Establishment of a Multiplex Loop-Mediated Isothermal Amplification Method for Rapid Detection of Sulfonamide Resistance Genes ( sul1,sul2,sul3 ) in Clinical Enterobacteriaceae Isolates from Poultry

Abstract

Antimicrobial resistance genes play an important role in mediating resistance to sulfonamide in Gram-negative bacteria. While PCR is the current method to detect sulfonamide resistance genes (sul1, sul2, sul3), it is time-consuming and costly and there is an urgent need to develop a more convenient, simpler and rapid test for the sul. In this study, we describe a multiplex loop-mediated isothermal amplification (m-LAMP) assay we developed for the rapid and simultaneous detection of three sul. This m-LAMP assay successfully detected seven reference strains with different sul genotypes, but was negative for nine sul-negative reference strains. The m-LAMP products were verified by HinfI restriction enzyme digestion and the detection limit of the test was 0.5 pg genomic DNA per reaction. Testing 307 sulfonamide-resistant Enterobacteriaceae clinical isolates with the m-LAMP revealed all were positive for the sul with sul2 (79.5%) and sul1 (64.5%) being most prevalent, and sul3 the least (12.1%). Of the Enterobacteriaceae isolates tested, the Salmonella Indiana, a newly emerging serovar resistant to numerous antimicrobials, were most commonly positive with 33% having sul3.

Introduction

Sulfonamides are synthetic, broad-spectrum bacteriostatic antimicrobials, which have been widely used since 1935 (Sköld O, 2000; Huovinen, 2001). Combinations of sulfonamides and their potentiators such as trimethoprim have expanded the range of infections that can be treated with these drugs (Bushby and Hitchings, 1968; Huovinen, 2001). Despite the availability of other antibiotics, sulfonamides are still widely used, especially in clinical veterinary practice, animal husbandry, and aquaculture (Blahna et al., 2006; Hammerum et al., 2006; Grave et al., 2010).

With the long-term and extensive use of sulfonamides, resistance has developed in many bacteria (Kozak et al., 2009). This sulfonamide resistance (SR) in Gram-negative bacteria has been shown to be mediated mainly by mutations in the floP (dihydrofolate synthase) (Sköld, 2001; Perreten and Boerlin, 2003) with three drug-resistant variants of the gene described to date, sul1, sul2, and sul3. The sul1 and sul2 were reported first (Rådström and Swedberg, 1988; Sundström et al., 1988) and are most common in SR Gram-negative strains. The sul1 is usually located in the 3′-terminal conserved regions of the class I integron, and sul2 in the nonconjugative plasmid or mobile multidrug-resistant plasmid (Carattoli, 2001; Byrne-Bailey et al., 2009). The sul3 was identified in 2003 (Perreten and Boerlin, 2003) and is mainly distributed in various large plasmids. The discovery of the SR genes has enabled the more comprehensive investigation of the molecular mechanisms of SR.

PCR and multiplex PCR are commonly used for the detection of sul genes (Antunes et al., 2005; Hammerum et al., 2006; Phuong Hoa et al., 2008; Kozak et al., 2009) but these methods are generally time-consuming and costly, making them unsuitable for the rapid screening for multiple sul in large numbers of samples (Kokkinos et al., 2014). For this, there is an urgent need for a more simple and convenient test.

Loop-mediated isothermal amplification (LAMP) is a novel detection technology in which four specific primers can rapidly (1 h) recognize six regions of the target DNA under isothermal conditions (60°C–65°C) (Notomi et al., 2000; Nagamine et al., 2001, 2002). The LAMP amplification products can be determined visually by the turbidity of the reaction fluid or color changes that occur when products combine with fluorescence dyes (Boehme et al., 2007). The LAMP assay stands out as a highly sensitive and specific diagnostic test that is particularly useful in developing countries as it requires sophisticated equipment or skilled personnel and is cost effective (Notomi et al., 2000). Currently, LAMP technology is mainly used for detecting infectious organisms and there are only few reports of its use to detect drug-resistance genes (Li et al., 2017).

In this study, we describe the development of a multiplex LAMP (m-LAMP) for the rapid, specific, and sensitive simultaneous detection of the three sul and its use for the rapid screening of clinical isolates for sul.

