicrobials, including carbapenems, cephalosporins, cephamycins, and penicillins (Queenan and Bush, 2007; Papp-Wallace et al., 2010; Munoz-Price et al., 2013). Since identification in 1996, CRB-harboring bla _KPC have been isolated from human clinical samples worldwide (Munoz-Price et al., 2013). We recently reported the results of a study that used multiple methods to compare the occurrence of antimicrobial resistance in feces of beef cattle “raised without antibiotics” (RWA) and raised “conventionally” (CONV) (Vikram et al., 2017). The bla _KPC-2 gene was detected in all 72 samples of metagenomic DNA (mgDNA) tested by quantitative polymerase chain reaction (qPCR). These 72 samples (36 CONV and 36 RWA) each represented a “lot” (group of animals produced and marketed together) and were equally distributed over a calendar year. Since in the previous study, a small internal fragment of the bla _KPC-2 gene was targeted (Fig. 1) for qPCR, this report describes the additional experiments necessary to confirm whether functional KPC carbapenemases were present in those beef cattle fecal samples.

FIG. 1.

Genetic organization of canonical Tn4401 carrying bla _KPC-2. Oligonucleotide primer annealing locations are indicated by black arrows. KPC, Klebsiella pneumoniae carbapenemases

Methods

Institutional approval

All procedures and protocols used in this study were reviewed and approved by the U.S. Meat Animal Research Center Institutional Biosafety Committee (USMARC IBC Protocol #3.0). All fecal samples were obtained from eviscerated colons produced during the normal and routine operations at a commercial beef processing plant operating in compliance with all applicable regulations and inspected by the U.S. Department of Agriculture, Food Safety and Inspection Service. The samples were collected monthly at the processing plant from February 2014 to January 2015. For each month 10 samples per lot for six lots (three RWA, three CONV) representing six production sites were collected. Samples were transported to the laboratory on ice packs and held at −20°C until DNA isolation.

bla _KPC-2 cloning

mgDNA isolation was described previously (Vikram et al., 2017). Briefly, each mgDNA sample consisted of mgDNA isolated from feces obtained from 10 colons from different animals within a lot. Cattle within a lot were usually housed together at a feeding operation in the same pen or groups of pens. To design oligonucleotide primer pairs KPC-INT-F/KPC-INT-R and KPC-FL-F/KPC-FL-R 21 bla _KPC-2 sequences from multiple species were downloaded in Geneious 9.1.6 (Biomatters Ltd., Newark NJ) and aligned. Primers KPC-INT-F and KPC-INT-R were designed in the conserved region within the bla _KPC-2 gene, whereas KPC-FL-F and KPC-FL-R were constructed to anneal to the conserved spacer region between the Tn3 repeat region and the 3′ end of the bla _KPC-2, and the 5′ end of the bla _KPC-2 gene and tnpA (Fig. 1). Oligonucleotide primers KPC-FL-F and KPC-FL-R (Table 1) were used to amplify full-length bla _KPC-2 from 18 mgDNA samples (9 CONV and 9 RWA). These samples were selected from RWA and CONV lots and were positive for bla _KPC-2 gene by qPCR. A Bio-Rad T100 thermal cycler (Bio-Rad Laboratories, Inc., Hercules, CA) was used with 0.2 μM (final concentration) of primers, and Platinum Pfx DNA polymerase (Invitrogen Life Technologies, Carlsbad, CA). The cycling conditions were 94°C for 3 min, followed by 27 cycles of 94°C for 30 s, 55°C for 30 s, and 68°C for 90 s with final extension on 68°C for 10 min. For each sample, a single band of the expected size (∼1.1 kbp) was observed when PCR products were separated by electrophoresis on a 1.2% agarose gel. The band was excised and purified using the QIAquick Gel Extraction Kit (Qiagen Inc. Valencia, CA). The purified DNA was inserted into pCR4Blunt-TOPO cloning vector (Invitrogen Life Technologies) and transformed into Escherichia coli TOP10 cells (Invitrogen Life Technologies) plated on Luria-Bertani agar plates supplemented with 50 μg/mL kanamycin according to the manufacturer's instructions. E. coli transformants with reduced carbapenem susceptibility were identified by streaking on LB agar media supplemented with 1.25 μg/mL of imipenem. For each transformation event, between 5 and 10 colonies with reduced carbapenem susceptibility were screened for the presence of cloned fragments by PCR using M13 primers specific to sequences that flank the pCR4Blunt-TOPO cloning site. Then transformants with cloned sequences were screened for the presence or absence of bla _KPC-2 by PCR with the oligonucleotide primers KPC-INT-F and KPC-INT-R (Table 1). A Bio-Rad T100 thermal cycler was used with 0.2 μM (final concentration) of primers, 0.3 μL Bullseye Hot Start Taq DNA polymerase (MidSci, St. Louis, MO), and dNTPs (0.4 μL). Thermal cycling conditions were 96°C for 3 min followed by 34 cycles of 96°C for 30 s, 55°C for 30 s, and 72°C for 1 min with final extension on 72°C for 5 min. The transformants were stored as glycerol stocks and for ease of reading are referred to as “strains” hereafter.

