Prevalence and Characterization of Salmonella in Three Typical Commercial Pig Abattoirs in Wuhan,China

Abstract

This study was designed to investigate the prevalence and characteristics of Salmonella in three Chinese pig abattoirs (A, B, and C) in Wuhan city in 2016. Four types of pig samples were collected and cultured for Salmonella. Salmonella was detected from 329 samples among the 1440 tested (22.9%). There was no significant difference in the overall prevalence between the first visit and the second visit and among the three abattoirs. Rectal swabs (RS) exhibited a significantly higher prevalence than carcass swabs and pork. A total of 177 isolates were characterized by multilocus sequence typing, serotyping, and antimicrobial susceptibility testing. Among 17 sequence types (STs) and 13 serotypes detected, ST40, ST469, and ST34, corresponding to serovars Derby, Rissen, and Typhimurium, respectively, were predominant. The isolates from different abattoirs exhibited diverse ST distribution. The minimum inhibitory concentrations were determined using the microdilution broth method. Resistance to at least one of the antimicrobials was observed for 96.6% of the strains (171/177), and multidrug resistant (MDR) isolates accounted for 75.7% of the strains (134/177). The highest resistance proportion was for tetracycline (92.7%), and the lowest was for cefotaxime (14.1%). The isolates from abattoir A exhibited a significantly lower MDR proportion than those from other abattoirs (p < 0.05). The isolates recovered from RS and pork samples exhibited significantly higher MDR proportions than those recovered from carcass swab samples. Notably, among three predominant STs of isolates, the ST34 isolates showed the highest MDR proportion. In view of the high Salmonella prevalence and antimicrobial resistance, great attention must be paid to the monitoring and controlling of Salmonella in a full pork production chain.

Introduction

S almonella is one of the most important zoonotic bacterial pathogens of economic significance (Galanis et al., 2006). It transmits mainly through contaminated food and feed, which can cause human and animal infection, such as symptoms of poisoning and gastroenteritis, and even death (Sammarco et al., 1997). It remains the most important foodborne pathogen for majority of the developed and developing countries (WHO, 2015). Both pigs and pork are the important sources of Salmonella infection in humans (Boyen et al., 2018; Li et al., 2014), and pig farms and abattoirs are the main sites for Salmonella contamination and transmission (Arguello et al., 2012; Le Bas et al., 2006; Moller et al., 2016; Sanchez-Maldonado et al., 2017).

Serotyping is widely used for the epidemiological investigation of Salmonella that infect humans and animals. Over 2600 serovars had been identified based on agglutination reactions with adsorbed antisera-targeted specific surface antigens (Gal-Mor et al., 2014). Multilocus sequence typing (MLST) is developed based on sequences of multiple housekeeping gene fragments, and the strains that possess identical alleles for all gene fragments are assigned to a common sequence type (ST). The MLST data are publicly available online and can be obtained from decentralized sources. ST often correlates with serovar, and so, MLST is considered a replacement for serotyping in Salmonella (Achtman et al., 2012).

Use of antimicrobials in animals frequently leads to the development of bacterial antimicrobial resistance, which may compromise the effective treatment of bacterial infections in animals and humans (Chen et al., 2004; Aslam et al., 2012; Domenech et al., 2015). A serious threat is the emergence and persistence of resistance to drugs of high importance for human medicine, especially extended-spectrum cephalosporins and fluoroquinolones (Jiu et al., 2017). Therefore, it is of great significance for food safety and public health to strengthen the monitoring and prevention of Salmonella contamination and antimicrobial resistance along the pork production chain.

In this study, we investigated the frequency of Salmonella on different pig samples during slaughtering in three typical Chinese commercial abattoirs in Wuhan city in 2016. Representative strains were selected for further characterization by serotyping, MLST, and antimicrobial susceptibility testing. The difference and correlation on the prevalence and antimicrobial resistance among samples from different abattoirs, STs, and types of samples at two different times were analyzed.

Materials and Methods

Sample collection

Samples were collected from three typical commercial pig abattoirs in Wuhan city, and each abattoir was visited twice in April and October 2016. The background information of the three abattoirs is described in Table 1. At each visit to each abattoir, four incoming pig farms were randomly selected from which fifteen animals were sampled per farm. Four types of pig samples were collected from each animal, which were rectal swabs (RS), carcass swabs after dehairing (CSAD), carcass swabs after splitting (CSAS), and pork samples (PS).

Table 1.

