Phenotypic and Genotypic Characterization of Escherichia coli and Salmonella enterica from Dairy Cattle Farms in the Wakiso District,Uganda: A Cross-Sectional Study

Abstract

Enterobacteriaceae producing β-lactamases have spread rapidly worldwide and pose a serious threat to human-animal-environment interface. In this study, we present the presence of Salmonella enterica (1.3%) and commensal Escherichia coli (96.3%) isolated from 400 environmental fecal dairy cattle samples over 20 farms in Uganda. Among E. coli isolates, 21% were resistant to at least one antimicrobial tested and 7% exhibited multidrug resistance. Four E. coli isolates displayed extended-spectrum beta-lactamase (ESBL)-producing genes, including bla _CTX-M-15 (n = 2/4), bla _CTX-M-27 (n = 1/4), bla _SHV-12 (n = 1/4), and bla _TEM-1B (n = 2/4). Whole genome sequencing confirmed the presence of the plasmid-mediated quinolone resistance qnrS1 gene among three ESBL isolates. No statistically significant differences in seasonal prevalence for E. coli and S. enterica among dairy cattle sampling periods were observed. Furthermore, to our knowledge, this is the first report of E. coli carrying bla _CTX-M-15, bla _CTX-M-27, bla _SHV-12, or qnrS1 isolated from dairy cattle in Uganda. We conclude that the presence of globally disseminated bla_CTX-M-15 and bla_CTX-M-27 warrants further study to prevent further spread. In addition, the presence of fluoroquinolone resistant ESBL-producing E. coli on dairy farms highlights the potential risk among the human-livestock-environment interaction. This study can be used as a baseline for implementation of a more robust national integrated surveillance system throughout Uganda.

Introduction

S almonella is a foodborne pathogen and one of four leading causes of diarrheal disease worldwide. More than 33 million deaths annually are attributed to salmonellosis. Conversely, foodborne infections caused by Escherichia coli are rare, although some strains cause severe disease (WHO, 2016).

In Uganda, since diarrhea-related deaths are reported as of unknown etiology, mortality related to foodborne Salmonella spp. and commensal E. coli cannot be determined (UNAS et al., 2015). In addition, there is a lack of information on antimicrobial resistance (AMR) in foodborne pathogens and no coordinated AMR surveillance system exists. Uganda has developed a National Action Plan (NAP) on AMR, which includes an integrated national surveillance system for foodborne pathogens.

As a result of these information gaps, the World Health Organization (WHO), supported by the Advisory Group on Integrated Surveillance of AMR (AGISAR), released a call for research proposals to build, improve, or strengthen capacities in countries to establish an integrated surveillance system on AMR (WHO, 2015). AMR is a global issue that can render current treatment regimens ineffective, resulting in higher health care costs for patients with resistant infections. AMR infections are also associated with increased morbidity and mortality (WHO, 2017a). If no changes or efforts are made to control AMR by 2050, it is estimated that over 10 million deaths per year will be related to AMR infections (Mckenna, 2014). Increased use of antimicrobials, including misuse among physicians and veterinarians, the ready availability of antimicrobials in developing countries, and exposure of the environment to antimicrobial and antimicrobial-like compounds, often contribute to the resistance problem (UNAS et al., 2015).

Since a national surveillance program is absent in Uganda, the prevalence and trends of Salmonella and commensal E. coli (including AMR) in food animals, humans, and the environment are largely unknown. We conducted a pilot study to determine the percent positive, Salmonella and commensal E. coli among dairy cattle; AMR testing was included. Salmonella or E. coli are recommended sentinel organisms in AMR surveillance systems (WHO, 2017b). Dairy cattle farming significantly contributes to the economy, employment, and nutrition through milk production (FBAM, 2014).

This pilot study was conducted in one of 111 districts in Uganda over a 1-year period. The Wakiso district (1906.7 km²) was chosen because of its proximity to Kampala, the prevalent dairy cattle production in this district, and the nutritional value of these food animals for the people of Kampala. The percent positive and AMR profiles of Salmonella enterica and commensal E. coli were determined from environmental fecal samples collected on dairy cattle farms.

