Prevalence of Enterotoxin Genes in Staphylococcus aureus Isolates from Pork Production

Abstract

In this study, 130 Staphylococcus aureus isolates from samples associated with pork production were tested for prevalence of 18 staphylococcal enterotoxin (SE) genes. Approximately 94.6% (123/130) of isolates from different stages of pork production harbored one or more SE genes forming 37 different enterotoxin gene profiles. Seb was present in 60.0% of the S. aureus isolates, the highest among the genes tested. The genes, sed, sej, seo, sep, ser, and seu, were not found. The five classical SE genes (including sea, seb, sec, sed, see) had lower prevalence than the egc gene cluster (seg, sei, sem, sen, seo, or seu). Notably, ∼6.9% (9/130) isolates harbored five SE genes. Classical SE genes were relatively higher in raw meat isolates than swine farm isolates, suggesting that raw meat isolates have a greater potential for classical staphylococcal food poisoning. Incomplete egc clusters were mainly distributed in swine farm isolates, and some of them coexisted with other classical SE genes (seb, sec), showing that swine farms could be potential sources of enterogenic S. aureus of food safety concern. Characterizing the distributions of enterotoxin genes among S. aureus may provide epidemiological information for the benefit of public health and food safety.

Introduction

Staphylococcal enterotoxins (SEs) excreted into food by enterotoxigenic strains of coagulase-positive Staphylococci (CPS), mainly Staphylococcus aureus, account for a large number of foodborne illnesses worldwide (Zeleny et al., 2015). SEs are active in high nanogram to low microgram quantities (Larkin et al., 2009), and are resistant to conditions (heat treatment, low pH) that easily destroy the bacteria that produce them, and to proteolytic enzymes, hence retaining their activity in the digestive tract after ingestion (Schantz et al., 1965; Bergdoll et al., 1983; Evenson et al., 1988). To date, 23 SEs and SE-like enterotoxins (SEls) have been identified, including classical types of SEs (SEA-SEE) and new SE/SEls (SEG-SElX). Moreover, certain new SE/SEls have been identified as a potential cause of foodborne outbreaks (Omoe et al., 2003; Umeda et al., 2017).

All of the SEs are typically encoded by the genes located on mobile genetic elements (MGEs), including prophages, plasmids, genomic island vSa, S. aureus pathogenicity island (SaPIs), and staphylococcal cassette chromosome mec (SCCmec) elements (Zhang et al., 1998; Omoe et al., 2003). This finding implies that SE/SEl genes are transferred among staphylococcal strains by horizontal transfer of MGEs, which accelerates the evolution of pathogenic S. aureus strains among animals as well as in humans (Uhlemann et al., 2012). Certain SE genes are grouped together on MGEs. For example, the genes of seg, sei, sem, sen, seo, and sometimes seu are typically present together on the genomic island vSaβ, namely enterotoxin gene cluster (egc) (Jarraud et al., 2001). Result of epidemiological and laboratory investigations implicated that S. aureus harboring egc without production of classical SEs could also cause foodborne outbreak (Umeda et al., 2017). Several studies have shown that egc is commonly distributed in foodborne and clinical S. aureus (Becker et al., 2003; Shuiep et al., 2009; Varshney et al., 2009; Aydin et al., 2011; Umeda et al., 2012).

Previous studies showed that raw and processed meat were the major food sources associated with S. aureus food poisoning, and food animals as well as contaminated surfaces or tools could serve as vehicles for the transfer of S. aureus to foods (Argudin et al., 2010; Waters et al., 2011; Chao et al., 2014). China is one of the world's largest pork producers with more than 470 million pigs, accounting for ∼50% of the total numbers in the world (Krishnasamy et al., 2015). In this country, the per capita consumption of meats has increased significantly over the past decades. Consequently, there is an increased potential for exposure to foodborne pathogens. From 2011 to 2014, 1244 pathogenic microorganism foodborne disease outbreaks were reported in China, which resulted in 27,479 illnesses (Wu et al., 2016). Among these illnesses, S. aureus was recognized as one of the most prominent culprits, resulting in 3269 illnesses (11.9%) (Wu et al., 2016). However, there is a paucity of data regarding SE genes distribution and virulence potential of S. aureus isolates from samples associated with pork production in China. The aim of this study was to analyze the distribution of genes encoding for SEs in S. aureus isolates from different stages of pork production.