Table 1.

Oligonucleotide Primers

Name	Sequence (5′ to 3′)	Reference
KPC-INT-F	AATGAGCTGCACAGTGGGAA	Vikram et al. (2017)
KPC-INT-R	ATCGCCGTCTAGTTCTGCTG	Vikram et al. (2017)
KPC-FL-F	ATTACATCCGGCCGCTACAC	This study
KPC-FL-R	GCGCAGACTCCTAGCCTAAA	This study

KPC, Klebsiella pneumoniae carbapenemases

Imipenem minimum inhibitory concentrations

Imipenem minimum inhibitory concentrations (MICs) were determined using the broth dilution method. Briefly, each strain was restreaked on Mueller Hinton agar supplemented with 1.25 μg/mL imipenem and grown overnight at 37°C. Four colonies from each plate were resuspended in Mueller Hinton Broth (MHB) and OD₆₂₅ was adjusted to 0.08–0.1 (equivalent to 0.5 McFarland solution). Fifty microliters of the OD₆₂₅-adjusted culture was added to 96-well plates containing twofold dilutions of imipenem in MHB for final concentrations ranging from 0.25 to 256 μg/mL. Plates were incubated at 35°C for 16 to 18 h. Imipenem MIC interpretive criteria were: susceptible ≤1 μg/mL, reduced susceptibility = 2 μg/mL, resistant ≥4 μg/mL following Clinical and Laboratory Standards Institute (CLSI) guidance for imipenem breakpoints for Enterobacteriaceae (CLSI, 2016).

Carbapenemase activity

Carbapenemase activity was detected using the Neo-Rapid CARB Kit 98024 (Rosco Diagnostica, Denmark), according to the manufacturer's instructions. Briefly, 10 μL loop of a colony grown overnight was suspended in 200 μL 0.9% sodium chloride solution (pH 8.5) in a glass tube. Ten microliters of 2.14% (wt/vol) Triton X-100 solution was added, and the tube was vortexed for 30 s and incubated for 30 min at room temperature. Indicator tablets were added to each tube then vortexed briefly to dissolve the tablets. Tubes were incubated at 37°C and inspected at 15, 30, and 60 min for any color change compared with negative controls. Change in color (from red to yellow or orange) was considered as positive carbapenemase activity.

Analysis of cloned sequences conferring reduced imipenem susceptibility

Plasmids were isolated using the PureLink Quick Plasmid Miniprep Kit (Invitrogen Life Technologies) according to the manufacturer's instructions. The cloned region was Sanger sequenced using M13 primer pair and fluorescently labeled terminator dye on ABI 3730xI DNA Analyzers (Applied Biosystems, Carlsbad, CA) at GeneWiz (South Plainfield, NJ) facility. Forward and reverse reads were merged using BBmerge in BBtool plugin (https://sourceforge.net/projects/bbmap) in Geneious 9.1.6 (Biomatters Ltd., Newark, NJ). The merged sequences were annotated by MegaBLAST algorithm with the “nr” database using word size of 28 and Max E-value of 1.0 × 10⁻¹ in the Geneious 9.1.6 software package. The top hits for each clone are reported. Alignments were performed using “Multiple Alignment Tool” in the Geneious 9.1.6 software package with 93% similarity. Phylogenetic trees were constructed using the MrBayes program (Huelsenbeck and Ronquist, 2001).