Materials and Methods

Experimental design and sample collection

This project was designed as four cross-sectional studies over a 1-year period. One sampling period occurred over two seasons, the rainy season (March) and the dry season (December). Voluntary enrollment in the study occurred following contact by the district veterinarian with producers from the Wakiso district. A total of 20 dairy cattle producers agreed to participate in the study. The total herd size on each farm ranged from 7 to 200 (Table 1); farms were located in the western part of the district. Cattle were left to graze and supplemented with potato vines mixed with molasses. On-farm sampling occurred once during the rainy and dry seasons (40 farm visits); 10 samples per farm were collected at each visit (n = 400). Table 1 shows the number of cattle present for sampling per farm.

Table 1.

Total Number of Cattle Present per Farm

Farm No.	Total No. of cattle	Farm No.	Total No. of cattle
Farm-1	12	Farm-11	200
Farm-2	40	Farm-12	11
Farm-3	27	Farm-13	7
Farm-4	22	Farm-14	12
Farm-5	24	Farm-15	9
Farm-6	9	Farm-16	29
Farm-7	15	Farm-17	60
Farm-8	50	Farm-18	40
Farm-9	29	Farm-19	24
Farm-10	32	Farm-20	10

Tongue depressors were used to collect fresh fecal droppings from the pasture environment. Care was taken to ensure each sample represented one cow; contact with the ground did not occur during sampling. Samples were placed in a sterile Whirl-Pak bag and transported to the laboratory on ice.

Bacterial culture and isolation

For Salmonella isolation, ∼1 g of sample was transferred to 9 mL each of Gram-negative Hajna (GN) broth and tetrathionate (TET) broth and incubated at 37°C for either 24 h (GN) or 48 h (TET). Culture continued as described (Fedorka-Cray et al., 1996). Presumptive positive Salmonella colonies were confirmed by serogrouping using slide agglutination followed by polymerase chain reaction (PCR) screening for the invA gene (present in all Salmonella spp.). For E. coli culture, one sterile cotton tip applicator (100 μL) inoculated with cultured GN broth was used to streak a Chromagar ECC (DRG International, Springfield Township, NJ) plate. After incubation overnight at 37°C, one well-isolated presumptive E. coli colony was struck to another Chromagar ECC plate to ensure purity. E. coli isolates were confirmed using the Kovac's Indole testing (Sigma, Inc., St. Louis, MO).

Antimicrobial susceptibility testing

Antimicrobial susceptibility was determined for all confirmed Salmonella and commensal E. coli isolates. Broth microdilution (Sensititre^™; Thermo Fisher Scientific, Waltham, MA) was used to measure the minimum inhibitory concentration (MIC) of 14 antimicrobials, including ampicillin, amoxicillin/clavulanic acid, azithromycin, cefoxitin, ceftiofur, ceftriaxone, chloramphenicol, ciprofloxacin, gentamicin, nalidixic acid, streptomycin, sulfisoxazole, tetracycline, and trimethoprim/sulfamethoxazole. Quality control strains included ATCC 29213 Staphylococcus aureus, ATCC 25922 E. coli, ATCC 27853 Pseudomonas aeruginosa, and ATCC 29212 Enterococcus faecalis. The Clinical and Laboratory Standards Institute procedures were followed for MIC interpretation (CLSI, 2017).

Extended-spectrum beta-lactamase screening

To examine molecular mechanisms of isolates presenting β-lactam resistance, isolates presenting resistance to ceftiofur (MIC ≥8 μg/mL) and/or ceftriaxone (MIC ≥4 μg/mL) antimicrobials were screened for extended-spectrum beta-lactamase (ESBL)-producing genes (Sjolund-Karlsson et al., 2013) using PCR; boiled lysates were used as DNA templates. Isolates were struck for isolation to Tryptic Soy Agar (TSA) with 5% sheep blood and incubated overnight at 37°C. Lysates were prepared by suspending a loopful of well-isolated colonies into 200 μL of molecular grade water and vortexing at maximum speed for several seconds. The suspension was boiled at 100°C for 10 min, centrifuged at 13 × 1000 rpm for 1 min, and the supernatant was collected for use as the DNA template. DNA templates were screened for the presence of the five most common ESBL genes: bla _CTX, bla _TEM, bla _CMY, bla _OXA-1, and bla _SHV (Brinas et al., 2002; Bonnet et al., 2003; Chen et al., 2004) using the Hotstar Taq Master Mix kit (Qiagen, Inc., Valencia, CA) according to the manufacturer's instructions.