Materials and Methods

Bacterial strains

Seven sul-positive reference strains and nine sul-negative reference stains were used as controls in this study (Table 1). A total of 307 SR Enterobacteriaceae isolates (113 Salmonella spp., 168 Escherichia coli, 20 Klebsiella pneumoniae, and 6 Proteus mirabilis) made from clinically ill poultry in previous studies were screened for sul with the m-LAMP we developed. The Salmonella spp. isolates were serotyped using standard agglutination tests with O and H antisera (S&A Reagent Laboratory LMT, Bangkok, Thailand).

Table 1.

Bacterial Strains Used in This Study

Strains	Species/serovars	Sul genotypes	Accession No.
D234	Salmonella Albany	sul1	KU603614 (sul1)
B354	Salmonella Indiana	sul2	KU603650 (sul2)
B142	Salmonella Indiana	sul3	KU603664 (sul3)
C1891	Salmonella Pullorum	sul1+sul2	KU603616 (sul1)
			KU603653 (sul2)
KP156	Klebsiella pneumonia	sul1+sul3	KU603636 (sul1)
			KU603670 (sul3)
C1451	Salmonella Pullorum	sul2+sul3	KU603654 (sul2)
			KU603667 (sul3)
B157	Salmonella Indiana	sul1+sul2+sul3	KU603627 (sul1)
			KU603652 (sul2)
			KU603666 (sul3)
ATCC25922	Escherichia coli	none
ATCC25923	Staphylococcus aureus	none
ATCC14028	Salmonella Typhimurium	none
ATCC13076	Salmonella Enteritis	none
ATCC19945	Salmonella Pullorum	none
CMCC51572	Shigella flexneri	none
CMCC51592	Shigella sonnei	none
CMCC51105	Shigella dysenteriae	none
CMCC51522	Shigella boydii	none

DNA extraction

The purified bacteria were inoculated into Luria-Bertani (LB) broth (Tianhe, Hangzhou, China) for overnight incubation at 37°C. Then, a rapid DNA isolation kit (Sangon, Shanghai, China) was used to extract bacterial DNA according to the manufacturer's instructions.

Design of the m-LAMP primers

The nucleotide sequences of the three sul were obtained from GenBank, and online software Primer Explorer version 4 (http://primerexplorer.jp/e) was used to design the LAMP primers, and the outer primers (F3 and B3) and inner primers (FIP and BIP) are shown in Table 2. The primers were designed so that amplification products contained a HinfI restriction site (Fig. 1), which enabled the differentiation of the three genes.

FIG. 1.

Locations of the m-LAMP primers and HinfI restriction sites in the sulfonamide resistance genes. Outer primers (F3 and B3) and the inner primers (FIP and BIP) were used in the m-LAMP. The dashed box shows the restriction site of HinfI. (A) sul1 (GenBank accession no. AF205943); (B) sul2 (GenBank accession no. AF542061); (C): sul3 (GenBank accession no. AY316203). Note: to enable the use of a single restriction enzyme to differentiate the sul we changed a base from C to T (red mark) in the B1 region of the sul2. m-LAMP, multiplex loop-mediated isothermal amplification. Color images available online at www.liebertpub.com/fpd

Table 2.

The Primers for the sul m-LAMP Used in This Study

Genes	Primers	Sequences (5′-3′)	Accession No.
sul1	1-F3: forward internal primer	ACCGCGGCGATCGAAAT	AF205943
	1-B3: backward inward primer	GCGCATAGCGCTGGGTT
	1-FIP: forward inner primer	ATACAGGCCTCGCGTCCGGATGAGTCGGATCAGACGTCGTG
	1-BIP: backward inner primer	ACGTATTGCGCCGCTCTTAGACAGCTGTCGATTGAAACACGG
sul2	2-F3: forward internal primer	ACCCGCTGGCGACATC	AF542061
	2-B3: backward inward primer	AGAAGCACCGGCAAATCG
	2-FIP: forward inner primer	TGATACCGGCACCCGTCAGCATGGATCACATTGCGGCGTT
	2-BIP: backward inner primer	CTTGATTCCGGCATGGGGTTTTGCCGCAATTCATCGAACCG
sul3	3-F3: forward internal primer	CGAATTGGTGCAGCTACT	AY316203
	3-B3: backward inward primer	GGGAAACGCTTCAAAACAAG
	3-FIP: forward inner primer	CTTTACACCAGCCTCAACTAAAGCAACGAATCCGGAAGAGGT
	3-BIP: backward inner primer	GTGAACGAATTATTCTTGATCCGGGAATAGATGTTTCTGGATTAGAGC