Results

For each of the 18 mgDNA samples, one bla _KPC-2 putative positive strain with reduced imipenem susceptibility was selected without any specific criteria (named A1 to A18) and characterized. Of the 18 bla _KPC-2 putative positive strains characterized, 14 had carbapenemase activity and imipenem MIC ≥32 μg/mL (Table 2). The remaining four strains had imipenem MICs = 2 μg/mL and lacked carbapenemase activity. Of the 18 bla _KPC-2-positive strains, 17 were sequenced with average Phred quality score (Q) of >30, where Q refers to the accuracy of nucleotide identification during automated sequencing (Ewing et al., 1998). Repeated sequencing for strain A13 in both directions resulted in poor-quality data. For each strain, the cloned sequences were highly similar to each other and the three bla _KPC-2 canonical examples (Fig. 2 and Supplementary Fig. S1; Supplementary Data are available online at www.liebertpub.com/fpd). Polymorphism analysis of the bla _KPC-2-positive clones indicated five synonymous and four nonsynonymous substitutions (Table 2). The bla _KPC-2 gene was in the opposite orientation of the pCR4Blunt-TOPO vector P_lac promoter for all four of the 2 μg/mL imipenem MIC strains (Table 2).

FIG. 2.

Generalized reversible time model tree for cloned bla _KPC-2 fragments with three published sequences. The sequences were aligned on Geneious 9.1.6 using parameters 93% similarity, Gap open penalty 12 and Gap extension penalty 3 and tree was generated using general time-reversible model by MrBayes in Geneious 9.1.6. The numbers over branches denote the number of base substitutions per site.

Table 2.

Characteristics of Selected Escherichia coli Top10 Strains Harboring bla _KPC-2 Cloned in PCR4blunt-TOPO

Strain	MIC (μg/mL)	Carbapenemase activity	Orientation relative to P_lac	Nucleotide transitions/transversion	Amino acid substitution(s)
A1	16	Positive	Forward	A569G	Q190R
A2	256	Positive	Forward
A3	>256	Positive	Forward
A4	2	Negative	Reverse	T20C	L7P
A5	64	Positive	Forward
A6	2	Negative	Reverse	T20C	L7P
A7	2	Negative	Reverse	T575C, G603A	L192P
A8	32	Positive	Forward
A9	64	Positive	Forward	A630G
A10	128	Positive	Forward	A342G
A11	2	Negative	Reverse	A251G	Q84R
A12	>256	Positive	Forward	A339G
A13	64	Positive	Forward	n/a	n/a
A14	64	Positive	Forward
A15	64	Positive	Forward
A16	64	Positive	Forward
A17	64	Positive	Forward
A18	64	Positive	Forward	T33C
D3	64	Positive	Forward	C15G, T40G

MIC, minimum inhibitory concentration; n/a, not applicable since A13 was not sequenced with high quality.

For each sample, reduced imipenem susceptibility strains negative for bla _KPC-2 by PCR with the oligonucleotide primers, KPC-INT-F and KPC-INT-R, were identified. Thirty-three of these strains were characterized to determine if these strains harbored non-bla _KPC-2 carbapenemases. For the one strain (D3) with a 64 μg/mL imipenem MIC and carbapenemase activity, the cloned sequence was bla _KPC-2 (Table 1). The other 32 strains had 2 μg/mL imipenem MICs and lacked carbapenemase activity. Sequence analysis showed these were similar to Bacteroides intestinalis hypothetical protein (Accession no. WP_061437718), Alistipes finegoldii gene encoding a tetraacyl disaccharide 4′ kinase LpxK protein (Accession no. CCZ76077), uncultured bacterium extrachromosomal DNA RGI00888 and Ruminococcus sp. (CDA20468) RecX protein.