Materials and Methods

Isolation of S. aureus and coagulase assays

From September–December 2014, three commercial swine farms with >5000 pigs, one large slaughterhouse, and several terminal markets were selected from Xiamen City, People's Republic of China, and 501 samples were collected from these places for S. aureus isolation. Pigs were born and raised in these three commercial swine farms with a distance of more than 25 km from each other and were then sent to the slaughterhouse. These three swine farms and the slaughterhouse were vertically integrated pork processing plant, meaning pigs originated from these three swine farms contracted to sell hogs exclusively to the slaughterhouse. However, terminal samples from the markets did not totally originate from the slaughterhouse tested in the present study.

Briefly, a total of 501 nonduplicate samples were collected from the pork industry, including three commercial swine farms (sty door and soil, n = 71; nasal swabs, n = 97), one slaughterhouse (pork, n = 173), and terminal markets (pork, n = 160). Isolation and identification of S. aureus were performed according to China's National Technical Standard GB4789.10-2010 and the special gene nuc was targeted by PCR for identifying S. aureus (Brakstad et al., 1992).

Contamination with S. aureus was detected in 26.0% (130/501) of the total samples, and the prevalence of S. aureus was highest in the slaughterhouse (35.8%, 62/173) followed by the market (24.4%, 39/160) and the farm (17.3%, 29/168).

Detection of SE genes

Bacterial genomic DNA template was extracted from the isolates by a commercial DNA Extraction Kit (Biomed, Beijing, China). The primer sequence, PCR product length (bp), and annealing temperature (°C) are reported in Table 1. Each assay contained 1 μL of prepared DNA template, 2.5 μL of 10 × Easy Taq Buffer (TaKaRa), 1 μL of 10 mM deoxynucleotide triphosphate (TaKaRa), 1 μL of several upstream and downstream primers (10 μM), and 0.125 μL of DNA polymerase (5 U/μL) (TaKaRa). The final system volume was adjusted to 25 μL. The PCR conditions were as follows: 1 cycle at 95°C for 10 min; 30 cycles of 95°C for 30 s, annealing temperature for 30 s, 72°C for 40–90 s depending on the PCR product length, and a final 1 cycle at 72°C for 10 min. All oligonucleotide primers used in this study were synthesized by Sangon Biotech (Shanghai, China). The sequencing of PCR products was performed by Beijing Genomics Institute (Shenzhen, China) and the data were analyzed with the GenBank database using the BLAST algorithm at the National Center for Biotechnology Information web site (www.ncbi.nlm.nih.gov).

Table 1.

