Characterization of Ciprofloxacin Resistance in Laboratory-Derived Mutants of Vibrio parahaemolyticus with qnr Gene

Abstract

Ciprofloxacin, a broad-spectrum fluoroquinolone, is a bactericidal antibiotic targeting DNA gyrase and DNA topoisomerase IV encoded by the gyrA and parC genes. Resistance to fluoroquinolones requires the accumulation of multiple mutations including those that alter target genes and increase drug efflux. To examine the development of fluoroquinolones resistance in Vibrio parahaemolyticus, ciprofloxacin induction and selection was used to obtain several resistant V. parahaemolyticus mutants, which showed decreased susceptibilities to quinolones, and increased or decreased susceptibility to other structurally unrelated antibiotics. Quinolone resistance-determining region mutations were characterized, and it was found that gyrA mutations occurred in some of the high-level resistant mutants although qnr was present in both wild-type susceptible and resistant mutant strains. The mutants showed increased qnr expression and exposure to sub-inhibitory concentrations of ciprofloxacin caused a further increase in qnr expression independently of the SOS system. Two mutants demonstrated increased expression of the VmeCD-VpoC pump gene that promotes quinolone efflux. In addition, some of the high-level resistance mutants significantly decreased bacterial fitness. These data suggested that multiple genes contributed to the enhanced ciprofloxacin resistance appeared in V. parahaemolyticus and that acquisition of ciprofloxacin resistance impaired bacterial fitness.

Introduction

V ibrio parahaemolyticus is a Gram-negative pathogen and a major causative agent of gastroenteritis particularly in areas with high seafood consumption. Infections caused by this pathogen have recently become pandemic due to the appearance of serotype O3:K6 (Martinez-Urtaza et al., 2005; Nair et al., 2007). Antimicrobials such as third-generation cephalosporins and fluoroquinolones are commonly used in the treatment and control of V. parahaemolyticus infections. Although the worldwide prevalence of fluoroquinolone-resistant V. parahaemolyticus remains low compared with β-lactam resistance, the dissemination of resistant clones has nonetheless increased in some countries (Han et al., 2007; Liu et al., 2013; Jiang et al., 2014). However, little is known concerning resistance of this bacterium to fluoroquinolones.

Fluoroquinolones are part of a class of synthetic broad-spectrum antibiotics that inhibit DNA gyrase (GyrA and GyrB subunits) and topoisomerase IV (ParC and ParE subunits) to hinder bacterial DNA synthesis (Hooper, 1999; Kim et al., 2016). In Vibro spp., high-level fluoroquinolone resistance is primarily the result of gyrA and parC mutations in the quinolone resistance-determining regions (QRDRs) (Kitiyodom et al., 2010).

The Qnr protein belongs to the pentapeptide repeat family and protects DNA gyrase and topoisomerase IV from fluoroquinolone inactivation, but its natural functions are not known (Kwak et al., 2013). Chromosomal qnr genes are found most commonly among aquatic Gram-negative bacteria including Vibrio spp. that are potential sources of qnr-like quinolone resistance determinants (Jacoby and Hooper, 2013). The V. parahaemolyticus chromosomal qnr homolog VPA0095 and the qnrVP genes conferred reduced susceptibility to fluoroquinolones when expressed in Escherichia coli (Poirel et al., 2005; Saga et al., 2005).

There is increasing evidence that Resistance-Nodulation-Division (RND)-type efflux transporters play a primary role in drug resistance to various antimicrobial agents in many Gram-negative bacteria. They have very large periplasmic domains and form tripartite complexes with membrane fusion proteins and outer membrane proteins (Nikaido and Piddock, 2009). V. parahaemolyticus possesses 12 RND pumps and when expressed in E. coli, two-thirds of them showed increased minimum inhibitory concentrations (MICs) for several antimicrobial agents including fluoroquinolones (Matsuo et al., 2007, 2013). Deletion of vmeAB and vmeCD produced significant increases in drug susceptibility. The VmeCD and VmeAB proteins are important in antimicrobial resistance formation in V. parahaemolyticus and they form functional complexes with the outer membrane protein VpoC (Matsuo et al., 2013).