Discussion

In this study, we have used a functional metagenomics approach to unambiguously demonstrate that a functional bla _KPC-2 gene is present in the feces of market weight U.S. beef cattle. Furthermore, the successful bla _KPC-2 cloning from all 18 samples with primers specific to transposon sequences (KPC-FL-F and KPC-FL-R) demonstrates that the detected bla _KPC-2 genes may be mobilized. These results are significant because bla _KPC-2 was not previously reported from food animals despite its widespread distribution in the United States. Interpreting these results is challenging since we are aware of only three analogous published studies that examined feces or fecal impacted environments for bla _KPC-2 by qPCR, although with different primers and amplification conditions. Two studies of a municipal wastewater treatment plant in Tianjin, China reported that bla _KPC-2 was detected in influent, all treatment phases, final effluent, and dewatered sludge (Yang et al., 2016, 2017). Another study reported that bla _KPC-2 was detected in wastewater effluents from three of seven Tunisian hospitals (Nasri et al., 2017).

Previous studies have suggested that CRB are rare in U.S. food animals. Webb et al. (2016) recently examined 159 fecal samples from dairy cattle at U.S. farms and concluded that CRB are “rare” in U.S. dairy cattle. However, the selective culture methods used may have failed to detect poorly cultivated species. Moreover, none of the bacteria with reduced susceptibility to carbapenems isolated by Webb et al. harbored bla _KPC-2. Also, Mollenkopf et al. (2017) used selective culture methods to isolate CRB from environmental samples obtained at a U.S. swine production operation. Multiple genera of CRB (Citrobacter, Enterobacter, Escherichia, Klebsiella, Morganella, Proteus, and Providencia) were isolated by Mollenkopf et al. and all CRB isolates harbored bla _IMP-27.

In contrast, results from our studies (Vikram et al., 2017; and this study) led us to conclude that bla _KPC-2 is likely more common in U.S. beef cattle than previously thought. This conclusion is supported by: (1) qPCR detection of bla _KPC-2 in feces from 72 different lots of cattle distributed over one calendar year (Vikram et al., 2017); (2) successful cloning of bla _KPC-2 from all 18 attempts using fecal mgDNA from different lots (Table 2); and (3) carbapenemase activity for all 14 strains with a bla _KPC-2 cloned in the proper orientation for transcription from the P_lac promoter (Table 2).

Additionally, we conclude that bla _KPC-2 is present in U.S. cattle feces regardless of antimicrobial exposure. Carbapenems, a sub-class of β-lactam antimicrobials, are not used in U.S. agriculture. However, Mollenkopf et al. (2017) more frequently isolated CRB in barns with greater use of the cephalosporin β-lactam ceftiofur leading to speculation that ceftiofur use may contribute to increased occurrence of carbapenemase genes. Conversely, using qPCR we found that fecal bla _KPC-2 levels did not differ between beef cattle produced CONV and RWA (Vikram et al., 2017) suggesting that factors other than antimicrobial use contribute to occurrence of bla _KPC-2 and possibly other CRB.

This study, together with our previous study of AMR in beef cattle feces (Vikram et al., 2017), the Webb et al. (2016) and Mollenkopf et al. (2017) studies demonstrate that diverse CRB are present in U.S. food animal production environments. However, conclusions regarding public health impacts or the influence of antimicrobial use practices during U.S. food animal production are premature. We note that Agga et al. (2015) more frequently detected carbapenem resistance genes in U.S. municipal wastewater treatment plant effluents than in cattle feedlot runoff catchment ponds and swine waste lagoons. Additional research is required to provide an ecological understanding of carbapenemase resistance in human feces, feces from food animal species, companion animals, wildlife, and the environment. These surveys must simultaneously incorporate multiple culture methods (as this may facilitate the isolation and analysis of organisms harboring bla _KPC-2) and qPCR for multiple carbapenemase genes. Metagenomic sequencing will not be sufficient. Using qPCR we detected bla _KPC-2 in 72 mgDNA samples of beef cattle feces, but metagenomic sequencing did not detect bla _KPC-2 (Vikram et al., 2017). Also, longitudinal cohort studies specific to each commodity are required to accurately gauge the impact of specific antimicrobial uses (i.e., ceftiofur) in food animal production on carbapenemase gene and CRB occurrence.