Replicon plasmid screening using PCR

The five Salmonella and four ESBL E. coli DNA templates were screened using the PCR-based replicon typing (PBRT) system (Diatheva, Cartoceto, Italy) according to the manufacturer's instructions. The PBRT kit is composed of an eight multiplex PCR (amplification of 28 replicons), representing the incompatibility group recognized in resistant plasmids among Enterobacteriaceae. The replicons include the following: HI1, HI2, I1α, M, N, I2, BO, FIB, FIA, W, L, P, X3, I1γ, T, A/C, FIIS, U, X1, R, FIIK, Y, X2, FIC, K, HIB-M, FIB-M, and FII.

Integron 1 PCR screening

The five Salmonella and four ESBL E. coli DNA templates were screened for Class 1 integrons by PCR. The target gene was intI1 with (5′ CAGTGGACATAAGCCTGTTC 3′) as the forward and (5′ CCCGAGGCATAGACTGTA 3′) as the reverse primers. Thermal cycler parameters were as follows: an initial cycle at 94°C for 10 min, 29 cycles of 94°C for 1 min, 54°C for 1 min, and 72°C for 2 min, elongation cycle at 72°C for 10 min, and 4°C to hold.

Whole genome sequencing

Whole genome sequencing (WGS) was conducted to determine antimicrobial determinates, multilocus sequence typing (MLST), plasmids, and virulence factors of the ESBL E. coli, using the blood and tissue kit from Qiagen, Inc. to extract the DNA. Isolates were sequenced using manufacturer's procedures for the Illumina Miseq (Illumina, Incorporated, San Diego, CA). All gene sequences were uploaded and analyzed in the CLC Genomics Workbench 10.1.1 (Qiagen, Inc.). WGS was also used to determine the serovar of the five Salmonella. Sequences were imported into SeqSero and PlasmidFinder 1.3 (Center for Genomic Epidemiology; www.genomicepidemiology.org) for serotype and plasmid prediction, respectively. Serological typing was also performed on the five Salmonella at the Norwegian Veterinary Institute, Adamstuen, Oslo, Norway.

Statistical analysis

The occurrence of Salmonella and E. coli was analyzed using WHONET and Microsoft Excel. A logistic regression model was used in SAS^® software (SAS, Cary, NC), where season (rainy and dry) served as the factor. Farm was included as a random effect.

Results

Percent positive Salmonella and E. coli from dairy cattle

Overall, from the 400 samples collected, 385 (96.3%) were positive for E. coli and 5 (1.3%) for S. enterica. Only two farms were positive for Salmonella. No statistically significant differences between seasons for E. coli (p = 0.4298) or S. enterica (p = 0.9973) were observed.

Antimicrobial resistance

No resistance was observed among S. enterica isolates. Eighty-one E. coli isolates (21%; 81/385) were resistant to at least one antimicrobial tested. Resistance occurred most often to tetracycline (17%), sulfisoxazole (17%), streptomycin (13%), trimethoprim-sulfamethoxazole (9%), ampicillin (7%), and chloramphenicol (3%). Multidrug resistance to three (7%) or four (4.2%) classes of antimicrobial drugs was observed and eight resistance patterns were detected with STR-FIS-TCY occurring most often (19%), followed by AMP-STR-FIS-TCY-SXT (11%); TCY (8%); FIS-TCY-SXT (7%); FIS (4%); STR-TCY (4%); and 3% each for STR-FIS and AMP-FIS-TCY-SXT.

Molecular characterization

Four Salmonella isolates serotyped as Guildford (ST3809; one farm), while one farm had Salmonella Enteritidis. E. coli serotypes were O133:H39; O133:H39; ONT:H9; and O154:H30. The ONT:H9 isolate exhibited a new O antigen that has not previously typed. Four ESBL E. coli were confirmed by PCR and WGS as positive for bla_CTX-M-15 (n = 2/4), bla _CTX-M-27 (n = 1/4), bla _SHV-12 (n = 1/4), and bla _TEM-1B (n = 2/4) genes. In addition to the presence of β-lactam genes, we observed the plasmid-mediated quinolone resistance (PMQR) qnrS1 gene among three ESBL isolates (bla _CTX-M-15+qnrS1 [n = 2], and bla _SHV-12+qnrS1 [n = 1]) (Table 2). These isolates were also phenotypically resistant to ciprofloxacin.

Table 2.