The aim of this study was to investigate molecular resistance mechanisms involved in increased MICs to ciprofloxacin in laboratory-derived V. parahaemolyticus mutants. We performed a functional analysis of QRDR mutations and identified a chromosomal qnr gene. Expression of the RND-type efflux pump genes were involved in decreasing the intracellular concentration of ciprofloxacin.

Materials and Methods

Bacterial strains and selection of ciprofloxacin resistance mutants

V. parahaemolyticus strain F7 isolated from shrimp was used as the parental strain for in vitro selection of mutants in this study. It was sensitive to most antibiotics and was especially susceptible to ciprofloxacin with an MIC of 0.016 μg/mL (Table 2). Bacteria were cultured at 37°C in Luria-Bertani (LB) broth (Difco Laboratories, Detroit, MI) or Mueller-Hinton (MH) broth (Hope Biotechnology, Qingdao, China). Bacterial strains were stored at −80°C in LB broth with 20% glycerol.

Ciprofloxacin was used to select resistant mutants through a stepwise selection process in vitro. Briefly, strain F7 was cultured at 37°C in MH broth containing ciprofloxacin at concentrations of 0.5 × , 1 × , 2 × , 4 × , 8 × , 16 × , 32 × , 64 × , and 128 × MIC. During ciprofloxacin selection, multiple passages were needed to allow adaptation of the selected mutants. The mutants named H0.5, H2, H8, H16, H32, and H128 were sequentially obtained after incubation at 37°C for 24–72 h exposed to ciprofloxacin at 0.5 × MIC (0.008 μg/mL), 2 × MIC (0.032 μg/mL), 8 × MIC (0.128 μg/mL), 16 × MIC (0.256 μg/mL), 32 × MIC (0.512 μg/mL), and 128 × MIC (2.048 μg/mL).

MIC determinations

MIC values were determined by the microdilution broth method according to the guidelines of the Clinical and Laboratory Standards Institute (CLSI, 2016) including quality control measurements. The tests were conducted with the following antibiotics: tetracycline (TET), nalidixic acid (NAL), ciprofloxacin (CIP), kanamycin (KAN), chloramphenicol (CHL), ampicillin (AMP), amoxicillin (AML), cefazolin (CZO), furazolidone (FUR), and trimethoprim/sulfamethoxazole (SXT). E. coli ATCC25922 was used as a quality control strain for MIC determinations. The results were recorded after 24 h of incubation at 37°C and were interpreted according to CLSI guidelines. This experiment was conducted in triplicate.

Growth rate of susceptible and resistant strains

To compare the growth of the parental strain F7 with selected resistant mutants, a fresh culture of each strain was inoculated separately into LB broth at an initial cell density of 10⁶ CFU/mL. The cultures were incubated in 96-well plates without shaking at 37°C for 48 h. OD600 values of the cultures were measured every 2 h using a Bioscreen C analyzer (Oy Growth Curves Ab, Helsinki, Finland). Three independent experiments were conducted using the same strains and conditions.

Detection of mutations within the QRDR and the qnr gene

Genomic DNA was extracted from V. parahaemolyticus using a MiniBEST Bacteria Genomic DNA Extraction Kit Ver.3.0 (Takara, Beijing, China), according to the manufacturer's instructions. Genomic DNA (200 ng) was used as template in polymerase chain reactions (PCRs) with specific primers for the V. parahaemolyticus gyrA, parC, and qnr genes (Table 1). Each reaction involved an initial denaturation at 95°C for 5 min, followed by 25–30 amplification cycles each consisting of an initial denaturation at 95°C for 10 s and 53–58°C for 10–15 s followed by a extend step of 30–50 s at 72°C. Amplicons were purified using a QIAquick PCR Purification Kit (Qiagen, Hilden, Germany) and sent to the Beijing Genomics Institute (Beijing, China) for DNA sequencing. Mutations were detected using BioEdit software (Ibis Biosciences, Carlsbad, CA) by comparison with the genome of V. parahaemolyticus RIMD 2210633 as the reference strain (Ref Seq nos. NC_004603.1 and NC_004605.1).

Table 1.