Footnotes

Acknowledgments

The authors thank Julie Dyer and Frank Reno for technical support. They thank Jody Gallagher for administrative assistance.

Names are necessary to report factually on available data; however, the USDA neither guarantees nor warrants the standard of the product, and the use of the name by the USDA implies no approval of the product to the exclusion of others that may also be suitable. USDA is an equal opportunity provider and employer.

Funding

This work was supported by the Untied States Department of Agriculture, Agricultural Research Service, National Program 108—Food Safety (Project No. 3040-42000-018). The funding agency had no role in study design, data collection, and interpretation, or the decision to submit the work for publication.

Disclosure Statement

No competing financial interests exist.

Author Contributions

A.V. and J.W.S. designed the research. A.V. performed the experiments. A.V. and J.W.S. analyzed data. A.V. and J.W.S. wrote the article.

References

Agga

, Arthur

, Durso

, Harhay

, Schmidt

. Antimicrobial-resistant bacterial populations and antimicrobial resistance genes obtained from environments impacted by livestock and municipal waste. PLoS One, 2015; 10:e0132586.

CDC. Antibiotic resistance threats in the United States, 2013. Centers for Disease Control and Prevention, 2013. Available at: http://www.cdc.gov/drugresistance/threat-report-2013/pdf/ar-threats-2013-508.pdf, accessed October 28, 2013 .

CLSI. Performance Standards for Antimicrobial Susceptibility Testing, 26th edition. M100S. Wayne, PA: Clinical and Laboratory Standards Institute, 2016.

Ewing

, Hillier

, Wendl

, Green

. Base-calling of automated sequencer traces using phred. I. Accuracy assessment. Genome Res, 1998; 8:175–185.

FDA. NARMS Retail Meat Annual Report, 2011. Washington, DC: U.S. Food and Drug Administration, 2015. Available at: https://www.fda.gov/downloads/animalveterinary/safetyhealth/antimicrobialresistance/nationalantimicrobialresistancemonitoringsystem/ucm442212.pdf, accessed December 1, 2016 .

Fischer

, Rodriguez

, Schmoger

, Friese

, Roesler

, Helmuth

, Guerra

. Escherichia coli producing VIM-1 carbapenemase isolated on a pig farm. J Antimicrob Chemother, 2012; 67:1793–1795.

Fischer

, Rodriguez

, Schmoger

, Friese

, Roesler

, Helmuth

, Guerra

. Salmonella enterica subsp. Enterica producing VIM-1 carbapenemase isolated from livestock farms. J Antimicrob Chemother, 2013; 68:478–480.

Guerra

, Fischer

, Helmuth

. An emerging public health problem: Acquired carbapenemase-producing microorganisms are present in food-producing animals, their environment, companion animals and wild birds. Vet Microbiol, 2014; 171:290–297.

Huelsenbeck

, Ronquist

. Mrbayes: Bayesian inference of phylogenetic trees. Bioinformatics, 2001; 17:754–755.

10.

Laube

, Friese

, von Salviati

, Guerra

, Kasbohrer

, Kreienbrock

, Roesler

. Longitudinal monitoring of extended-spectrum-beta-lactamase/AmpC-producing Escherichia coli at German broiler chicken fattening farms. Appl Environ Microbiol, 2013; 79:4815–4820.

11.

Mollenkopf

, Stull

, Mathys

, Bowman

, Feicht

, Grooters

, Daniels

, Wittum

. Carbapenemase-producing Enterobacteriaceae recovered from the environment of a swine farrow-to-finish operation in the United States. Antimicrob Agents Chemother, 2017; 61:e01298-16.