Phenotype and Genotype Comparison of Extended-Spectrum Beta-Lactamase Escherichia coli from Dairy Cattle Farms in Wakiso District of Uganda

		Resistance genes		Plasmid replicon typing		Class 1 integron
E. coli strain	Resistance pattern	PCR	WGS	PCR	WGS	PCR	WGS	MLST/ST complex
E. coli-1 O133:H39	AMP, TIO, CRO, CIP^*, FIS, SXT	bla _CTX-M	bla _CTX-M-15, qnrS1, strA, strB, sul2	None	None	None	Intl1	ST6636/none
E. coli-2 O133:H39	AMP, TIO, CRO, CIP^*, FIS, SXT	bla _CTX-M	bla _CTX-M-15, qnrS1, strA, strB, sul2, dfrA14	IncHI2	Incl1	None	Intl1	ST6636/none
E. coli-3 ONT:H9	AMP, CRO, CIP^*, FIS, TCY, SXT	bla _SHV, bla_TEM	bla _SHV-12, bla_TEM-1B , qnrS1, strA, strB, fosA, sul2, tet(A), dfrA14	IncX3, IncHI1, IncHI2	IncX3, ColpVC	None	Intl1	ST7460/none
E. coli-4 O154:H30	AMP, AZI, TIO, CRO, CHL, STR, FIS, TCY, SXT	bla _CTX-M, bla_TEM	bla _CTX-M-27, bla_TEM-1B , strA, strB, mph(A), catA1, sul1, sul2, tet(A), dfrA7, dfrA14	IncFIB, IncFII, IncP	IncFIB, IncFII, IncQ1	Intl1	Intl1	ST58/ST155

Resistance to ciprofloxacin.

MLST, multilocus subtype; PCR, polymerase chain reaction; ST, sequence type; WGS, whole genome sequencing.

The class 1 integron Int1 was detected by PCR amplification in only one ESBL E. coli isolate. However, WGS was able to detect Int1 from four ESBL E. coli isolates through the resistance genes cassette displaying E. coli-1: strA-strB-sul2; E. coli-2: strA-strB-sul2-dfrA14; E. coli-3: strA-strB-sul2-dfrA14; and E. coli-4: strA-strB-sul2-dfrA7-dfrA14 (as shown in Table 2).

In addition, six replicon-type plasmids were detected by PCR among the ESBL isolates; (IncFIB, IncFII IncP, IncHI2, IncHI1, and IncX3). Conversely, WGS predicted six plasmids (IncFIB, IncFII, IncQ1, Incl1, IncX3, and ColpVC) with three (IncFIB, IncFII, and IncX3) matching PCR results. IncQ1, Incl1, and ColpVC were not included in the PCR kit. The occurrence of bla _CTX-M-15 gene was previously reported as encoded on an Incl1 plasmid in a strain carrying qnrS1, strA, and sul2 (Toh et al., 2017) and other β-lactam genes as well (Knudsen et al., 2018). Only the Enteritidis isolate harbored the spv-encoding virulence plasmids IncFII and IncFIB(S), previously reported by Kudirkiene et al. (2018).

One ESBL isolate exhibiting bla _CTX-M-27 belonged to a common ESBL-producing clonal MLST complex ST58/ST155 (Chen et al., 2016), while two isolates belonged to ST6636 and one to ST7460 (Table 2). For Salmonella, all Guildford were ST3809, while Enteritidis typed as the commonly observed ST11 (Toro et al., 2016).

Discussion

The E. coli percent positives described in this study highlight their ubiquity and potential human-livestock cross- contamination, as cattle are kept in close proximity to households in Uganda. Previously, human and livestock E. coli showed low genetic diversity in Uganda, suggesting that these strains are circulating in both settings (Rwego et al., 2008). In fact, these aspects could contribute to the increase in risk factors of zoonotic and zooanthroponotic transmission in the dairy sector, causing economic problems with decreased productivity, mastitis, and hospitalization as previously reported (Rwego et al., 2008; Ssajjakambwe et al., 2017). While recovery of S. enterica was low in this study, a public health issue emerges when consumption of raw milk in underdeveloped countries continues. Furthermore, water is also a source of Salmonella in the Kampala area (Afema et al., 2016), although Guilford was not isolated and Enteritidis was only recovered from 1/72 ruminant sources. Water (spring and well) was shared among animals and humans on our study farms and likely serves as a source of contamination.

The overall percent resistance observed in this study among E. coli (21%) was comparable as reported by Weiss et al. (2018), although the tetracycline resistance among cattle isolates differed. This can be attributed to different sampling sites between studies. Our on-farm surveys (data not shown) indicated that oxytetracycline was used most often to treat ill animals. Tetracycline is reported as the most commonly used antimicrobial (in feed or for prophylaxis) for treatment (UNAS et al., 2015). However, no causality could be determined in this study.