Primers for Polymerase Chain Reaction and Real-Time Reverse Transcription Polymerase Chain Reaction

Gene	Primer sequence	Annealing temperature	Amplicon length (bp)	Reference
gyrA
F	CGATTGGAACAAACCATATAAA	55°C	200	Jiang et al. (2014)
R	CGGTGTAACGCATTGCCGCA
parC
F	CTTGGTCTTTCGGCATCAGC	57°C	214	Jiang et al. (2014)
R	CTTCGGTATAACGCATTGCC
qnr
F	TCTCGCTAAGGCTCGTAGC	57°C	902	Poirel et al. (2005)
R	TTCCTCGTCGAGGTTATTCG
qnr
RT-F	AAAGCGCTAGAAGGGTGTAGT	53°C	327	This study
RT-R	ATCCGAGCCTTTGAGAGTTGC
vmeB
RT-F	CCGTGCTATGGGTTACTTCTC	59°C	124	This study
RT-R	AAGGCTCAGGGAGTCTTGTAG
vmeD
RT-F	TTCGTGAATACCCTGAAATG	57°C	104	This study
RT-R	CTCCAAAGGCTGAGTAATAA
vpoC
RT-F	TAGCAAAGCAAAATGATCCACA	57°C	86	This study
RT-R	AGCACTACGGCTAGAGGTGA
16SrDNA
RT-F	ACGTTAGCGACAGAAGAAGC	60°C	211	This study
RT-R	ACCGCTACACCTGAAATTCT

Real-time reverse transcription PCR

Strains were grown in LB broth at 37°C with shaking to exponential phase (OD600 = 0.6), and ciprofloxacin at 1/2 × and 1/4 × MIC was added for 30 min when expression of the qnr was analyzed. Total RNA was isolated with the RNeasy minikit (Qiagen) according to the manufacturer's instructions. Genomic DNA was eliminated by incubation with TURBO DNase (Thermo Fisher Scientific, Waltham, MA) treatment, and RNA quantification and quality assessment were carried out using a NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific). RNAs were adjusted to a concentration of 500 ng/mL and frozen at −80°C until required.

Expression of the qnr, vmeB, vmeD, and vpoC were analyzed by real-time reverse transcription PCR (RT-PCR). First-strand cDNA was synthesized with the PrimeScript RT Master Mix (Takara). Quantitative real-time PCR was performed using the SsoFast EvaGreen SuperMix (Biorad, Hercules, CA) with the CFX96 Real-Time instrument (Biorad). Primers specific for qnr, vmeB, vmeD, and vpoC were designed using Primer Express Software version 2.0 (Applied Biosystems, Foster City, CA) (Table 1). The 16SrDNA gene was used as an internal control for normalization. The PCR mixture was denatured at 95°C for 30 s, followed by 40 cycles of 95°C for 5 s, 55°C for 20 s, and 72°C for 15 s. The 2^−ΔΔCt method was used for relative gene expression calculations. To assure specific amplification, melting curves of each reaction were assessed and each RNA sample was tested in triplicate.

Statistical analysis

The Student's t-test was used to compare results within experiments. p-Values <0.05 were considered significant.

Results

Antibiotic susceptibility of V. parahaemolyticus variants

V. parahaemolyticus strain F7 was grown in the presence of ciprofloxacin (0.008–2.048 μg/mL) and successive ciprofloxacin-resistant derivatives were obtained. Two ciprofloxacin-resistant mutants possessing 32 × MIC (H32) and 128 × MIC (H128) were generated from wild-type strain F7. Interestingly, these mutants possessed reduced susceptibilities to quinolones nalidixic acid, ciprofloxacin, and norfloxacin, and altered susceptibilities to several structurally unrelated antibiotics (Table 2). The MIC breakpoints for susceptibility and resistance to ciprofloxacin were ≤1 and ≥4 μg/mL, respectively (CLSI, 2016). It seemed that the resistance levels of these two mutants were not directly associated with a systematic increase in ciprofloxacin concentration. Mutant H32 showed a 250-fold increase in its MIC to ciprofloxacin and norfloxacin compared with the parental strain, while MICs of these antibiotics increased 1000-fold for H128. A paradoxical response was obtained for the β-lactams ampicillin and cefazolin and for tetracycline, chloramphenicol, and furazolidone. Mutant H32 showed MIC increases for these antibiotics while they decreased for mutant H128. In addition, a small, systematic decrease for kanamycin resistance was observed (Table 2).