m-LAMP reaction

The LAMP reaction was carried out in a final volume of 25 μL reaction mixture containing 1 μL of primers [FIP and BIP (40 μM), F3 and B3 (5 μM), 2.5 μL buffer [200 mM Tris–HCl pH8.8, 100 mM KCl, 100 mM (NH₄)₂SO₄, 40 mM MgSO₄, 8 M Betaine, 1% Triton X-100], 1 μL Bst DNA polymerase (8 U), 3.5 μL dNTPs (10 mM), 2 μL DNA template, and 4 μL ddH₂O. The mixture was incubated for 50 min at 64°C in the Loopamp real-time turbidity system (LA-500, Beijing Lanpu Bio-tech, Beijing, China).

Specificity of the m-LAMP assay

The specificity of the m-LAMP assay was established by testing seven reference strains with known sul genotypes (sul1, sul2, sul3, sul1+sul2, sul1+sul3, sul2+sul3, and sul1+sul2+sul3) and nine sul-free reference strains. The m-LAMP products (5 μL) were incubated at 37°C for 1 h with 1 μL HinfI, 2 μL CutSmart buffer, and 12 μL ddH₂O, before being electrophoresed through 2% agarose gels and visualized under ultraviolet light.

Sensitivity of the m-LAMP assay

Serial 10-fold dilutions of the genomic DNA templates of the seven sul–positive reference strains were made (5 × 10⁴ pg to 5 × 10⁻² pg per reaction) to determine the detection limit for the m-LAMP.

Detection of sul genes in clinical isolates

The 307 SR clinical isolates were screened for sul with the m-LAMP assay and amplification products identified by color change when they combined with SYBR GREEN I (1 μL per reaction) that could be observed with the naked eye (green indicated positive, orange negative). Products were digested with HinfI to determine which of the three sul were present.

Statistical analysis

The prevalences of the different sul were compared with Chi-squared Test. A p value below 0.05 was considered to indicate significant difference.

Results

Specificity of the multiplex LAMP assay

The Primer-BLAST program showed the m-LAMP primers selected for the study had 100% identity with the sul1, sul2, and sul3. The m-LAMP method successfully amplified all the reference strains known to have sul but were negative for the sul-free reference strains. The presence of sul1, sul2, and sul3 in the samples was reliably demonstrated with HinfI restriction enzyme digestion of the LAMP amplification products (Fig. 2).

FIG. 2.

Specificity of the m-LAMP amplification products of different sulfonamide resistance genotypes digested by HinfI restriction enzyme. Lane M, DL-5000 DNA Marker. Lane 1–3, LAMP amplification products, the digested products and negative control.

Sensitivity of the multiplex LAMP assay

The m-LAMP assay was used to amplify 10-fold serial dilutions of S. Albany D234 (sul1), S. Indiana B354 (sul2), S. Indiana B142 (sul3), S. Pullorum C1891 (sul1+sul2), K. pneumoniae KP156 (sul1+sul3), S. Pullorum C1451 (sul2+sul3), and S. Indiana B157 (sul1+sul2+sul3) and the detection limit determined to be 0.5 pg genomic DNA per reaction (Fig. 3).

FIG. 3.

Sensitivity of the m-LAMP in detecting sulfonamide resistance genes. Lane M, DL-5000 DNA Marker. Lane 1–7, 5 × 10⁴, 5 × 10³, 5 × 10², 5 × 10¹, 5 × 10⁰, 5 × 10⁻¹, 5 × 10⁻² pg per reaction, Lane 8, negative control.