Target Genes, Primer Sequences, and Polymerase Chain Reaction Conditions

Target gene	Primer name	Primer sequence (5′–3′)	Product size (bp)	Annealing temperature (°C)	References
sea	sea-F	GGATATTGTTGATAAATATAAAGGGAAAAAAG	439	50	Betley and Mekalanos (1988)
sea	sea-R	GTTAATCGTTTTATTATCTCTATATATTCTTAATAGT	439	50	Betley and Mekalanos (1988)
seb	seb-F	AGATTTAGCTGATAAATACAAAGATAAATACG	494	52	Jones and Khan (1986)
seb	seb-R	TCGTAAGATAAACTTCAATCTTCACATCT	494	52	Jones and Khan (1986)
sec	sec-F	AGATTTAGCAAAGAAGTACAAAGATG	490	51	Bohach and Schlievert (1987)
sec	sec-R	AAGGTGGACTTCTATCTTCACACTT	490	51	Bohach and Schlievert (1987)
sed	sed-F	CTAGTTTGGTAATATCTCCT	318	43	Ote et al. (2011)
sed	sed-R	TAATGCTATATCTTATAGGG	318	43	Ote et al. (2011)
see	see-F	GGGAAAAAAGTAGACTTATATGGTG	348	50	Ote et al. (2011)
see	see-R	ATCATAACTTACCGTGGACC	348	50	Ote et al. (2011)
seg	seg-F	TGCTATCGACACACTACAACC	704	50	Ote et al. (2011)
seg	seg-R	CCAGATTCAAATGCAGAACC	704	50	Ote et al. (2011)
seh	seh-F	TGATTTAGCTCAGAAGTTTAAAAATAAAAATG	466	51	Ren et al. (1994)
seh	seh-R	TTTCTTAGTATATAGATTTACATCAATATG	466	51	Ren et al. (1994)
sei	sei-F	CTCAAGGTGATATTGGTGTAGG	577	48	Ote et al. (2011)
sei	seiR	AAAAAACTTACAGGCAGTCCATCTC	577	48	Ote et al. (2011)
sej	sej-F	ATGAAAAAAACAATATTTATACTGATTTTCTCCC	807	53	Zhang et al. (1998)
sej	sej-R	TCTACAGAACCAAAGGTAGACTTATTAATAC	807	53	Zhang et al. (1998)
sek	sek-F	ATGAATCTTATGATTTAATTTCAGAATCAA	545	50	Yarwood et al. (2002)
sek	sek-R	ATTTATATCGTTTCTTTATAAGAAATATCG	545	50	Yarwood et al. (2002)
sel	sel-F	ATGAAAAAAAGATTATTATTTGTAATTGTTATTAC	723	50	Fitzgerald et al. (2001)
sel	sel-R	ATCATCTTTTTGAAATTTCGACATCTAG	723	50	Fitzgerald et al. (2001)
sem	sem-F	ATGAAAAGAATACTTATCATTGTTGTTTTATTG	720	51	Jarraud et al. (2001)
sem	sem-R	CTTCAACTTTCGTCCTTATAAGATATTTC	720	51	Jarraud et al. (2001)
sen	sen-F	ATAAAAAATATTAAAAAGCTTATGAGATTGTTC	777	50	Jarraud et al. (2001)
sen	sen-R	ACTTAATCTTTATATAAAAATACATCAATATG	777	50	Jarraud et al. (2001)
seo	seo-F	TATGTAGTGTAAACAATGCATATGCA	685	51	Jarraud et al. (2001)
seo	seo-R	TCTATTGTTTTATTATCATTATAAATTTGCAAAT	685	51	Jarraud et al. (2001)
sep	sep-F	TTAGACAAACCTATTATCATAATGGAAGT	618	51	Kuroda et al. (2001)
sep	sep-R	TATATAAATATATATCAATATGCATATTTTTAGACT	618	51	Kuroda et al. (2001)
seq	seq-F	GGAAAATACACTTTATATTCACAGTTTCA	542	51	Yarwood et al. (2002)
seq	seq-R	ATTTATTCAGTTTTCTCATATGAAATCTC	542	51	Yarwood et al. (2002)
ser	ser-F	AGCGGTAATAGCAGAAAATG	363	53	Omoe et al. (2003)
ser	ser-R	TCTTGTACCGTAACCGTTTT	363	53	Omoe et al. (2003)
seu	seu-F	AATGGCTCTAAAATTGATGG	215	53	Letertre et al. (2003)
seu	seu-R	ATTTGATTTCCATCATGCTC	215	53	Letertre et al. (2003)

Statistical analysis

Statistical analysis was performed with SPSS v.22.0 (SPSS, Inc., Chicago, IL). Differences in groups were compared using the chi-squared test and a p-value of <0.05 was deemed to be significant.

Results

The prevalence of enterotoxin genes

Among the 130 isolates, 123 (94.6%) S. aureus harbored 330 SE genes forming 37 different enterotoxin types, with 1 to 5 enterotoxin genes per isolate in different combinations (Fig. 1 and Table 4). The five traditional toxin genes (including sea, seb, sec, sed, and see) had lower prevalence than the egc gene cluster (seg, sei, sem, sen, seo, or seu). The most frequent enterotoxin gene was seb (60.0%); sed, sej, seo, sep, ser, and seu were not found. Notably, ∼6.9% (9/130) isolates harbored five enterotoxin genes (Table 2). None of completed egc cluster (seg, sei, sem, sen, seo, or seu) was detected in all isolates. There was no enterotoxin genes found in seven isolates, and accounted for 5.4% (Table 2).

FIG. 1.

The positive rates of 18 SE genes in 130 Staphylococcus aureus isolates from pork production. SE, staphylococcal enterotoxin.

Table 2.