The occurrence of ESBL-producing Enterobacteriaceae such as E. coli carrying bla _CTX-M-15, bla _CTX-M-27, bla _SHV-12, and bla _TEM-1B has been associated with dairy cattle worldwide (Afema et al., 2018). It is also commonly associated with infectious disease in hospital settings. The occurrence of E. coli coproducing ESBL and PMQR genes in dairy cattle farms could be associated with the host adaptability of E. coli strains. Although, bla _CTX-M-15, bla _CTX-M-27, bla _SHV-12, and qnrS1 have been widely described worldwide (Jacoby et al., 2014; Chong et al., 2018), the results of this study are the first observation, to our knowledge, of E. coli carrying bla _CTX-M-15, bla _CTX-M-27, bla _SHV-12, or qnrS1 isolated from dairy cattle in Uganda. Furthermore, the IncX3 and Incl1 plasmids may serve as vectors in the dissemination of bla _SHV-12 and bla _CTX-M-15, respectively (Toh et al., 2017; Liakopoulos et al., 2018).

Of the four ESBL E. coli, only one was positive for the class I integron integrase gene IntI1 by PCR, while all four were positive by WGS. The presence of integron gene cassettes harboring AMR genes is important for ESBL-producing organisms (Mehdipour Moghaddam et al., 2015). We observed that the Int1 (cassette sul-strA-strb-intl1-dfrA) was present in isolates harboring ESBL genes bla _TEM-1B and bla _CTX-M-15. Studies have shown that commensal E. coli encoding these types of genetic determinants are transferrable (Karczmarczyk et al., 2011; Navajas-Benito et al., 2017) and have been also been associated in clinical settings (Cerdeira et al., 2017).

Only Salmonella Enteritidis harbored the spv-encoding virulence plasmids IncFII and IncFIB(S) previously reported by Kudirkiene et al. (2018). Salmonella from water sources were previously found to be primarily pan-susceptible among ruminant sources (Afema et al., 2016), which closely matched our findings despite the differences among serotypes. However, other studies in cattle over the past 19 years demonstrating AMR among S. enterica from cattle have reported that AMR Salmonella from humans was three times more likely to exhibit resistance to older antimicrobials, while AMR among cattle isolates was more likely for newer antimicrobials (UNAS et al., 2015). A careful analysis of these studies by serotype as well as use information is necessary.

Limitations in this study included the lack of resources, including human, laboratory, and financial. Water sampling was removed from the study because of these limitations. Many supplies were not available within the country and had to be shipped from the United States and laboratory infrastructure was poor. As a result, isolates were shipped to the United States for all characterization, including WGS. As expected, WGS has a high degree of resolution and was more accurate than PCR. However, identification of a new O antigen in E. coli as well as the ESBL and PMQR findings, and Salmonella Guildford serotype highlight the importance of this work.

Conclusion

To our knowledge, this is the first report of E. coli carrying bla _CTX-M-15, bla _CTX-M-27, bla _SHV-12, or qnrS1 isolated from dairy cattle in Uganda. The presence of globally disseminated bla_CTX-M-15 and bla _CTX-M-27 warrants further investigation to prevent their spread. In addition, the presence of fluoroquinolone resistant ESBL-producing E. coli in dairy farms could impact treatment in both veterinary and public health. Finally, the presence of S. enterica in dairy cattle farms also poses a public health risk. This study will provide information for national authorities to establish a national surveillance program with continued monitoring of AMR.

Footnotes

Acknowledgments

We would like to recognize funding sources from North Carolina State University (NCSU), College of Veterinary Medicine (CVM), and the WHO AGISAR Secretariat. We would also like to thank all colleagues from NCSU CVM, WHO, and Makerere CVM in Kampala, Uganda, who assisted with this project.

Disclosure Statement

No competing financial interests exist.

References

Afema

, Ahmed

, Besser

, Jones

, Sischo

, Davis

. Molecular epidemiology of dairy cattle-associated Escherichia coli carrying bla _CTX-M genes in Washington State. Appl Environ Microbiol, 2018; 84. DOI: 10.1128/AEM.02430-17

Afema

, Byarugaba

, Shah

, Atukwase

, Nambi

, Sischo

. Potential sources and transmission of Salmonella and antimicrobial resistance in Kampala, Uganda. PLoS One, 2016; 11:e0152130.