Prevalence of SR genes in clinical isolates

The m-LAMP showed all the clinical SR isolates contained at least one of the sul. The prevalence of the sul3 (37/307, 12.1%) was significantly lower than that of sul1 (198/307, 64.5%), and sul2 (244/307, 79.5%) (p < 0.01) (Table 3). Half the isolates (155/307; 50%) carried a single sul, while 132 (43%) carried two of the sul, and 20 strains (7%) carried all three sul. The most common resistance patterns were the combination of sul1and sul2 (n = 125, 40.7%) followed by the presence of only sul2 (n = 97, 31.6%) (p < 0.01) (Table 4). Of the SR Enterobacteriaceae isolates, the Salmonella spp. had six resistance genotypes (patterns?) none of which contained sul3, the E. coli strains had five and the Klebsiella spp. and Proteus spp. three (Table 4).

Table 3.

Prevalence of the sul Genes Detected in Clinical Enterobacteriaceae Isolates

		No. (%) of isolates with indicated sul gene(s)
Bacterial species	No. of isolates	sul1	sul2	sul3 ^a
Salmonella spp.	113	62 (54.9)	96 (85.0)	17 (15.0)
Escherichia coli	168	112 (66.7)	137 (81.5)	17 (10.1)
Klebsiella pneumonia	20	20 (100)	7 (35)	3 (15)
Proteus mirabilis	6	4 (66.7)	4 (66.7)	0(0)
Total	307	198 (64.5)	244 (79.5)	37 (12.1)

The positivity in sul3 (37/307, 12.1%) was significantly lower than that of sul1 (198/307, 64.5%), and sul2 (244/307, 79.5%) (p < 0.01).

Table 4.

Genotyping of the sul Genes in Clinical Enterobacteriaceae Isolates

		No. of isolates with sul genotype(s)
Bacterial species (serovars)	No. of isolates	sul1	sul2 ^a	sul3	sul1+sul2 ^a	sul1+sul3	sul2+sul3	sul1+sul2+sul3
Salmonella spp.	113	15	49		32	2	2	13
S. Indiana	45		2		28	2		13
S. Pullorum	34	10	21		3
S. Enteritidis	20	5	15
S. Typhimurium	7		5				2
S. Agona	4		3		1
S. Heidelberg	2		2
S. Saintpaul	1		1
Escherichia coli	168	21	46	10	84			7
Klebsiella pneumonia	20	10			7	3
Proteus mirabilis	6	2	2		2
Total	307	48	97	10	125	5	2	20

The dual positive for sul1and sul2 (n = 125, 40.7%) and positive for sul2 (n = 97, 31.6%) were more prevalent than other sul genotypes.

There were differences in the prevalence of the different sul among the 113 Salmonella serovars: 95.6% (43/45) of Salmonella Indiana isolates carried two or three sul (Table 4) while, in strong contrast, 91.2% (62/68) of the other Salmonella serovars carried only a single sul (Table 4). In addition, the Salmonella Indiana isolates showed more diverse sul genotypes than the other Salmonella serovars (Table 4).

Discussion

There are now many studies showing widespread resistance to sulfonamides among bacteria due to the long-term and often injudicious use of these antimicrobials. The resistance in the Gram-negative bacteria is mainly mediated by sul (sul1, sul2, sul3) (Sköld, 2001; Perreten and Boerlin, 2003; Kozak et al., 2009; Gong et al., 2013) and simple, rapid, and cost-effective tests to these genes is important to guide antimicrobial therapy and to monitor and investigate mechanisms of resistance.

In this study, we successfully established a m-LAMP detection method for the rapid detection of the three sul. The specificity of the m-LAMP method with 16 control reference strains was 100% with the HinfI digestion of the m-LAMP products enabling the rapid identification of the resistance genotype. The sensitivity of the m-LAMP method was 0.5 pg from genomic DNA per reaction system, which is similar to that of other LAMP assays, including 2.6 pg for Bordetella pertussis, 1 pg for cfr gene, 0.26 pg for Staphylococcus aureus, and 0.23 pg for K. pneumoniae and Enterobacter sakazakii (Liu et al., 2012, 2015; Qi et al., 2012; Dong et al., 2015; Sheet et al., 2016). It is of note the detection limit of LAMP assays are usually 10-fold higher than those of PCRs (Liu et al., 2012, 2015; Qi et al., 2012; Dong et al., 2015).