The Enterotoxin Gene(s) Number of Staphylococcus aureus Isolated from Different Stages of Pork Production

	Number of S. aureus isolated from
	Swine farm		Slaughterhouse	Terminal market ^a
Number of enterotoxin gene(s) per isolate (n)	Nasal swabs (n = 22), n (%)	Environment ^b (n = 7), n (%)	Raw meat (n = 62), n (%)	Raw meat (n = 39), n (%)	Total number (n = 130), n (%)
5	4 (18.2)		4 (6.5)	1 (2.6)	9 (6.9)
4	9 (40.9)	3 (42.9)	8 (12.9)	6 (15.4)	26 (20.0)
3	6 (27.3)	4 (57.1)	12 (19.4)	14 (35.9)	36 (27.7)
2	3 (13.6)		8 (12.9)	10 (25.6)	21 (16.2)
1			23 (37.1)	8 (20.5)	31 (23.8)
0			6 (9.7)	1 (2.6)	7 (5.4)

Isolates from farmers' markets or supermarkets.

Isolates from sty door and soil.

The distribution of enterotoxin genes

The distribution of SE genes (Table 3) and SE gene profiles (Table 4) among S. aureus isolates was further analyzed based on the sample categories. As for classical SE genes, seb was detected in the swine farm isolates, whereas sea, seb, sec, and see were found in the slaughterhouse and terminal market isolates (Table 3). As for novel SE genes, seg, sei, sem, and sen, were relatively higher in swine farm isolates than those from other sources. Because of high-frequency transfer of SE/SEl genes containing MGEs among staphylococcal strains, a total of 37 different enterotoxin gene combinations were detected, including an incomplete egc cluster in 12 isolates, co-occurrence of classical SE genes, sea, seb, and see, in 16 isolates, et al. Furthermore, incomplete egc clusters were mainly distributed in swine farm isolates, and some of them coexisted with other classical SE genes (seb, sec). Co-occurrence of classical SE gene sea+seb and see combinations was frequently detected in S. aureus isolates from terminal markets and slaughterhouse. It is noteworthy that the combination of seb+seg+sem+sen was dominant among S. aureus isolates from swine farms, while the combination of sea+seb+sek+seq was only detected in isolates from both the slaughterhouse and terminal markets. There were 28 isolates from the slaughterhouse and terminal markets, which only encode an enterotoxin gene.

Table 3.

The Distribution of the 18 Staphylococcal Enterotoxin Genes in 130 Staphylococcus aureus Isolates from Different Stages of Pork Production

		Classical SE genes					Novel SE genes
Sources of isolates	Number of isolates	sea	Seb	sec	sed	see	seg	seh	sei	sej	sek	sel	Sem	sen	seo	sep	seq	ser	seu	Total	Mean ^a
Swine farm Nasal swabs	22		11				22		8				20	19						80	3.6
Environment^b	7		5				7						7	5						24	3.4
Total in Swine farm (%)	29		16 (55.2)				29 (100)		8 (27.6)				27 (93.1)	24 (82.8)						104	3.6
Slaughterhouse (%)
Raw meat	62	9 (14.5)	35 (56.4)	2 (3.2)		5 (8.1)	23 (37.1)	3 (4.8)	9 (15.2)		2 (3.2)	2 (3.2)	29 (46.8)	6 (9.7)			4 (6.5)			129	2.1
Terminal market (%)
Raw meat^c	39	22 (56.4)	27 (71.8)	2 (5.1)		18 (46.2)	4 (10.3)				4 (10.2)	1 (2.6)	14 (35.9)	2 (2.6)			3 (7.7)			97	2.5
Total in all (%)	130	31 (23.8)	78 (60.0)	4 (3.1)		23 (17.7)	56 (43.1)	3 (2.3)	17 (13.1)		6 (4.6)	3 (2.3)	70 (53.8)	32 (24.6)			7 (5.6)			330	2.5

The number of toxin genes per strain on average.

Isolates from sty door and soil.

Isolates from farmers' markets or supermarkets.

SE, staphylococcal enterotoxin.

Table 4.