Background of Three Typical Commercial Abattoirs

Abattoirs	Types	Sources of the incoming pigs	Commitment and monitoring of antimicrobials in incoming pig farms	Rough number of pigs for slaughtering per day	Output products
A	Large-scale state-owned meat processing enterprise	Intensive farms	Yes	1500	Chilled pork
B	Large-scale private meat processing enterprise	Intensive farms	No	2000	Chilled pork
C	Small-scale private pig slaughterhouse	Small-scale farms	No	300	Fresh pork

Strain isolation and serotyping

The protocol for Salmonella isolation was modified based on the Chinese National Standard (GB4789.4-2010). The swab samples were placed into tubes containing 5 mL of sterile buffered peptone water (BPW) medium and then incubated overnight at 37°C for pre-enrichment. The PS with around 30 g of each were collected after splitting and homogenized in 100 mL of sterile BPW medium, followed by pre-enrichment as described above. Selective enrichment was performed by transferring 100 μL of the pre-enriched BPW medium prepared above into 10 mL of tetrathionate broth followed by incubation at 42°C for 18–24 h. The enriched broths were used to extract genomic DNA by a heat boiling method (Naas et al., 2007), which was used as the templated in polymerase chain reaction (PCR) amplification of invA gene to screen for positive samples (Rahn et al., 1992). The suspected Salmonella-positive broth was streaked onto bismuth sulfite agar followed by incubation at 37°C for 24 h. The positive colonies were further confirmed by PCR amplification of invA gene. One Salmonella isolate was selected from each positive sample and stored at −80°C. For fifteen samples of the same source from the same pig farm, all strains were characterized if no more than three isolates were recovered, while only three strains were characterized if more than three isolates were recovered. Serotyping was performed according to the Kauffman-White scheme (Grimont and Weill, 2007).

Multilocus sequence typing

Bacteria were recovered in the lysogeny broth medium with shaking at 37°C for 12 h, and the genomic DNA used as template for PCR was extracted by a heat boiling method (Naas et al., 2007). MLST was performed using the primers listed in Table 2 according to the scheme published on the MLST home page (http://enterobase.warwick.ac.uk/species/senterica/allele_st_search). The MLST results were analyzed with MEGA software (version 5.0), and eBURST was made to study the genetic relationship of the STs (Li et al., 2014).

Table 2.

Primers Used for Salmonella Multilocus Sequence Typing in This Study

Genes	Primers		Product (bp)
Genes	For amplification	For sequencing	Product (bp)
aroC	F: CCTGGCACCTCGCGCTATAC	F: GGCACCAGTATTGGCCTGCT	826
aroC	R: CCACACACGGATCGTGGCG	R: CATATGCGCCACAATGTGTTG	826
dnaN	F: ATGAAATTTACCGTTGAACGTGA	F: CCGATTCTCGGTAACCTGCT	833
dnaN	R: AATTTCTCATTCGAGAGGATTGC	R: CCATCCACCAGCTTCGAGGT	833
hemD	F: ATGAGTATTCTGATCACCCG	F: GTGGCCTGGAGTTTTCCACT	666
hemD	R: ATCAGCGACCTTAATATCTTGCCA	R: GACCAATAGCCGACAGCGTAG	666
hisD	F: GAAACGTTCCATTCCGCGCAGAC	F: GTCGGTCTGTATATTCCCGG	894
hisD	R: CTGAACGGTCATCCGTTTCTG	R: GGTAATCGCATCCACGAAATC	894
purE	F: ATGTCTTCCCGCAATAATCC	F: CGCATTATTCCGGCGCGTGT	510
purE	R: TCATAGCGTCCCCCGCGGATC	R: CGCGGATCGGGATTTTCCAG	510
sucA	F: AGCACCGAAGAGAAACGCTG	F: AGCACCGAAGAGAAACGCTG	643
sucA	R: GGTTGTTGATAACGATACGTAC	R: GGTTGTTGATAACGATACGTAC	643
thrA	F: GTCACGGTGATCGATCCGGT	F: ATCCCGGCCGATCACATGAT	852
thrA	R: CACGATATTGATATTAGCCCG	R: CTCCAGCAGCCCCTCTTTCAG	852

Antimicrobial susceptibility testing

The minimum inhibitory concentration values were determined using the broth microdilution method, and antimicrobial susceptibility results were interpreted according to the guidelines of the Clinical and Laboratory Standards Institute (CLSI, 2013). Eight antimicrobial agents were selected, including ampicillin (AMP), cefotaxime (CEF), gentamicin (GEN), amoxicillin/clavulanic acid (AMC), tetracycline (TET), ciprofloxacin (CIP), sulfamethoxazole/trimethoprim (SXT), and chloramphenicol (CHL), which represent eight major classes of antimicrobial agents important to both veterinary and human medicine. An isolate resistant to at least one antimicrobial agent was defined to be antimicrobial resistant (AMR), and an isolate resistant to three or more antimicrobial agents was defined to be multidrug resistant (MDR). Escherichia coli ATCC 25922 was used as the quality control strain.

Statistical analysis

Confidence intervals (CIs), 95%, were calculated using the method described by Ross (2003). Difference in prevalence of positive Salmonella among different groups was analyzed by SAS software (version 9.4; SAS Inst., Inc., Cary, NC). The GLIMMIX procedure with farm as random effect, and abattoir, visit, and sample types as fixed effects was used in the mixed model. Difference in proportion of resistant isolates among different groups was analyzed using the chi-squared test (χ²) by SPSS 17.0 software (SPSS, Inc., Chicago, IL). p Value of <0.05 was deemed to be significantly different.