Bonnet

, Recule

, Baraduc

, Chanal

, Sirot

, De Champs

, Sirot

. Effect of D240G substitution in a novel ESBL CTX-M-27. J Antimicrob Chemother, 2003; 52:29–35.

Brinas

, Zarazaga

, Saenz

, Ruiz-Larrea

, Torres

. Beta-lactamases in ampicillin-resistant Escherichia coli isolates from foods, humans, and healthy animals. Antimicrob Agents Chemother, 2002; 46:3156–3163.

Cerdeira

, Cunha

MPV

, Francisco

, Bueno

MFC

, Araujo

, Ribas

, Gontijo-Filho

, Knobl

, de Oliveira Garcia

, Lincopan

. IncX3 plasmid harboring a non-Tn4401 genetic element (NTEKPC) in a hospital-associated clone of KPC-2-producing Klebsiella pneumoniae ST340/CG258. Diagn Microbiol Infect Dis, 2017; 89:164–167.

Chen

, Hung

, Huang

, Chen

, Huang

, Chen

, Chiou

, Hung

, Wang

, Cheng

. Characteristics of CTX-M extended-spectrum beta-lactamase producing Escherichia coli strains isolated from multiple rivers in southern Taiwan. Appl Environ Microbiol, 2016; 82:1889–1897.

Chen

, Zhao

, White

, Schroeder

, Lu

, Yang

, McDermott

, Ayers

, Meng

. Characterization of multiple-antimicrobial-resistant Salmonella serovars isolated from retail meats. Appl Environ Microbiol, 2004; 70:1–7.

Chong

, Shimoda

, Shimono

. Current epidemiology, genetic evolution and clinical impact of extended-spectrum beta-lactamase-producing Escherichia coli and Klebsiella pneumoniae . Infect Genet Evol, 2018; 61:185–188.

CLSI. Performance Standards for Antimicrobial Susceptibility Testing; Twenty-Fourth Informational Supplement. CLSI document M100-S27. Wayne, PA: Clinical and Laboratory Standards Institute, 2017.

10.

FBAM. Industry Focus: Dairy Industry in Uganda. Food Business Africa Magazine. 2014. Available at: www.foodbusinessafrica.com/industry-focus-dairy-industry-in-uganda, accessed April 2, 2017 .

11.

Fedorka-Cray

, Bush

, Thomas

, Gray

, McKean

. Salmonella Infection in Herds of Swine. Swine Research Report. 1996. Available at: https://lib.dr.iastate.edu/cgi/viewcontent.cgi?referer=&httpsredir=1&article=1048&context=swinereports_1996, accessed April 2, 2017 .

12.

Jacoby

, Strahilevitz

, Hooper

. 2014. Plasmid-mediated quinolone resistance. Microbiol Spectrum 2:PLAS-0006-2013. DOI:10.1128/microbiolspec.PLAS-0006-2013.

13.

Jacoby

, Strahilevitz

, Hooper

. Plasmid-mediated quinolone resistance. Microbiol Spectr, 2014; 2.

14.

Karczmarczyk

, Walsh

, Slowey

, Leonard

, Fanning

. Molecular characterization of multidrug-resistant Escherichia coli isolates from Irish cattle farms. Appl Environ Microbiol, 2011; 77:7121–7127.

15.

Knudsen

, Gammelsrud

, Alfsnes

, Steinbakk

, Abrahamsen

, Muller

, Bohlin

. Transfer of a bla CTX-M-1-carrying plasmid between different Escherichia coli strains within the human gut explored by whole genome sequencing analyses. Sci Rep, 2018; 8:280.

16.

Kudirkiene

, Andoh

, Ahmed

, Herrero-Fresno

, Dalsgaard

, Obiri-Danso

, Olsen

. The use of a combined bioinformatics approach to locate antibiotic resistance genes on plasmids from whole genome sequences of Salmonella enterica serovars from humans in Ghana. Front Microbiol, 2018; 9:1010. Published online 2018 May 17. DOI: 10.3389/fmicb.2018.01010

17.

Liakopoulos

, van der Goot

, Bossers

, Betts

, Brouwer

MSM

, Kant

, Smith

, Ceccarelli

, Mevius

. Genomic and functional characterisation of IncX3 plasmids encoding bla _SHV-12 in Escherichia coli from human and animal origin. Sci Rep, 2018; 8:7674.