The Prevalence and Distribution of Enterotoxin Gene Profiles Among 130 Staphylococcus aureus from Different Stages of Pork Production

	Number (%) of SE genotypes from different stage isolates
SE genotypes	Nasal swabs (swine farms) (n = 22), n (%)	Environment ^a (swine farms) (n = 7), n (%)	Raw meat (slaughterhouse) (n = 62), n (%)	Raw meat ^b (terminal markets) (n = 39), n (%)	All sources (n = 130), n (%)
sea, seb, see			3 (4.8)	9 (23.1)	12 (9.2)
seg, sem	2 (9.1)		5 (8.1)	2 (5.1)	9 (6.9)
seb, seg, sem, sen	5 (22.7)	3 (42.9)			8 (6.2)
seg, sei, sem, sen	4 (18.2)		3 (4.8)		7 (5.4)
seb, seg, sem	1 (4.5)	2 (28.6)	3 (4.8)	1 (2.6)	7 (5.4)
seg, sem, sen	4 (18.2)	2 (28.6)		1 (2.6)	7 (5.4)
seb, seg, sei, sem, sen	4 (18.2)		2 (3.2)		6 (4.6)
sea, seb, sek, seq			2 (3.2)	2 (5.1)	4 (3.1)
sea, seb, see, sem				3 (7.7)	3 (2.3)
sea, seb				3 (7.7)	3 (2.3)
sea, see, sem				2 (5.1)	2 (1.5)
sec, sel, sem			1 (1.6)	1 (2.6)	2 (1.5)
seb, see				2 (5.1)	2 (1.5)
sea, seb, seg			1 (1.6)		1 (0.8)
sec, seg, sel, sem, sen			1 (1.6)		1 (0.8)
sea, seb, see, seg, sem			1 (1.6)		1 (0.8)
sea, seb, sek, seq, sem				1 (2.6)	1 (0.8)
seb, seg, sei, sem			1 (1.6)		1 (0.8)
seg, seh, sei, sem			1 (1.6)		1 (0.8)
sea, seb, sec, see				1 (2.6)	1 (0.8)
sea, seb, seq, seg			1 (1.6)		1 (0.8)
seb, seg, sei, sen	1 (4.5)				1 (0.8)
seg, sei, sem			1 (1.6)		1 (0.8)
seg, seh, sem			1 (1.6)		1 (0.8)
seb, seh, sei			1 (1.6)		1 (0.8)
sea, seb, seg			1 (1.6)		1 (0.8)
sea, seb, sem			1 (1.6)		1 (0.8)
seg, sen	1 (4.5)				1 (0.8)
seb, seg			1 (1.6)		1 (0.8)
see, sem			1 (1.6)		1 (0.8)
seb, sek				1 (2.6)	1 (0.8)
seb, sem				1 (2.6)	1 (0.8)
sea, see				1 (2.6)	1 (0.8)
seb, seq			1 (1.6)		1 (0.8)
seb			15 (24.2)	4 (10.3)	19 (14.6)
seg				1 (2.6)	1 (0.8)
sem			6 (9.7)	2 (5.1)	8 (6.2)
None^c			8 (12.9)	1 (2.6)	9 (6.9)
Total	22 (100)	7 (100)	62 (100)	39 (100)	130 (100)

Isolates from sty door and soil.

Isolates from farmers' markets or supermarkets.

None indicates isolates do not harbor any SE genes.

SE, staphylococcal enterotoxin.

Discussion

S. aureus is part of the commensal microbiota of the human or animal population and could cause a range of illnesses, from minor skin infections (pimples) to life-threatening diseases (Argudin et al., 2010). Previous studies indicated the entrance of S. aureus in the food chain, for example, through contamination of carcasses during the slaughtering process (Van Loo et al., 2007) or through secondary contamination by slaughterhouse staff (Pu et al., 2009), hence the potential of these S. aureus to cause foodborne disease has to be evaluated. Our results show that the distribution of different SE genes in S. aureus was different in the same source, and the distribution of the same SE gene at different stages of pork production was also different. For example, among slaughterhouse isolates, the abundance of classical SE genes (including sea, seb, sec, sed, and see) was relatively lower than the egc gene cluster (seg, sei, sem, sen, seo, or seu). Notably, the diversity of SE gene profiles in raw meat isolates was significantly greater than those in swine farms isolates, indicating cross-contamination during pork meat processing. Classical SE genes were relatively higher in raw meat isolates than swine farms isolates, suggesting that raw meat isolates have a greater potential for classical staphylococcal food poisoning (SFP). Incomplete egc clusters were mainly distributed in swine farm isolates, and some of them coexisted with other classical SE genes (seb, sec), showing that swine farms could be potential sources of enterogenic S. aureus of food safety concern.