Results

Salmonella prevalence among the three abattoirs

Among 1440 pig samples collected from the three abattoirs, 329 samples were positive for Salmonella (22.9%, 95% CI: 20.7–25.1) (Supplementary Table S1). As shown in Table 3, there was no significant difference in the overall prevalence between the first visit and the second visit (odds ratio [OR]: 0.83; 95% CI: 0.48–1.45) and among the three abattoirs. With regard to different sample types, the overall recovery from RS (107/360, 29.7%) was significantly higher than that from CSAD (OR: 0.60, 95% CI: 0.42–0.85), CSAS (OR: 0.65, 95% CI: 0.46–0.92), and PS (OR: 0.49, 95% CI: 0.38–0.70). There was no significant difference in the overall recovery between carcass swab and PS (p > 0.05).

Table 3.

Logistic Regression Analysis of the Presence of Salmonella in Different Types of Samples Collected on Four Farms and Three Abattoirs During Two Visits

Variables	Comparison	Estimate	SE	p	OR	95% CI
Variables	Comparison	Estimate	SE	p	OR	Lower	Upper
Visit	Second vs. First	0.1875	0.2832	0.5081	0.83	0.48	1.45
Sample type	CSAS vs. CSAD	−0.0868	0.1864	0.6415	0.92	0.64	1.32
	PS vs. CSAD	0.2067	0.1942	0.2873	1.23	0.84	1.80
	RS vs. CSAD	−0.5172	0.1786	0.0038	0.60	0.42	0.85
	PS vs. CSAS	0.2935	0.1922	0.1269	1.34	0.92	1.96
	RS vs. CSAS	0.4304	0.1764	0.0148	0.65	0.46	0.92
	RS vs. PS	−0.7239	0.1847	<0.0001	0.49	0.34	0.70
Abattoirs	B vs. A	−0.4000	0.3443	0.2456	0.67	0.34	1.32
	C vs. A	0.1368	0.3498	0.6958	1.15	0.58	2.28
	C vs. B	0.5368	0.3465	0.1216	1.71	0.87	3.38

The results were presented as number of positive samples/number of total samples (n/N), prevalence, and 95% confidence intervals. Samples: RS, CSAD, CSAS, PS.

CI, confidence interval; CSAD, carcass swabs after dehairing; CSAS, carcass swabs after splitting; OR, odds ratio; PS, pork samples; RS, rectal swabs; SE, standard error.

ST distribution

An overall of 177 Salmonella isolates were subject to further characterizations, and the results are presented in Supplementary Table S2. As described in Table 4, the strains were classified into 17 STs and 13 serotypes. A strong correlation between ST and serotype was observed. ST40, ST469, and ST34 correspond to serovars Derby, Rissen and Typhimurium, respectively. ST40, ST469, and ST34 were the most frequent STs accounting for 44.6% (79/177), 31.1% (55/177), and 13.6% (24/177) of the isolates, respectively. Two novel STs, STN1 and STN2, were identified. Cluster analysis showed that STN1 was the single-locus variant of ST469, while STN2 was a distinct ST. The most frequent STs were ST40 (34/61, 55.7%) and ST469 (22/61, 36.1%) for abattoir A, ST469 (31/64, 48.4%) and ST40 (17/64, 26.6%) for abattoir B, and ST40 (30/52, 57.7%) and ST34 (16/52, 30.8%) for abattoir C. The proportion of ST40 strains for abattoir B was significantly lower than that for abattoir A (p = 0.001) or C (p = 0.004), while it was not significantly different between abattoirs A and C (p = 0.840). The proportion of ST469 strains for abattoir C (2/52, 3.9%) was significantly lower than that for abattoir A (22/61, 36.1%) (p = 0.000) or B (31/64, 48.4%) (p = 0.000), while it was not significantly different between abattoirs A and B (p = 0.162). The proportion of ST34 strains for abattoir C (16/52, 30.8%) was significantly higher than that for abattoir A (1/61, 1.6%) (p = 0.000) or B (7/64, 10.9%) (p = 0.008), while no significant difference was observed between abattoirs A and B (p = 0.079).

Table 4.

Distribution of Sequence Types and Serotypes of the Salmonella Isolates from Each Abattoir (Number of Isolates)