When we used the m-LAMP we developed to screen for sul in 307 SR Enterobacteriaceae isolates, we found all to be positive (especially for sul1 and sul2). This is consistent with the sul being responsible for SR in SR Gram-negative bacteria and is in agreement with other studies (Gomes-Neves et al., 2014; Lopes et al., 2015; Yahiaoui et al., 2015; García-Fierro et al., 2016). We detected the sul 2 most commonly and the sul3 least commonly, which is similar to some previous studies (Aslam et al., 2009; Mąka et al., 2015; Yahiaoui et al., 2015; Manyahi et al., 2017) but not others (Gomes-Neves et al., 2014; Lopes et al., 2015; García-Fierro et al., 2016; Ben Salem et al., 2017; El-Sharkawy et al., 2017). The reason for the differences is unclear but might be due to regional differences or the different species examined the studies.

Although our study and reports from other groups have generally shown a low prevalence of sul3 in Enterobacteriaceae isolates, we found that Salmonella Indiana isolates had a significantly higher sul3 prevalence than the other species we studied. Salmonella Indiana is a newly emerging Salmonella serovar with high levels of Antimicrobial resistance in China (Gong et al., 2017). The finding that the majority of our Salmonella Indiana isolates had multiple sul genotypes suggests that Salmonella Indiana may enhance its drug-resistance by acquiring various resistance-related mobile components (Gong et al., 2016).

Overall, genotyping of the SR Enterobacteriaceae isolates showed that most carried one or two of the sul (n = 287, 93.5%), mainly sul2 or sul1-sul2, which were the most prevalent genotypes. Similar results have been reported previously which appears to indicate that sul1-sul2 or sul2 may be the major sul genotypes in SR Enterobacteriaceae bacteria (Zhang et al., 2012; Yahiaoui et al., 2015; Manyahi et al., 2017).

Conclusions

The m-LAMP we developed proved to be a rapid, simple, specific, and sensitive test for the three known SR genes. The test can be used for the detection and genotyping of sul in clinical specimens, which will enable the more judicious use of antimicrobials in patients. Further, the m-LAMP could serve as an important tool in studies of the mechanisms and evolution of SR in bacteria.

Footnotes

Acknowledgments

This project was supported by grants from the National Natural Foundation of China (31772758 and 31402200), and the Scientific and Technological Project of Yangzhou (YZ2016039, YZ2017062, and YZ2017171).

Disclosure Statement

No competing financial interests exist.

References

Antunes

, Machado

, Sousa

, Peixe

. Dissemination of sulfonamide resistance genes (sul1, sul2, and sul3) in Portuguese Salmonella enterica strains and relation with integrons. Antimicrob Agents Chemother, 2005; 49:836–839.

Aslam

, Diarra

, Service

, Rempel

. Antimicrobial resistance genes in Escherichia coli isolates recovered from a commercial beef processing plant. J Food Prot, 2009; 72:1089–1093.

Ben Salem

, Abbassi

, García

, García-Fierro

, Fernández

, Kilani

, Jaouani

, Khayeche

, Messadi

, Rodicio

. Antimicrobial drug resistance and genetic properties of Salmonella enterica serotype Enteritidis circulating in chicken farms in Tunisia. J Infect Public Health, 2017; 10:855–860.

Blahna

, Zalewski

, Reuer

, Kahlmeter

, Foxman

, Marrs

. The role of horizontal gene transfer in the spread of trimethoprim-sulfamethoxazole resistance among uropathogenic Escherichia coli in Europe and Canada. J Antimicrob Chemother, 2006; 57:666–672.

Boehme

, Nabeta

, Henostroza

, Raqib

, Rahim

, Gerhardt

, Sanga

, Hoelscher

, Notomi

, Hase

, Perkins

. Operational feasibility of using loop-mediated isothermal amplification for diagnosis of pulmonary tuberculosis in microscopy centers of developing countries. J Clin Microbiol, 2007; 45:1936–1940.

Bushby

, Hitchings

. Trimethoprim, a sulphonamide potentiator. Br J Pharmacol Chemother, 1968; 33:72–90.