The SE genes are commonly carried and disseminated through different MGEs (Malachowa and DeLeo, 2010), therefore, we further emphasized the positive correlations of some enterotoxin-encoding genes that are genetically linked and whose combinations seem to be conserved among S. aureus. Most of isolates in this study contained the incomplete egc (seg, sei, sem, sen), lacking two genes, and they coexisted with other SE genes, especially seb. Previous studies showed that the egc locus could be a reproduction source of enterotoxin gene evolution (Jarraud et al., 2001; Thomas et al., 2006). Our results show that another important combination is sea+seb+sek+seq, which is closely related to a prevalent hospital-acquired methicillin-resistant S. aureus (MRSA) observed among Asian populations (Suzuki et al., 2014). In addition, sec+sel+sem combination was detected in two isolates simultaneously, which is often observed on SaPIbov1, SaPIn1/m1, or SaPImw2 (Alibayov et al., 2014). Interestingly, SCCmec is typically carried by antibiotic resistance genes, in which enterotoxin seh is inserted together with transposase in the methicillin resistance cassette, SCCmec, which provides a possible cotransfer of antibiotic genes and SEs genes (Noto and Archer, 2006). There were three isolates that harbored seh, and one isolate has been identified as methicillin-resistant S. aureus (data not shown), thus further studies are needed to determine the correlation of MRSA with the enterotoxigenicity, and whether cotransfer of antibiotic genes and SEs genes among staphylococcal strains is possible.

Conclusions

Characterizing the distributions of SE genes and gene clusters in S. aureus isolates from samples associated with pork production may provide epidemiological information for the benefit of public health and food safety. Slaughterhouse and terminal market isolates were the main potential cause of classical SFP, while swine farms isolates harboring novel SE genes could become new potential risk factors for food safety. Thus, to control staphylococcal food poisoning and to ensure food safety, the roles of new SEs as well as those of classical SEs must be considered, and warrants further study to assess their pathogenicity using animal models and contribution to foodborne disease burden.

Footnotes

Acknowledgments

This work was supported by the National Key Basic Research Program (2016YFD0500606), the Science and Technology Planning Project of Guangdong Province, China (2014A020214001, 2016A020219001), the Construction of the First Class Universities (Subject) and Special Development Guidance Special Fund (K5174960), and the Fundamental Research Funds for the Central Universities, SCUT (D2170320).

Disclosure Statement

No competing financial interests exist.

References

Alibayov

, Zdenkova

, Sykorova

, Demnerova

. Molecular analysis of Staphylococcus aureus pathogenicity islands (SaPI) and their super antigens combination of food samples. J Microbiol Methods, 2014; 107:197–204.

Argudin

, Mendoza

, Rodicio

. Food poisoning and Staphylococcus aureus enterotoxins. Toxins (Basel), 2010; 2:1751–1773.

Aydin

, Sudagidan

, Muratoglu

. Prevalence of staphylococcal enterotoxins, toxin genes and genetic-relatedness of foodborne Staphylococcus aureus strains isolated in the Marmara Region of Turkey. Int J Food Microbiol, 2011; 148:99–106.

Becker

, Friedrich

, Lubritz

, Weilert

, Peters

, Von Eiff

. Prevalence of genes encoding pyrogenic toxin super antigens and exfoliative toxins among strains of Staphylococcus aureus isolated from blood and nasal specimens. J Clin Microbiol, 2003; 41:1434–1439.

Bergdoll

, Easman

CSF

, Adlam

. Enterotoxins. In: Staphylococci and Staphylococcal Infections. London, UK: Academic Press, 1983.

Betley

, Mekalanos

. Nucleotide sequence of the type A staphylococcal enterotoxin gene. J Bacteriol, 1988; 170:34–41.

Bohach

, Schlievert

. Nucleotide sequence of the staphylococcal enterotoxin C1 gene and relatedness to other pyrogenic toxins. Mol Gen Genet, 1987; 209:15–20.