Table 2.

Minimum Inhibitory Concentration Values of Each Antibiotic

Classification	Antibiotic	F7 (μg/mL)	H32 (μg/mL)	H128 (μg/mL)
Quinolones	Nalidixic acid	0.5 (S)	8 (S)	32 (R)
	Norfloxacin	0.016 (S)	4 (R)	16 (R)
	Ciprofloxacin	0.016 (S)	4 (R)	16 (R)
Tetracyclines	Tetracycline	0.25 (S)	32 (R)	16 (R)
Aminoglycosides	Kanamycin	8 (S)	2 (S)	4 (S)
Chloramphenicols	Chloramphenicol	32 (R)	256 (R)	128 (R)
β-Lactams	Ampicillin	32 (R)	1024 (R)	512 (R)
	Amoxicillin	16 (I)	>256 (R)	>256 (R)
	Cefazolin	4 (S)	64 (R)	32 (R)
Nitrofuran	Furazolidone	4 (S)	64 (I)	4 (S)
Sulfonamides	Trimethoprim/sulfamethoxazole	2048 (R)	2048 (R)	2048 (R)

The breakpoints for S, I, and R were interpreted according to CLSI (2016) guidelines.

I, intermediate; R, resistant; S, susceptible.

Gene mutation assays

Quinolone resistance is mainly due to mutations located in the QRDRs in DNA gyrase (GyrA) and topoisomerase IV (ParC) (Liu et al., 2013). In our study, the QRDRs of mutants and parental strain were analyzed. The stable and high-level resistance mutants H32 and H128 contained a T249A transversion in gyrA resulting in a Ser83Ile mutation. No mutations in gyrA were found for strains F7, H2, H8, and H16. However, neither the mutants nor the parental strain possessed parC mutations.

Characterization of qnr gene

DNA fragments corresponding to the qnr homolog from strains F7, H32, and H128 were amplified by PCR and sequenced. The qnr sequence from H32 and H128 were the same as F7, and the putative proteins shared 98% identity with QnrVP (Poirel et al., 2005). There were four amino acid changes in strains F7, H32, and H128 that differed from the QnrVP reference sequence: Asp34Glu, Ser150Ala, Ser153Thr, and Ile189Val.

The qnr expression was measured and it was found that the baseline expression levels in mutant H128 cultured under the absence of ciprofloxacin was similar to the parental F7 (1.70-fold greater). To test whether qnr was induced by fluoroquinolones, strains F7, H32, and H128 were exposed to ciprofloxacin at 1/4 × and 1/2 × MIC levels for 30 min. Interestingly, expression of qnr in these strains was dose-dependent. The highest level of expression was observed at 1/2 × MIC in H128 and was 6.48-fold (p < 0.01) greater than that of F7 under the absence of ciprofloxacin. H32 showed a more modest increase (2.54-fold, p < 0.01) at 1/2 × MIC (Fig. 1).

FIG. 1.

Relative expression of qnr under induced and noninduced conditions. Vibrio parahaemolyticus was grown at 37°C until the exponential phase (OD600 ∼ 0.6), then supplemented with ciprofloxacin (1/4 × and 1/2 × MIC) at 37°C for 30 min. Data are expressed a ratio of the F7 value under noninduced conditions. Mean fold-change values of triplicate independent experiments and standard deviation are shown. *p < 0.05; **p < 0.01. MIC, minimum inhibitory concentration.

Expression of genes encoding RND pumps

Expression levels of the RND family members vmeB, vmeD, and vpoC were examined to identify whether these genes contributed to resistance formation in our strains. The vmeD gene was found to be consistently overexpressed in mutant H128 (9.71-fold, p < 0.01) but showed only a slight increase in mutant H32 (<2-fold). H128 expressed vpoC 3.43-fold (p < 0.01) greater than strain F7. In contrast, the vmeB gene always showed decreased expression and the decrease was greater for the mutant H32 (Fig. 2).

FIG. 2.

Relative expression of vmeB, vmeD, and vpoC. Data are expressed as in Figure 1. **p < 0.01.