Byrne-Bailey

, Gaze

, Kay

, Boxall

, Hawkey

, Wellington

. Prevalence of sulfonamide resistance genes in bacterial isolates from manured agricultural soils and pig slurry in the United Kingdom. Antimicrob Agents Chemother, 2009; 53:696–702.

Carattoli

. Importance of integrons in the diffusion of resistance. Vet Res, 2001; 32:243–259.

Dong

, Liu

, Li

, Wang

, Li

, Zou

, Yang

, Huang

, Zhou

, Huang

, Yuan

. Survey and rapid detection of Klebsiella pneumoniae in clinical samples targeting the rcsA gene in Beijing, China. Front Microbiol, 2015; 6:519.

10.

El-Sharkawy

, Tahoun

, El-Gohary

AEA

, El-Abasy

, El-Khayat

, Gillespie

, Kitade

, Hafez

, Neubauer

, El-Adawy

. Epidemiological, molecular characterization and antibiotic resistance of Salmonella enterica serovars isolated from chicken farms in Egypt. Gut Pathog, 2017; 9:8.

11.

García-Fierro

, Montero

, Bances

, González-Hevia

MÁ

, Rodicio

. Antimicrobial drug resistance and molecular typing of Salmonella enterica serovar Rissen from different sources. Microb Drug Resist, 2016; 22:211–217.

12.

Gomes-Neves

, Antunes

, Manageiro

, Gärtner

, Caniça

, da Costa

, Peixe

. Clinically relevant multidrug resistant Salmonella enterica in swine and meat handlers at the abattoir. Vet Microbiol, 2014; 168:229–233.

13.

Gong

, Kelly

, Wang

. Prevalence and antimicrobial resistance of Salmonella enterica serovar Indiana in China (1984–2016). Zoonoses Public Health, 2017; 64:239–251.

14.

Gong

, Wang

, Shi

, Bao

, Zhu

, Kelly

, Zhuang

, Lu

, Dou

, Wang

, Xu

, Zou

. Highly drug-resistant Salmonella enterica serovar Indiana clinical isolates recovered from broilers and poultry workers with diarrhea in China. Antimicrob Agents Chemother, 2016; 60:1943–1947.

15.

Gong

, Xu

, Zhu

, Miao

, Liu

, Xu

, Zhang

, Yu

, Jia

. Antimicrobial resistance, presence of integrons and biofilm formation of Salmonella Pullorum isolates from Eastern China (1962–2010). Avian Pathol, 2013; 42:290–294.

16.

Grave

, Torren-Edo

, Mackay

. Comparison of the sales of veterinary antibacterial agents between 10 European countries. Antimicrob Agents Chemother, 2010; 65:2037–2040.

17.

Hammerum

, Sandvang

, Andersen

, Seyfarth

, Porsbo

, Frimodt-Møller

, Heuer

. Detection of sul1, sul2 and sul3 in sulphonamide resistant Escherichia coli isolates obtained from healthy humans, pork and pigs in Denmark. Int J Food Microbiol, 2006; 106:235–237.

18.

Huovinen

. Resistance to trimethoprim-sulfamethoxazole. Clin Infect Dis, 2001; 32:1608–1614.

19.

Kokkinos

, Ziros

, Bellou

, Vantarakis

. Loop-mediated isothermal amplification (LAMP) for the detection of Salmonella in food. Food Anal Methods, 2014; 7:512–526.

20.

Kozak

, Pearl

, Parkman

, Reid-Smith

, Deckert

, Boerlin

. Distribution of sulfonamide resistance genes in Escherichia coli and Salmonella isolates from swine and chickens at abattoirs in Ontario and Québec, Canada. Appl Environ Microbiol, 2009; 75:5999–6001.

21.

, Fan

, Zhou

, Zhang

. Loop-mediated isothermal amplification (LAMP): A novel rapid detection platform for pathogens. Microb Pathog, 2017; 107:54–61.

22.

Liu

, Xu

, Dong

, Li

, Zhao

, Li

, Zhang

, Wei

, Wang

, Huang

, Zeng

, Huang

, Zhang

, Yuan

. Survey and rapid detection of Bordetella pertussis in clinical samples targeting the BP485 in China. Front Public Health, 2015; 3:39.