ST	Serotype	Abattoir A					Abattoir B					Abattoir C					Total
ST	Serotype	RS	CSAD	CSAS	PS	Total	RS	CSAD	CSAS	PS	Total	RS	CSAD	CSAS	PS	Total	Total
40	Derby	7 (3 + 4)	3 (3 + 0)	12 (8 + 4)	12 (6 + 6)	34 (20 + 14)	8 (8 + 0)	4 (4 + 0)	5 (4 + 1)		17 (16 + 1)	10 (1 + 9)	9 (6 + 3)	5 (1 + 4)	4 (1 + 3)	28 (9 + 19)	79 (45 + 34)
469	Rissen	8 (2 + 6)	4 (2 + 2)	7 (0 + 7)	3 (0 + 3)	22 (4 + 18)	6 (1 + 5)	1 (0 + 1)	16 (7 + 9)	8 (1 + 7)	31 (9 + 22)		2 (0 + 2)			2 (0 + 2)	55 (13 + 42)
34	Typhimurium				1 (0 + 1)	1 (0 + 1)	4 (0 + 4)	1 (1 + 0)		2 (0 + 2)	7 (1 + 6)	7 (7 + 0)		2 (2 + 0)	7 (7 + 0)	16 (16 + 0)	24 (17 + 7)
1628	Chester													4 (0 + 4)	1 (0 + 1)	5 (0 + 5)	5 (0 + 5)
32	Mantis									1 (0 + 1)	1 (0 + 1)						2 (0 + 2)
32	Virchow			1 (0 + 1)		1 (0 + 1)											2 (0 + 2)
29	Stanley								1 (1 + 0)								1 (1 + 0)
155	London							1 (1 + 0)									1 (1 + 0)
64	Anatum						1 (1 + 0)										1 (1 + 0)
71	Abony	1 (1 + 0)															1 (1 + 0)
1543	Tumodi							1 (1 + 0)									1 (1 + 0)
1498	Eastbourne									1 (1 + 0)							1 (1 + 0)
463	Newlands			1 (1 + 0)													1 (1 + 0)
19	Typhimurium						1 (1 + 0)										1 (1 + 0)
36	Typhimurium							1 (1 + 0)									1 (1 + 0)
7	NI												1 (0 + 1)				1 (0 + 1)
N1	Rissen	1 (1 + 0)															1 (1 + 0)
N2	NI									1 (1 + 0)							1 (1 + 0)
Total		17 (7 + 10)	7 (5 + 2)	21 (9 + 12)	16 (6 + 10)	61 (27 + 34)	20 (11 + 9)	9 (8 + 1)	22 (12 + 10)	13 (3 + 10)	64 (34 + 30)	17 (8 + 9)	12 (6 + 6)	11 (3 + 8)	12 (8 + 4)	52 (25 + 27)	177 (86 + 91)

The numbers in the bracket before and after “+” represent the numbers of positive samples collected in the first visit in April and in the second visit in October, respectively.

CSAD, carcass swabs after dehairing; CSAS, carcass swabs after splitting; NI, not identified; PS, pork samples; RS, rectal swabs; ST, sequence type.

No significant difference was observed in the proportion of ST40 strains and the proportion of ST469 strains among four sample types (p > 0.05). However, the proportions of ST34 strains for RS (20.4%, 11/54) and PS (24.4%, 10/41) were both significantly higher than those for CSAD (3.6%, 1/28) and CSAS (3.7%, 2/54) (p < 0.05).

Salmonella antimicrobial susceptibility among the three abattoirs

As shown in Table 5, of the 177 Salmonella isolates, 171 isolates (96.6%) exhibited resistance to at least one of the antimicrobials, 134 (75.7%) were resistant to three or more antimicrobials, and 47 (26.6%) were resistant to seven or more antimicrobials. The highest resistance proportion was to TET (164/177, 92.7%), and the lowest was to CEF (25/177, 14.1%).

Table 5.