12.

Munoz-Price

, Poirel

, Bonomo

, Schwaber

, Daikos

, Cormican

, Cornaglia

, Garau

, Gniadkowski

, Hayden

, Kumarasamy

, Livermore

, Maya

, Nordmann

, Patel

, Paterson

, Pitout

, Villegas

, Wang

, Woodford

, Quinn

. Clinical epidemiology of the global expansion of Klebsiella pneumoniae carbapenemases. Lancet Infect Dis, 2013; 13:785–796.

13.

Nasri

, Subirats

, Sanchez-Melsio

, Mansour

, Borrego

, Balcazar

. Abundance of carbapenemase genes (bla _KPC, bla _NDM and bla _OXA-48) in wastewater effluents from Tunisian hospitals. Environ Pollut, 2017; 229:371–374.

14.

Papp-Wallace

, Bethel

, Distler

, Kasuboski

, Taracila

, Bonomo

. Inhibitor resistance in the KPC-2 beta-lactamase, a preeminent property of this class A beta-lactamase. Antimicrob Agents Chemother, 2010; 54:890–897.

15.

Poirel

, Bercot

, Millemann

, Bonnin

, Pannaux

, Nordmann

Carbapenemase-producing Acinetobacter spp. in cattle, France. Emerg Infect Dis, 2012; 18:523–525.

16.

Queenan

, Bush

. Carbapenemases: The versatile beta-lactamases. Clin Microbiol Rev, 2007; 20:440–458.

17.

Vikram

, Rovira

, Agga

, Arthur

, Bosilevac

, Wheeler

, Morley

, Belk

, Schmidt

. Impact of “raised without antibiotics” beef cattle production practices on occurrences of antimicrobial resistance. Appl Environ Microbiol, 2017; 83:e01682-17.

18.

Webb

, Bugarel

, den Bakker

, Nightingale

, Granier

, Scott

, Loneragan

. Carbapenem-resistant bacteria recovered from faeces of dairy cattle in the high plains region of the USA. PLoS One, 2016; 11:e0147363.

19.

WHO. Critically important antimicrobials for human medicine–5th rev. Geneva: World health Organization, 2017. Available at: http://www.Who.Int/foodborne_disease/resistance/cia/en/, accessed December 5, 2017 .

20.

Yang

, Huang

, Li

, Yang

, Mao

, Luo

. Discharge of kpc-2 genes from the WWTPs contributed to their enriched abundance in the receiving river. Sci Total Environ, 2017; 581–582:136–143.

21.

Yang

, Mao

, Zhou

, Luo

. Prevalence and fate of carbapenemase genes in a wastewater treatment plant in northern china. PLoS One, 2016; 11:e0156383.

22.

Zhang

, Lu

, Schwarz

, Zhang

, Wang

, Si

, Yu

, Chen

, Liu

. Complete sequence of the bla _NDM-1-carrying plasmid pNDM-AB from Acinetobacter baumannii of food animal origin. J Antimicrob Chemother, 2013; 68:1681–1682.

Supplementary Material

Please find the following supplemental material available below.

For Open Access articles published under a Creative Commons License, all supplemental material carries the same license as the article it is associated with.

For non-Open Access articles published, all supplemental material carries a non-exclusive license, and permission requests for re-use of supplemental material or any part of supplemental material shall be sent directly to the copyright owner as specified in the copyright notice associated with the article.

0.00 MB

0.55 MB

Functional bla KPC-2 Sequences Are Present in U.S. Beef Cattle Feces Regardless of Antibiotic Use

Abstract

Introduction

Methods

Institutional approval

bla KPC-2 cloning

Imipenem minimum inhibitory concentrations

Carbapenemase activity

Analysis of cloned sequences conferring reduced imipenem susceptibility

Results

Discussion

Footnotes

Acknowledgments

Funding

Disclosure Statement

Author Contributions

References

Supplementary Material

bla _KPC-2 cloning