23.

Liu

, Fang

, Zhang

, Wang

, Gong

, Xi

, Li

. Development of a loop-mediated isothermal amplification assay for detection of Cronobacter spp. (Enterobacter sakazakii). World J Microbiol Biotechnol, 2012; 28:1013–1020.

24.

Lopes

, Pissetti

, da Cruz Payão Pellegrini

, da Silva

, Cardoso

. Resistance phenotypes and genotypes of Salmonella enterica subsp. enterica isolates from feed, pigs, and carcasses in Brazil. J Food Prot, 2015; 78:407–413.

25.

Mąka

, Maćkiw

, Ścieżyńska

, Modzelewska

, Popowska

. Resistance to sulfonamides and dissemination of sul genes among Salmonella spp. isolated from food in Poland. Foodborne Pathog Dis, 2015; 12:383–389.

26.

Manyahi

, Tellevik

, Ndugulile

, Moyo

, Langeland

, Blomberg

. Molecular characterization of cotrimoxazole resistance genes and their associated integrons in clinical isolates of Gram-negative bacteria from Tanzania. Microb Drug Resist, 2017; 23:37–43.

27.

Nagamine

, Hase

, Notomi

. Accelerated reaction by loop-mediated isothermal amplification using loop primers. Mol Cell Probes, 2002; 16:223–229.

28.

Nagamine

, Watanabe

, Ohtsuka

, Hase

, Notomi

. Loop-mediated isothermal amplification reaction using a nondenatured template. Clin Chem, 2001; 47:1742–1743.

29.

Notomi

, Okayama

, Masubuchi

, Yonekawa

, Watanabe

, Amino

, Hase

. Loop-mediated isothermal amplification of DNA. Nucleic Acids Res, 2000; 28:e63.

30.

Perreten

, Boerlin

. A new sulfonamide resistance gene (sul3) in Escherichia coli is widespread in the pig population of Switzerland. Antimicrob Agents Chemother, 2003; 47:1169–1172.

31.

Phuong Hoa

, Nonaka

, Hung Viet

, Suzuki

. Detection of the sul1, sul2, and sul3 genes in sulfonamide-resistant bacteria from wastewater and shrimp ponds of north Vietnam. Sci Total Environ, 2008; 405:377–384.

32.

, Du

, Zhu

, Bai

, Hu

, Luo

, Hu

, Wu

, Shen

, Liu

. A loop-mediated isothermal amplification method for rapid detection of the multidrug-resistance gene cfr . Gene, 2012; 504:140–143.

33.

Rådström

, Swedberg

. RSF1010 and a conjugative plasmid contain sulII, one of two known genes for plasmid-borne sulfonamide resistance dihydropteroate synthase. Antimicrob Agents Chemother, 1988; 32:1684–1692.

34.

Sheet

, Grabowski

, Klein

, Abdulmawjood

. Development and validation of a loop mediated isothermal amplification (LAMP) assay for the detection of Staphylococcus aureus in bovine mastitis milk samples. Mol Cell Probes, 2016; 30:320–325.

35.

Sköld

. Resistance to trimethoprim and sulfonamides. Vet Res, 2001; 32:261–273.

36.

Sköld

. Sulfonamide resistance: Mechanisms and trends. Drug Resist Updat, 2000; 3:155–160.

37.

Sundström

, Rådström

, Swedberg

, Sköld

. Site-specific recombination promotes linkage between trimethoprim- and sulfonamide resistance genes. Sequence characterization of dhfrV and sulI and a recombination active locus of Tn21 . Mol Gen Genet, 1988; 213:191–201.

38.

Yahiaoui

, Robin

, Bakour

, Hamidi

, Bonnet

, Messai

. Antibiotic resistance, virulence, and genetic background of community-acquired Uropathogenic Escherichia coli from Algeria. Microb Drug Resist, 2015; 21:516–526.

39.

Zhang

, Wang

, Zhong

. Survey on sulfonamide antibiotic-resistant genotype and phenotype of avian Escherichia coli in North China. Poult Sci, 2012; 91:884–887.