Number and Proportion of Resistant Salmonella Isolates

	No. (and proportion) of strains resistant to
	≥1	≥3	≥7 drugs	AMP	AMC	CEF	GEN	TET	SXT	CIP	CHL
Total (n = 177)	171 (96.6%)	134 (75.7%)	47 (26.6%)	128 (72.3%)	53 (29.9%)	25 (14.1%)	103 (58.2%)	164 (92.7%)	136 (76.8%)	88 (49.7%)	111 (62.7%)
Abattoirs
A (n = 61)	55 (90.2%)^b	29 (47.5%)^b	2 (3.3%)^b	23 (37.7%)^b	12 (19.7%)^b	1 (1.6%)^b	35 (57.4%)^b	50 (82.0%)^b	36 (59.0%)^c	4 (6.6%)^c	17 (27.9%)^c
B (n = 64)	64 (100.0%)^a	58 (90.6%)^a	22 (34.4%)^a	56 (87.5%)^a	32 (50.0%)^a	5 (7.8%)^b	27 (42.2%)^c	64 (100.0%)^a	60 (93.8%)^a	42 (65.6%)^b	48 (75.0%)^b
C (n = 52)	52 (100.0%)^a	47 (90.4%)^a	23 (44.3%)^a	49 (94.3%)^a	9 (17.3%)^b	19 (36.5%)^a	41 (78.9%)^a	50 (96.2%)^a	40 (76.9%)^b	42 (80.8%)^a	46 (88.5%)^a
Samples
RS (n = 54)	54 (100.0%)^a	46 (85.2%)^a	19 (35.2%)^a	45 (83.3%)^a	16 (29.6%)^ab	10 (18.5%)^ab	35 (64.8%)^b	54 (100.0%)^a	51 (94.4%)^a	35 (64.8%)^a	42 (77.8%)^a
CSAD (n = 30)	29 (96.7%)^ab	20 (66.7%)^b	5 (16.7%)^b	20 (66.7%)^b	6 (20.0%)^b	2 (6.7%)^b	12 (40.0%)^c	27 (90.0%)^b	18 (60.0%)^b	8 (26.7%)^b	19 (63.3%)^a
CSAS (n = 52)	47 (90.4%)^b	34 (65.4%)^b	4 (7.7%)^b	33 (63.5%)^b	15 (28.9%)^qb	3 (5.8%)^b	23 (44.2%)^c	45 (86.5%)^b	31 (59.6%)^b	22 (42.3%)^b	23 (44.2%)^b
PS (n = 41)	41 (100.0%)^a	34 (82.9%)^a	19 (46.3%)^a	30 (73.2%)^ab	16 (39.0%)^a	10 (24.4%)^a	33 (80.5%)^a	38 (92.7%)^b	36 (87.8%)^a	23 (56.1%)^ab	27 (65.9%)^a
Major STs
ST40 (n = 79)	73 (92.4%)^b	57 (72.2%)^b	7 (8.9%)^c	53 (67.1%)^b	19 (24.1%)^b	3 (3.8%)^c	42 (53.2%)^b	69 (87.3%)^a	56 (70.9%)^b	35 (44.3%)^b	44 (55.7%)^b
ST34 (n = 24)	24 (100.0%)^ab	24 (100.0%)^a	22 (91.7%)^a	24 (100.0%)^a	7 (29.2%)^ab	16 (66.7%)^a	23 (95.8%)^a	24 (100.0%)^a	24 (100.0%)^a	22 (91.7%)^a	23 (95.8%)^a
ST469 (n = 55)	55 (100.0%)^a	38 (69.1%)^b	15 (27.3%)^b	37 (67.3%)^b	20 (36.4%)^a	6 (10.9%)^b	31 (56.4%)^b	52 (94.6%)^a	42 (76.4%)^b	21 (38.2%)^b	29 (52.7%)^b

Antimicrobial agents: AMP, AMC, CEF, GEN, TET, SXT, CIP, and CHL. Different superscript letters represented the significant difference among Salmonella isolates from different abattoirs (A, B, and C), or recovered from different pig samples (RS, CSAD, CSAS, and PS), or belonging to different STs, respectively. The level of statistical significance was established at p ≤ 0.05.

AMC, amoxicillin/clavulanic acid; AMP, ampicillin; CEF, cefotaxime; CHL, chloramphenicol; CIP, ciprofloxacin; GEN, gentamicin; SXT, sulfamethoxazole/trimethoprim; TET, tetracycline; CSAD, carcass swabs after dehairing; CSAS, carcass swabs after splitting; PS, pork samples; RS, rectal swabs; STs, sequence types.

The proportions of AMR and MDR strains for abattoir A (55/61, 90.2% for AMR, and 29/61, 27.5% for MDR) were both significantly lower than those for abattoirs B (64/64, 100.0% for AMR, and 58/64, 90.6% for MDR) and C (52/52, 100.0% for AMR, and 47/52, 90.4% for MDR) (p < 0.05). The proportions of isolates resistant to AMP, TET, SXT, CIP, and CHL for abattoir A were all significantly lower than those for abattoirs B and C (p < 0.05). The isolates from abattoir A exhibited a significantly lower resistance proportion in amoxicillin/clavulanate than those from abattoir B (p < 0.05), and in GEN and CEF than those from abattoir C (p < 0.05). In comparison with those for abattoir C, the proportions of resistant isolates for abattoir B were significantly lower in CEF, GEN, CIP, and CHL (p < 0.05), and significantly higher in amoxicillin/clavulanate and SXT (p < 0.05). A total of 39 different AMR patterns were identified for all the isolates. The most common AMR pattern for abattoir A was TET-SXT (36/61, 59.0%), while it was AMP-AMC-GEN-TET-SXT-CIP-CHL (17/64, 26.6%) and AMP-CEF-GEN-TET-SXT-CIP-CHL (18/52, 34.6%) for abattoirs B and C, respectively.

Next we compared the antimicrobial resistance of the isolates from different sample types. The strains recovered from both RS (46/54, 85.2%) and PS (34/41, 82.9%) exhibited significantly higher MDR proportions than CSAD (20/30, 66.7%) and CSAS (34/52, 65.4%) (p < 0.05), especially the proportion of resistance to 7–8 drugs (p < 0.05). In comparison with ones recovered from CSAD and CSAS, the strains recovered from RS exhibited significantly higher resistance proportions in AMP, GEN, TET, CIP, and SXT (p < 0.05), and the isolates recovered from PS exhibited significantly higher resistance proportions in CEF, GEN, and SXT (p < 0.05). A significant difference was observed between the isolates recovered from RS and PS only in the resistance to GEN and TET (p < 0.05).