Brakstad

, Aasbakk

, Maeland

. Detection of Staphylococcus aureus by polymerase chain reaction amplification of the nuc gene. J Clin Microbiol, 1992; 30:1654–1660.

Chao

, Bao

, Jiao

. Molecular epidemiological characteristics and clonal genetic diversity of Staphylococcus aureus with different origins in China. Foodborne Pathog Dis, 2014; 11:503–510.

10.

Evenson

, Hinds

, Bernstein

, Bergdoll

. Estimation of human dose of staphylococcal enterotoxin A from a large outbreak of staphylococcal food poisoning involving chocolate milk. Int J Food Microbiol, 1988; 7:311–316.

11.

Fitzgerald

, Monday

, Foster

, Bohach

, Hartigan

, Meaney

, Smyth

. Characterization of a putative pathogenicity island from bovine Staphylococcus aureus encoding multiple superantigens. J Bacteriol, 2001; 183:63–70.

12.

Jarraud

, Peyrat

, Lim

, Tristan

, Bes

, Mougel

, Etienne

, Vandenesch

, Bonneville

, Lina

. Egc, a highly prevalent operon of enterotoxin gene, forms a putative nursery of superantigens in Staphylococcus aureus . J Immun, 2001; 166:669–677.

13.

Jones

, Khan

. Nucleotide sequence of the enterotoxin B gene from Staphylococcus aureus . J Bacteriol, 1986; 166:29–33.

14.

Krishnasamy

, Otte

, Silbergeld

. Antimicrobial use in Chinese swine and broiler poultry production. Antimicrob Resist Infect Control, 2015; 4:17.

15.

Kuroda

, Ohta

, Uchiyama

, Baba

, Yuzawa

, Kobayashi

, Cui

, Oguchi

, Aoki

, Nagai

, Lian

, Ito

, Kanamori

, Matsumaru

, Maruyama

, Murakami

, Hosoyama

, Mizutani-Ui

, Takahashi

, Sawano

, Inoue

, Kaito

, Sekimizu

, Hirakawa

, Kuhara

, Goto

, Yabuzaki

, Kanehisa

, Yamashita

, Oshima

, Furuya

, Yoshino

, Shiba

, Hattori

, Ogasawara

, Hayashi

, Hiramatsu

. Whole genome sequencing of methicillin-resistant Staphylococcus aureus . Lancet, 2001; 357:1225–1240.

16.

Larkin

, Carman

, Krakauer

, Stiles

. Staphylococcus aureus: The toxic presence of a pathogen extraordinaire. Curr Med Chem, 2009; 16:4003–4019.

17.

Letertre

, Perelle

, Dilasser

, Fach

. Identification of a new putative enterotoxin seu encoded by the egc cluster of Staphylococcus aureus . J Appl Microbiol, 2003; 95:38–43.

18.

Malachowa

, DeLeo

. Mobile genetic elements of Staphylococcus aureus . Cell Mol Life Sci, 2010; 67:3057–3071.

19.

Noto

, Archer

. A subset of Staphylococcus aureus strains harboring staphylococcal cassette chromosome mec (SCCmec) type IV is deficient in ccrAB-mediated SCCmec excision. Antimicrob Agents Chemother, 2006; 50:2782–2788.

20.

Omoe

, Hu

, Takahashi-Omoe

, Nakane

, Shinagawa

. Identification and characterization of a new staphylococcal enterotoxin-related putative toxin encoded by two kinds of plasmids. Infect Immun, 2003; 71:6088–6094.

21.

Ote

, Taminiau

, Duprez

, Dizier

, Mainil

. Genotypic characterization by polymerase chain reaction of Staphylococcus aureus isolates associated with bovine mastitis. Vet Microbiol, 2011; 153:285–292.

22.

, Han

, Ge

. Isolation and characterization of methicillin-resistant Staphylococcus aureus strains from Louisiana retail meats. Appl Environ Microbiol, 2009; 75:265–267.

23.

Ren

, Bannan

, Pancholi

, Cheung

, Robbins

, Fischetti

, Zabriskie

. Characterization and biological properties of a new staphylococcal exotoxin. J Exp Med, 1994; 180:1675–1683.

24.

Schantz

, Roessler

, Wagman

, Spero

, Dunnery

, Bergdoll

. Purification of staphylococcal enterotoxin B. Biochemistry, 1965; 4:1011–1016.