18.

Mckenna

. The Coming Cost of Superbugs: 10 Million Deaths per Year. 2014. www.wired.com/2014/12/oneill-rpt-amr, accessed April 2, 2017 .

19.

Mehdipour Moghaddam

, Mirbagheri

, Salehi

, Habibzade

. Prevalence of class 1 integrons and extended spectrum beta lactamases among multi-drug resistant Escherichia coli isolates from North of Iran. Iran Biomed J, 2015; 19:233–239.

20.

Navajas-Benito

, Alonso

, Sanz

, Olarte

, Martinez-Olarte

, Hidalgo-Sanz

, Somalo

, Torres

. Molecular characterization of antibiotic resistance in Escherichia coli strains from a dairy cattle farm and its surroundings. J Sci Food Agric, 2017; 97:362–365.

21.

Rwego

, Gillespie

, Isabirye-Basuta

, Goldberg

. High rates of Escherichia coli transmission between livestock and humans in rural Uganda. J Clin Microbiol, 2008; 46:3187–3191.

22.

SAS Institute, Inc. The data for this paper was generated using SAS software. Copyright © 2016 SAS Institute, Inc. SAS and all other SAS Institute, Inc. product or service names are registered trademarks or trademarks of SAS Institute Inc., Cary, NC. https://communities.sas.com/t5/Statistical-Procedures/SAS-Citation-quot-EXAMPLE-quot/td-p/206842

23.

Sjolund-Karlsson

, Howie

, Blickenstaff

, Boerlin

, Ball

, Chalmers

, Duval

, Haro

, Rickert

, Zhao

, Fedorka-Cray

, Whichard

. Occurrence of beta-lactamase genes among non-Typhi Salmonella enterica isolated from humans, food animals, and retail meats in the United States and Canada. Microb Drug Resist, 2013; 19:191–197.

24.

Ssajjakambwe

, Bahizi

, Setumba

, Kisaka

, Vudriko

, Atuheire

, Kabasa

, Kaneene

. Milk hygiene in rural southwestern Uganda: Prevalence of mastitis and antimicrobial resistance profiles of bacterial contaminants of milk and milk products. Vet Med Int, 2017; 2017:8710758.

25.

Toh

, Bokhari

, Kutbi

, Haroon

, Mantilla Calderon

, Zowawi

, Hong

. Varying occurrence of extended-spectrum beta-lactamase bacteria among three produce types. J Food Safety, 2017. Volume 38. DOI: 10.1111/jfs.12373

26.

Toro

, Retamal

, Ayers

, Barreto

, Allard

, Brown

, Gonzalez-Escalona

. Whole-genome sequencing analysis of Salmonella enterica serovar Enteritidis isolates in Chile provides insights into possible transmission between gulls, poultry, and humans. Appl Environ Microbiol, 2016; 82:6223–6232.

27.

UNAS, CDDEP, GARP-Uganda, Mpairwe

, Wamala

. Antibiotic Resistance in Uganda: Situation Analysis and Recommendations. Kampala: Uganda National Academy of Sciences; Center for Disease Dynamics, Economics & Policy, 2015:107.

28.

Weiss

, Wallace

, Rwego

, Gillespie

, Chapman

, Singer

, Goldberg

. Antibiotic-resistant Escherichia coli and class 1 integrons in people, domestic animals, and wild primates in rural Uganda. Appl Environ Microbiol, 2018; 84. DOI: 10.1128/AEM.01632-18

29.

WHO. Global Action Plan for Antimicrobial Resistance. The World Health Organization, 2015. Available at: www.who.int/antimicrobial-resistance/global-action-plan/en, accessed April 2, 2017 .

30.

WHO. Salmonella (non-typhoidal). The World Health Organization, 2016. Available at: www.who.int/news-room/fact-sheets/detail/salmonella-(non-typhoidal), accessed April 2, 2017 .

31.

WHO. Antimicrobial Resistance. Global Antimicrobial Resistance Surveillance System (GLASS). The World Health Organization, 2017a. Available at: www.who.int/news-room/fact-sheets/detail/antimicrobial-resistance, accessed April 2, 2017 .

32.

WHO. Integrated Surveillance of Antimicrobial Resistance in Foodborne Bacteria: Application of a One Health Approach. The World Health Organization, 2017b. Available at: www.who.int/foodsafety/publications/agisar_guidance2017/en, accessed August 31, 2017 .