Finally, we analyzed the difference in antimicrobial resistance among the isolates of three most commonly detected STs. Interestingly, the ST34 isolates (24/24, 100.0%) exhibited a significantly higher MDR proportion than the ST40 (57/79, 72.2%) (p = 0.004) and ST469 (38/55, 69.1%) isolates (p = 0.002), as well as the resistance to all the tested antimicrobials, but TET and amoxicillin/clavulanate (p < 0.05).

Discussion

Pork contamination by bacterial pathogens may come from the whole pork production chain. Cross-contamination and inadequate disinfection in the slaughtering environment have been recognized as major contributors to the contamination of Salmonella on pork and carcasses (Duggan et al., 2010; Arguello et al., 2012; Aslam et al., 2012; Moller et al., 2016; Sanchez-Maldonado et al., 2017). Three commercial pig abattoirs sampled in this study represent the major types of Chinese pork processing enterprises. The overall Salmonella prevalence was 22.9% for all the three abattoirs, and no significant difference was observed between the first visit and the second visit and among the three abattoirs. Among the four sample types, the overall prevalence was the highest in RS, which is consistent with the fact that Salmonella often colonizes the intestines of nonclinical pigs. Compared with the overall prevalence in pork in the E.U. countries where Salmonella surveillance and control programs have been well established (EFSA and ECDC, 2018), a significantly higher prevalence was observed in this study. However, the results in our study revealed a lower contamination level compared with the results reported in similar studies performed in China (Ma et al., 2017; Zhang et al., 2018).

MLST analysis showed that the predominant STs were ST40, ST469, and ST34, corresponding to serovars Derby, Rissen, and Typhimurium, respectively. These results were consistent with the previous findings on prevalence of ST lineages and serotypes of Salmonella in pigs and pork (Valdezate et al., 2005; Duggan et al., 2010; EFSA, 2011; Hauser et al., 2011; Kerouanton et al., 2013; Miao et al., 2017). Among different abattoirs, the most frequently identified ST varies, for example, ST40 is dominant for abattoir A and C, while it is ST469 that is most prevalent in abattoir B.

AMR bacteria may spread along the whole food chain, and pose great threats to animal and human health (Chen et al., 2004; Domenech et al., 2015). In this study, the overall proportion of AMR and MDR strains reached up to 96.6% and 75.7%, respectively, consistent with the similar findings reported in previous studies (Li et al., 2014). The levels and patterns of antimicrobial resistance also vary among strains of different STs. The ST34 isolates possess the highest proportions of strains resistant to all the tested antimicrobials but TET. Moreover, the RS and PS exhibited significantly higher proportions of ST34 strains compared with carcass swab samples. These results indicate that the ST34 strains were mostly derived from the incoming pigs and had a higher risk of being exposed to the antimicrobials. It is worth noting that the proportion of MDR strains from abattoir A was the lowest among the three abattoirs. Further studies need to be performed to investigate whether the low MDR rate is due to stricter monitoring of drug residues in incoming pigs or the reasonable use of antimicrobials during pig husbandry.

The overall resistance proportion in Salmonella isolates from all three abattoirs was the highest for TET and the lowest for CEF. The observations on the AMR prevalence are in accordance with previous reports in the pork production chain (Miranda et al., 2009; Yang et al., 2010; Thai et al., 2012). The high prevalence of resistance to TET and sulfonamides is likely due to the wide use of these antimicrobials in pig farms (Aslam et al., 2012). Furthermore, the proportion of CIP-resistant strains was about 50%, especially high in the strains from RS and PS of abattoirs B (RS: 17/20; pork: 12/13) and C (RS: 14/16; pork: 11/12) (Supplementary Table S1), suggesting that fluoroquinolones had been widely used in pig production and veterinary clinical practice, and could lead to the failure of treating bacterial foodborne diseases. CIP resistance of Salmonella isolates from nonclinical animals had also been reported to rise (Cattoir and Nordmann, 2009; Veldman et al., 2011; de Jong et al., 2012; Jiu et al., 2017). de Jong et al. (2014) reported that coresistance to CIP and CEF in pig Salmonella isolates was rare, but it widely exists as reported in this study, especially in strains from RS (7/7) and PS (7/8) collected from abattoir C in the first visit (Supplementary Table S2), indicating that the incoming animals of abattoir C from small-scale farms were confronted with more selective pressure of extended-spectrum cephalosporins and fluoroquinolones.

Footnotes

Acknowledgments

We thank the official veterinarians at Wuhan Agricultural Comprehensive Law Enforcement Inspector Corps and the technical staff at the three abattoirs for the help in sampling. Also, we thank Dr. Chao Wang for the statistical analysis of the epidemiological results.

Disclosure Statement

No competing financial interests exist.

Funding Information

This work was financially supported by the National Key Research and Development Program of China (2018YFD0500500) and the Special Fund for Agro-scientific Research in the Public Interest in China (201403054).

Supplementary Material

Supplementary Table S1

Supplementary Table S2

References

Achtman

, Wain

, Weill

, Nair

, Zhou

, Sangal

, Krauland

, Hale

, Harbottle

, Uesbeck

, Dougan

, Harrison

, Brisse

, the S. enterica MLST study group. Multilocus sequence typing as a replacement for serotyping in Salmonella enteric . Plos Pathog, 2012; 8:e1002776.