Biological cost of the selected resistant strains

It was found that there were differences in growth rate between the parental strain F7 and mutants H0.5, H4, H8, H16, H32, and H128 when cultured separately in antibiotic-free LB broth. Parental strain F7 and mutant H0.5 reached stationary phase after 4–6 h incubation with a final OD600 yield of ∼1.0. Mutants H32 and H128 grew considerably slower in the primary phase of growth than F7 and H0.5, indicating fitness defect. However, after 10 h culture, the OD600 levels of H32 and H128 were greater than all other strains, especially at 20 h (p < 0.01) (Fig. 3).

FIG. 3.

Growth kinetics of Vibrio parahaemolyticus strains. OD600 values of the cultures were measured every 2 h. Three independent experiments were conducted and the mean value and standard derivation are shown. L0: LB broth. LB, Luria-Bertani.

Discussion

Ciprofloxacin is currently used as an oral antibiotic for the treatment of infections. Prior studies have used this antibiotic to induce and select resistant Salmonella enterica serovar Typhimurium mutants, in which the MICs for ciprofloxacin, ampicillin, tetracycline, and chloramphenicol were significantly increased (Ricci and Piddock, 2009; Kim et al., 2016). In our investigation, we found that ciprofloxacin could also be a selection agent of multidrug-resistant (MDR) mutants of V. parahaemolyticus. The MDR phenotype of these mutants suggested existence of nonspecific antibiotic resistance mechanisms, such as decreased antibiotic influx or activation of efflux pumps. In addition, MICs of ampicillin, cefazolin, tetracycline, chloramphenicol, and furazolidone were found increased in H32 and decreased in H128. Similar results was reported by another study (Biot et al., 2013), in which doxycycline selection was used to obtain several resistant Burkholderia thailandensis variants, and a paradoxical response was observed for five aminoglycosides, with an increase in MICs for the first two selection levels and then decrease for the last two levels of selection. This suggested that ciprofloxacin resistance could arise by many mechanisms, some of which increase or decrease susceptibility to chemically unrelated antibiotics (Vinué et al., 2015).

Fluoroquinolone antibiotics interfere with DNA gyrase and DNA topoisomerase leading to an inhibition of DNA replication and to cell death (Okuda et al., 1999). Previous studies with Vibrio cholerae and other Vibrio spp. indicated that the basis of resistance to fluoroquinolones was generally a Ser83Ile mutation in GyrA (Roig et al., 2009; Zhou et al., 2013). However, gyrA mutations were rare when mutants with decreased ciprofloxacin susceptibility were selected from isolates carrying the qnr gene (Cesaro et al., 2008; Goto et al., 2015). In this study, we obtained gyrA mutations in V. parahaemolyticus isolates possessing qnr and found that the Ser83lle substitution in GyrA occurred in both H32 and H128. Gyrase mutations provide higher-level resistance than efflux pump or porin changes (Weigel et al., 2001).

In Vibrio spp., single GyrA Ser83Ile substitutions were identified in the intermediate and resistant Vibrio anguillarum strains while an additional ParC Ser85Leu substitution was found in the strains with higher levels of fluoroquinolone resistance (Colquhoun et al., 2007). Other studies also showed that mutations in both parC and gyrA were necessary for high level of fluoroquinolone resistance (Kitiyodom et al., 2010; Zhou et al., 2013). In our study, no parC mutations occurred in derived resistant mutants. These results contrasted with findings of previous work, in which the genome sequences of ciprofloxacin-induced resistant mutants of Streptococcus pneumoniae revealed QRDRs mutations of both parC and gyrA, and mutations in parC preceded those in gyrA during the selection for ciprofloxacin resistance (Lupien et al., 2013).

Enterobacterial members possessing plasmid-mediated quinolone resistance due to qnr genes was widespread (Rodriguez-Martinez et al., 2006). The presence of novel chromosomal qnr genes have been found in aquatic bacteria and in metagenomes from marine organisms, suggesting a qnr gene bearing plasmid originated from aquatic bacteria (Jacoby and Hooper, 2013). In our study, the whole genome of strain F7 was sequenced (data not shown), and the qnr gene was found to be chromosomal but without consensus LexA binding site in the 300 bp upstream of qnr. Since LexA is the central regulator of the SOS response to DNA damage (Kwak et al., 2013), the ciprofloxacin induction that appeared in our mutants could be SOS-independent and due to fluoroquinolone exposure (Li et al., 2015). Similar results have been reported elsewhere that fluoroquinolones induced chromosomal qnrVS1 expression in Vibrio splendidus and closely related plasmid-carried qnrS1 gene was regulated independently of the SOS system (Okumura et al., 2011). In contrast, the qnrB gene was induced by fluoroquinolones in an SOS-dependent manner (Wang et al., 2009). Although a role for Qnr alone conferring resistance cannot be substantiated, the gene could supplement fluoroquinolone resistance due to target enzyme changes, deficiencies in porin channels or efflux pump activation, and would facilitate selection of higher resistance through mutation (Rodriguez-Martinez et al., 2011).