25.

Shuiep

, Kanbar

, Eissa

, Alber

, Lämmler

, Zschöck

, El Zubeir

, Weiss

. Phenotypic and genotypic characterization of Staphylococcus aureus isolated from raw camel milk samples. Res Vet Sci, 2009; 86: 211–215.

26.

Suzuki

, Omoe

, Hu

, Sato'o

, Ono

, Monma

, Arai

, Konishi

, Kato

, Hirai

, Nakama

, Kai

, Kamata

. Molecular epidemiological characterization of Staphylococcus aureus isolates originating from food poisoning outbreaks that occurred in Tokyo, Japan. Microbiol Immun, 2014; 58:570–580.

27.

Thomas

, Jarraud

, Lemercier

, Cozon

, Echasserieau

, Etienne

, Gougeon

, Lina

, Vandenesch

. Staphylococcal enterotoxin-like toxins U2 and V, two new staphylococcal super antigens arising from recombination within the enterotoxin gene cluster. Infect Immun, 2006; 74:4724–4734.

28.

Uhlemann

, Porcella

, Trivedi

, Sullivan

, Hafer

, Kennedy

, Barbian

, McCarthy

, Street

, Hirschberg

, Lipkin

, Lindsay

, DeLeo

, Lowy

. Identification of a highly transmissible animal-independent Staphylococcus aureus ST398 clone with distinct genomic and cell adhesion properties. mBio, 2012; 3:e00027-12.

29.

Umeda

, Nakamura

, Yamamoto

, Nishina

, Yasufuku

, Hirai

, Hirayama

, Goto

, Hase

, Ogasawara

. Molecular and epidemiological characterization of staphylococcal foodborne outbreak of Staphylococcus aureus harboring seg, sei, sem, sen, seo, and selu genes without production of classical enterotoxins. Int J Food Microbiol, 2017; 256:30–35.

30.

Umeda

, Ogasawara

, Hase

. Prevalence of staphylococcal enterotoxin and enterotoxin-like genes in Staphylococcus aureus isolates related to foodborne disease. Japan. J Food Microbiol, 2012; 29:114–118.

31.

Van Loo

, Diederen

, Savelkoul

, Woudenberg

, Roosendaal

, van Belkum

, Lemmens-den Toom

, Verhulst

, van Keulen

, Kluytmans

. Methicillin-resistant Staphylococcus aureus in meat products, the Netherlands. Emerg Infect Dis, 2007; 13:1753–1755.

32.

Varshney

, Mediavilla

, Robiou

, Guh

, Wang

, Gialanella

, Levi

, Kreiswirth

, Fries

. Diverse enterotoxin gene profiles among clonal complexes of Staphylococcus aureus isolates from the Bronx, New York. Appl Environ Microbiol, 2009; 75:6839–6849.

33.

Waters

, Contente-Cuomo

, Buchhagen

, Liu

, Watson

, Pearce

, Foster

, Bowers

, Driebe

, Engelthaler

, Keim

, Price

. Multidrug-resistant Staphylococcus aureus in US meat and poultry. Clin Infect Dis, 2011; 52:1227–1230.

34.

, Duan

, Gu

, Hao

, Ye

, Gong

, Wang

. A review of the methods for detection of Staphylococcus aureus enterotoxins. Toxins (Basel), 2016; 8:176.

35.

Yarwood

, McCormick

, Paustian

, Orwin

, Kapur

, Schlievert

. Characterization and expression analysis of Staphylococcus aureus pathogenicity island 3. Implications for the evolution of staphylococcal pathogenicity islands. J Biol Chem, 2002; 277:13138–13147.

36.

Zeleny

, Emteborg

, Charoud-Got

, Schimmel

, Nia

, Mutel

, Ostyn

, Herbin

, Hennekinne

. Development of a reference material for Staphylococcus aureus enterotoxin A in cheese: Feasibility study, processing, homogeneity and stability assessment. Food Chem, 2015; 168:241–246.

37.

Zhang

, Iandolo

, Stewart

. The enterotoxin D plasmid of Staphylococcus aureus encodes a second enterotoxin determinant (sej). FEMS Microbiol Lett, 1998; 168:227–233.