Arguello

, Carvajal

, Collazos

, García-Feliz

, Rubio

. Prevalence and serovars of Salmonella enterica on pig carcasses, slaughtered pigs and the environment of four Spanish slaughterhouses. Food Res Int, 2012; 45:905–912.

Aslam

, Checkley

, Avery

, Chalmers

, Bohaychuk

, Gensler

, Reid-Smith

, Boerlin

. Phenotypic and genetic characterization of antimicrobial resistance in Salmonella serovars isolated from retail meats in Alberta, Canada. Food Microbiol, 2012; 32:110–117.

Boyen

, Haesebrouck

, Maes

, Van Immerseel

, Ducatelle

, Pasmans

. Non-typhoidal Salmonella infections in pigs: A closer look at epidemiology, pathogenesis and control. Vet Microbiol, 2018; 130:1–19.

Cattoir

, Nordmann

. Plasmid-mediated quinolone resistance in gram-negative bacterial species: An update. Curr Med Chem, 2009; 16:1028–1046.

Chen

, Zhao

, White

, Schroeder

, Lu

, Yang

, McDermott

, Ayers

, Meng

. Characterization of multiple-antimicrobial-resistant Salmonella serovars isolated from retail meats. Appl Environ Microbiol, 2004; 70:1–7.

CLSI. Performance standards for antimicrobial disk and dilution susceptibility tests for bacterial isolated from animals; approved standard-fourth edition.VET01-A4. Wayne, PA: Clinical and Laboratory Standards Institute, 2013.

de Jong

, Smet

, Ludwig

, Stephan

, de Graef

, Vanrobaeys

, Haesebrouck

. Antimicrobial susceptibility of Salmonella isolates from healthy pigs and chickens (2008–2011). Vet Microbiol, 2014; 171:298–306.

de Jong

, Stephan

, Silley

. Fluoroquinolone resistance of Escherichia coli and Salmonella from healthy livestock and poultry in the EU. J Appl Microbiol, 2012; 112:239–245.

10.

Domenech

, Jimenez-Belenguer

, Perez

, Ferrus

, Escriche

. Risk characterization of antimicrobial resistance of Salmonella in meat products. Food Control, 2015; 57:18–23.

11.

Duggan

, Mannion

, Prendergast

, Leonard

, Fanning

, Gonzales-Barron

, Egan

, Butler

, Duffy

. Tracking the Salmonella status of pigs and pork from lairage through the slaughter process in the Republic of Ireland. J Food Prot, 2010; 73:2148–2160.

12.

EFSA. Analysis of the baseline survey on the prevalence of Salmonella in holdings with breeding pigs, in the EU, 2008—Part B: Factors associated with Salmonella pen positivity. EFSA J, 2011; 9:2329.

13.

European Food Safety Authority and European Centre for Disease Prevention and Control (EFSA and ECDC). The European Union summary report on trends and sources of zoonoses, zoonotic agents and food-borne outbreaks in 2017. EFSC J, 2018; 16:5500.

14.

Gal-Mor

, Boyle

, Grassl

. Same species, different diseases: How and why typhoidal and non-typhoidal Salmonella enterica serovars differ. Front Microbiol, 2014; 5:391.

15.

Galanis

, Lo Fo Wong

, Patrick

, Binsztein

, Cieslik

, Chalermchikit

, Aidara-Kane

, Ellis

, Angulo

, Wegener

. Web-based surveillance and global Salmonella distribution, 2000–2002. Emerg Infect Dis, 2006; 12:381–388.

16.

GB4789.4-2010. National food safety standard. Food microbiological examination: Salmonella . Department of Health in P. R. China. 2010. (in Chinese).

17.

Grimont

PAD

, Weill

. Antigenic Formulae of the Salmonella Serovars. World Health Organization Reference and Research on Salmonella (9th ed.). Paris: Institut Pasteur, 2007.

18.

Hauser

, Hebner

, Tietze

, Helmuth

, Junker

, Prager

, Schroeter

, Rabsch

, Fruth

, Malorny

. Diversity of Salmonella enterica serovar Derby isolated from pig, pork and humans in Germany. Int J Food Microbiol, 2011; 151:141–149.

19.

Jiu

, Zhu

, Khan

, Sun

, Zou

, Meng

, Wu

, Zhou

, Li

. Phenotypic and genotypic resistance of Salmonella isolates from healthy and diseased pigs in China during 2008–2015. Microb Drug Resist, 2017; 23:651–659.

20.

Kerouanton

, Rose

, Weill

, Granier

, Denis

. Genetic diversity and antimicrobial resistance profiles of Salmonella enterica serotype Derby isolated from pigs, pork, and humans in France. Foodborne Pathog Dis, 2013; 10:977–984.

21.

Le Bas

, Hann

, Thanh

, Thuong

, Thuy

. Prevalence and epidemiology of Salmonella spp. in small pig abattoirs of Hanoi, Vietnam. Ann N Y Acad Sci, 2006; 1081:269–272.