The RND efflux pumps VmeAB and VmeCD are able to export fluoroquinolones (Matsuo et al., 2007, 2013). Our data indicated that the gradual increase in ciprofloxacin selection concentrations resulted in altered vmeB and vmeD expression in V. parahaemolyticus. The expression level of vmeD correlated with the level of antibiotic selection pressure. The vmeD gene was initially only slightly increased in mutant H32. As the ciprofloxacin level was further increased, the resistance level of mutant H128 increased for many antibiotics, especially for fluoroquinolones (Table 2), and this was related to vmeD and vpoC overexpression. Therefore, the VmeCD-VpoC efflux pump was involved in decreased susceptibility of mutants H32 and H128 to fluoroquinolones. The TetR family transcriptional regulator, VP0040, located upstream of vmeCD, has been implicated in vmeCD regulation (Matsuo et al., 2013). Antibiotics such as chloramphenicol and imipenem could also select for MDR strains of Gram-negative bacteria due to the overexpression of RND efflux pumps (Ghisalberti et al., 2005).

The relative fitness of derived mutants indicated that fluoroquinolone-resistant mutants harboring GyrA Ser83Ile mutations along with qnr were at a significant growth disadvantage in antibiotic-free culture in comparison with the susceptible strain. Similar results have been previously reported in which some combinations of qnr and gyrA mutations had a measurable decrease in growth rates (Machuca et al., 2014). This would make a fitness cost as an explanation for the lack of gyrA mutations unlikely. This contrasted with fluoroquinolone-resistant Campylobacter jejuni strains that showed enhanced fitness in the absence of selection pressure (Luo et al., 2005).

Mutants that were selected from parental strain F7 were mainly those that activated efflux pumps. Increased expression of vmeD and vpoC in the mutants was found. Upregulation of drug efflux may also have a fitness cost but this was accommodated in evolution because of their pleiotropic effects on susceptibility to other agents (Marcusson et al., 2009). The adaptation to fitness cost may need a longer evolutionary time.

Conclusions

In our study, ciprofloxacin-selected V. parahaemolyticus mutants possessed reduced susceptibilities to the fluoroquinolones and altered susceptibilities to several chemically unrelated antibiotics. Ciprofloxacin resistance of laboratory-derived V. parahaemolyticus mutants can thus arise by more than one mechanism, including alterations in quinolone target enzymes (GyrA) and the activation of the VmeCD-VpoC efflux pump. The qnr gene located on chromosome of V. parahaemolyticus facilitates selection of higher resistance through mutation.

Footnotes

Acknowledgments

This study was supported by the National Key R&D Program of China (2017YFC1600100) and the National Natural Science Foundation of China (31471660).

Disclosure Statement

No competing financial interests exist.

References

Biot

, Lopez

, Poyot

, Neulat-Ripoll

, Lignon

, Caclard

, Thibault

, Peinnequin

, Pagès

, Valade

. Interplay between three RND efflux pumps in doxycycline-selected strains of Burkholderia thailandensis . PLoS One, 2013; 8:e84068.

Cesaro

, Bettoni

, Lascols

, Merens

, Soussy

, Cambau

. Low selection of topoisomerase mutants from strains of Escherichia coli harbouring plasmid-borne qnr genes. J Antimicrob Chemother, 2008; 61:1007–1015.

[CLSI] Clinical and Laboratory Standards Institute. Performance standards for antimicrobial susceptibility testing: Twenty-sixth informational supplement, M100-S26. Wayne, PA: Clinical and Laboratory Standards Institute, 2016.