22.

, Pan

, Kang

, Geng

, Liu

, Cai

, Jiao

. Prevalence, characteristics, and antimicrobial resistance patterns of Salmonella in retail pork in Jiangsu province, eastern China. J Food Prot, 2014; 77:236–245.

23.

, Lei

, Kong

, Jiang

, Liu

, Men

, Yang

, Cheng

, Chen

, Wang

. Prevalence, antimicrobial resistance, and relatedness of Salmonella isolated from chickens and pigs on farms, abattoirs, and markets in Sichuan province, China. Foodborne Pathog Dis, 2017; 14:667–677.

24.

Miao

, Li

, Qin

, Zhou

. Prevalence and antimicrobial resistance of Salmonella isolates recovered from retail pork in major village markets in Tai'an region, China. J Food Prot, 2017; 80:1635–1640.

25.

Miranda

, Mondragon

, Martinez

, Guarddon

, Rodriguez

. Prevalence and antimicrobial resistance patterns of Salmonella from different raw foods in Mexico. J Food Prot, 2009; 72:966–971.

26.

Moller

, Sant'Ana

, Hansen

, Nauta

, Silva

, Alvarenga

, Maffei

, Silva

, Lopes

, Franco

, Aabo

, Hansen

. Evaluation of a cross contamination model describing transfer of Salmonella spp. and Listeria monocytogenes during grinding of pork. Int J Food Microbiol, 2016; 226:42–52.

27.

Naas

, Oxacelay

, Nordmann

. Identification of CTX-M-type extended-spectrum-beta-lactamase genes using real-time PCR and pyrosequencing. Antimicrob Agents Ch, 2007; 51:223–230.

28.

Rahn

, de Grandis

, Clarke

, McEwen

, Galan

, Ginocchio

, Curtiss

3rd , Gyles

. Amplification of an invA gene sequence of Salmonella typhimurium by polymerase chain reaction as a specific method of detection of Salmonella . Mol Cellular Probes,, 1992; 6:271–279.

29.

Ross

T.D

. Accurate confidence intervals for binomial proportion and Poisson rate estimation. Comput Biol Med, 2003; 33:509–531.

30.

Sammarco

, Ripabelli

, Ruberto

, Iannitto

, Grasso

. Prevalence of Salmonellae, Listeriae, and Yersiniae in the slaughterhouse environment and on work surfaces, equipment, and workers. J Food Prot, 1997; 60:367–371.

31.

Sanchez-Maldonado

, Aslam

, Service

, Narváez-Bravo

, Avery

, Johnson

, Jones

. Prevalence and antimicrobial resistance of Salmonella isolated from two pork processing plants in Alberta, Canada. Int J Food Microbiol, 2017; 241:49–59.

32.

Thai

, Hirai

, Lan

, Yamaguchi

. Antibiotic resistance profiles of Salmonella serovars isolated from retail pork and chicken meat in North Vietnam. Int J Food Microbiol, 2012; 156:147–151.

33.

Valdezate

, Vidal

, Herrera-Leon

, Pozo

, Rubio

, Usera

, Carvajal

, Echeita

. Salmonella Derby clonal spread from pork. Emerg Infect Dis, 2005; 11:694–698.

34.

Veldman

, Cavaco

, Mevius

, Battisti

, Franco

, Botteldoorn

, Bruneau

, Perrin-Guyomard

, Cerny

, De Frutos Escobar

, Guerra

, Schroeter

, Gutierrez

, Hopkins

, Myllyniemi

, Sunde

, Wasyl

, Aarestrup

. International collaborative study on the occurrence of plasmid-mediated quinolone resistance in Salmonella enterica and Escherichia coli isolated from animals, humans, food and the environment in 13 European countries. J Antimicrob Chemoth, 2011; 66:1278–1286.

35.

World Health Organization. WHO Estimates of the Global Burden of Foodborne Diseases. World Health Organization, 2015. https://apps.who.int/iris/handle/10665/199350. Accessed February 26, 2020 .

36.

Yang

, Qu

, Zhang

, Shen

, Cui

, Shi

, Xi

, Sheng

, Zhi

, Meng

. Prevalence and characterization of Salmonella serovars in retail meats of marketplace in Shaanxi, China. Int J Food Microbiol, 2010; 141:63–72.

37.

Zhang

, Fu

, Xiong

, Ma

, Wei

, Qu

, Zhang

, Liao

. Highly prevalent multidrug-resistant Salmonella from chicken and pork meat at retail markets in Guangdong, China. Front Microbiol, 2018; 9:2104.

Supplementary Material

Please find the following supplemental material available below.

For Open Access articles published under a Creative Commons License, all supplemental material carries the same license as the article it is associated with.

For non-Open Access articles published, all supplemental material carries a non-exclusive license, and permission requests for re-use of supplemental material or any part of supplemental material shall be sent directly to the copyright owner as specified in the copyright notice associated with the article.

0.00 MB

0.02 MB

0.03 MB