Colquhoun

, Aarflot

, Melvold

. gyrA and parC mutations and associated quinolone resistance in Vibrio anguillarum serotype O2b strains isolated from farmed Atlantic cod (Gadus morhua) in Norway. Antimicrob Agents Chemother, 2007; 51:2597–2599.

Ghisalberti

, Masi

, Pages

, Chevalier

. Chloramphenicol and expression of multidrug efflux pump in Enterobacter aerogenes . Biochem Biophys Res Commun, 2005; 328:1113–1118.

Goto

, Kawamura

, Arakawa

. Contribution of QnrA, plasmid-mediated quinolone resistance peptide, to survival of Escherichia coli exposed to lethal ciprofloxacin concentration. Jpn J Infect Dis, 2015; 68:196–202.

Han

, Walker

, Janes

, Prinyawiwatkul

, Ge

. Antimicrobial susceptibilities of Vibrio parahaemolyticus and Vibrio vulnificus isolates from Louisiana Gulf and retail raw oysters. Appl Environ Microbiol, 2007; 73:7096–7098.

Hooper

. Mechanisms of fluoroquinolone resistance. Drug Resist Updat, 1999; 2:38–55.

Jacoby

, Hooper

. Phylogenetic analysis of chromosomally determined Qnr and related proteins. Antimicrob Agents Chemother, 2013; 57:1930–1934.

10.

Jiang

, Yao

, Li

, Tan

, Zhai

, Wang

. Characterization of antimicrobial resistance of Vibrio parahaemolyticus from cultured sea cucumbers (Apostichopus japonicas). Lett Appl Microbiol, 2014; 59:147–154.

11.

Kim

, Jo

, Ding

, Lee

, Ahn

. Assessment of altered binding specificity of bacteriophage for ciprofloxacin-induced antibiotic-resistant Salmonella Typhimurium. Arch Microbiol, 2016; 198:521–529.

12.

Kitiyodom

, Khemtong

, Wongtavatchai

, Chuanchuen

. Characterization of antibiotic resistance in Vibrio spp. Isolated from farmed marine shrimps (Penaeus monodon). FEMS Microbiol Ecol, 2010; 72:219–227.

13.

Kwak

, Jacoby

, Hooper

. Induction of plasmid-carried qnrS1 in Escherichia coli by naturally occurring quinolones and quorum-sensing signal molecules. Antimicrob Agents Chemother, 2013; 57:4031–4034.

14.

, Plésiat

, Nikaido

. The challenge of efflux-mediated antibiotic resistance in Gram-negative bacteria. Clin Microbiol Rev, 2015; 28:337–418.

15.

Liu

, Wong

, Chen

. Molecular characterisation of a multidrug resistance conjugative plasmid from Vibrio parahaemolyticus . Int J Antimicrob Agents, 2013; 42:575–579.

16.

Luo

, Pereira

, Sahin

, Lin

, Huang

, Michel

, Zhang

. Enhanced in vivo fitness of fluoroquinolone-resistant Campylobacter jejuni in the absence of antibiotic selection pressure. Proc Natl Acad Sci U S A, 2005; 102:541–546.

17.

Lupien

, Billal

, Fani

, Soualhine

, Zhanel

, Leprohon

, Ouellette

. Genomic characterization of ciprofloxacin resistance in a laboratory-derived mutant and a clinical isolate of Streptococcus pneumoniae . Antimicrob Agents Chemother, 2013; 57:4911–4919.

18.

Machuca

, Briales

, Labrador

, Diaz-de-Alba

, Lopez-Rojas

, Docobo-Perez

, Martinez-Martinez

, Rodriguez-Bano

, Pachon

, Pascual

, Rodriguez-Martinez

. Interplay between plasmid-mediated and chromosomal-mediated fluoroquinolone resistance and bacterial fitness in Escherichia coli . J Antimicrob Chemother, 2014; 69:3203–3215.

19.

Marcusson

, Frimodt-Moller

, Hughes

. Interplay in the selection of fluoroquinolone resistance and bacterial fitness. PLoS Pathog, 2009; 5:e1000541.

20.

Martinez-Urtaza

, Simental

, Velasco

, DePaola

, Ishibashi

, Nakaguchi

, Nishibuchi

, Carrera-Flores

, Rey-Alvarez

, Pousa

. Pandemic Vibrio parahaemolyticus O3:K6, Europe. Emerg Infect Dis, 2005; 11:1319–1320.

21.

Matsuo

, Hayashi

, Morita

, Koterasawa

, Ogawa

, Mizushima

, Tsuchiya

, Kuroda

. VmeAB, an RND-type multidrug efflux transporter in Vibrio parahaemolyticus . Microbiology, 2007; 153(Pt 12):4129–4137.

22.

Matsuo

, Nakamura

, Kodama

, Mikami

, Hiyoshi

, Tsuchiya

, Ogawa

, Kuroda

. Characterization of all RND-type multidrug efflux transporters in Vibrio parahaemolyticus . Microbiologyopen, 2013; 2:725–742.

23.

Nair

, Ramamurthy

, Bhattacharya

, Dutta

, Takeda

, Sack

. Global dissemination of Vibrio parahaemolyticus serotype O3:K6 and its serovariants. Clin Microbiol Rev, 2007; 20:39–48.

24.

Nikaido

, Takatsuka

. Mechanisms of RND multidrug efflux pumps. Biochim Biophys Acta, 2009; 1794:769–781.

25.

Okuda

, Hayakawa

, Nishibuchi

, Nishino

. Sequence analysis of the gyrA and parC homologues of a wild-type strain of Vibrio parahaemolyticus and its fluoroquinolone-resistant mutants. Antimicrob Agents Chemother, 1999; 43:1156–1162.

26.

Okumura

, Liao

, Gavin

, Jacoby

, Hoope

. Quinolone induction of qnrVS1 in Vibrio splendidus and plasmid-carried qnrS1 in Escherichia coli, a mechanism independent of the SOS system. Antimicrob Agents Chemother, 2011; 55:5942–5945.

27.

Poirel

, Liard

, Rodriguez-Martinez

, Nordmann

. Vibrionaceae as a possible source of Qnr-like quinolone resistance determinants. J Antimicrob Chemother, 2005; 56:1118–1121.

28.

Ricci

, Piddock

. Ciprofloxacin selects for multidrug resistance in Salmonella enterica serovar Typhimurium mediated by at least two different pathways. J Antimicrob Chemother, 2009; 63:909–916.

29.

Rodriguez-Martinez

, Cano

, Velasco

, Martínez-Martínez

, Pascual

. Plasmid-mediated quinolone resistance: An update. J Infect Chemother, 2011; 17:149–182.

30.

Rodriguez-Martinez

, Velasco

, Pascual

, Garcia

, Martinez-Martinez

. Correlation of quinolone resistance levels and differences in basal and quinolone-induced expression from three qnrA containing plasmids. Clin Microbiol Infect, 2006; 12:440–445.

31.

Roig

, Llorens

, Fouz

, Amaro

. Spontaneous quinolone resistance in the zoonotic serovar of Vibrio vulnificus . Appl Environ Microbiol, 2009; 75:2577–2580.

32.

Saga

, Kaku

, Onodera

, Yamachika

, Sato

, Takase

. Vibrio parahaemolyticus chromosomal qnr homologue VPA0095: Demonstration by transformation with a mutated gene of its potential to reduce quinolone susceptibility in Escherichia coli . Antimicrob Agents Chemother, 2005; 49:2144–2145.

33.

Vinué

, Corcoran

, Hooper

, Jacoby

. Mutations that enhance the ciprofloxacin resistance of Escherichia coli with qnrA1 . Antimicrob Agents Chemother, 2015; 60:1537–1545.

34.

Wang

, Jacoby

, Mills

, Hooper

. SOS regulation of qnrB expression. Antimicrob Agents Chemother, 2009; 53:821–823.

35.

Weigel

, Anderson

, Facklam

, Tenover

. Genetic analyses of mutations contributing to fluoroquinolone resistance in clinical isolates of Streptococcus pneumoniae . Antimicrob Agents Chemother, 2001; 45:3517–3523.

36.

Zhou

, Yu

, Li

, Zhang

, Tong

, Kan

. Accumulation of mutations in DNA gyrase and topoisomerase IV genes contributes to fluoroquinolone resistance in Vibrio cholerae O139 strains. Int J Antimicrob Agents, 2013; 42:72–75.