Presence of Foodborne Pathogens in Seafood and Risk Ranking for Pathogens

Abstract

This study aims at examining the contamination of coliform bacteria, Escherichia coli, Listeria monocytogenes, Vibrio vulnificus, and Vibrio cholerae, which carry extremely serious risks to the consumer health, in 700 seafood belonging to 4 different (raw sea fish, raw mussels, raw shrimp, and raw squid) categories. The total number of samples was determined as 700. When the obtained results were viewed in total, they were found to be 48.14%, 18.71%, 8.57%, and 3.42% for coliform bacteria, E. coli, L. monocytogenes, and V. vulnificus, respectively. V. cholerae, one of the factors studied, was not found. Conventional microbiological cultivation methods were used in the analysis stage as well as the real-time PCR method. This study aims at making a risk ranking modeling for consumer health based on product category and pathogens by interpreting the results of the analysis with statistical methods. According to the statistical analysis, significantly binary correlations were determined among some parameters that stimulate one another for reproducing. In the light of the obtained results of the study, it has been concluded that the studies of the most detailed examinations of the microbiological risks associated with seafood, forms of microbial pollution and microorganisms that cause deterioration in seafood and threaten consumer health and the path that their epidemiologies follow, are of primary importance to both protecting consumer health and obtaining safe and quality seafood.

Introduction

Seafood is of great importance for nutrition all over the world. The microbiological quality of seafood can vary greatly depending on environmental conditions, microbiological quality of water, water temperature, salinity, distance to residential areas where pollution exists, natural bacterial flora in water, food consumed by fish, fishing methods, and cooling conditions (Feldhusen, 2000; Cheng et al., 2015). It is known that in the quality problems related to fish and other seafood, the main differences, examined by looking at the deterioration of other protein group foods, are caused by the existence of great amounts of lipid compositions, heat-resistant muscle proteins, and proteolytic enzymes. These negative biochemical reactions are temperature dependent and, therefore, low-temperature applications are effectively preventing the deterioration of these reactions in fish and seafood (Jaczynski et al., 2012). Based on the reported cases, there is substantial evidence that fish and fish products can cause a variety of foodborne diseases (Vogel, 2009). It has been identified as the fastest-growing food sector in the world by the FAO (Food and Agriculture Organization). Fish consumption decreases the mortality rate due to coronary heart disease in the adult population. However, health risks associated with certain chemical and biological pollutants likely to be present in fish and other seafood have been documented (FAO, 2018). Consequently, since seafood and especially fish are susceptible to secondary contamination, the purchasing stage, the treatments during the preparation process, and consumers' compliance with the consumption rules are very important for food safety. The consumers' poor seafood consuming habits and their shopping habits that may adversely affect food safety are risk factors. To minimize the risks and to maximize nutritional benefits, risk factors need to be taken into account and eliminated. Feeding habits vary due to cultures of the countries across the world. People in many countries consume ready-to-eat and raw food, including seafood, and this situation may cause serious risks for the consumers' health if the seafoods are produced under poor hygienic conditions (Mizan et al., 2015).

Materials and Methods

Sampling

The samples of different types of seafood to be collected for analysis in terms of determined microbiological parameters were transferred to the laboratory following the cold chain standards and were analyzed in the laboratory on the day after the collection process. For this purpose, a total of 700 samples of 4 different types (raw sea fish, raw mussels, raw shrimp, and raw squid) were collected from different points of sale (400 samples from raw fish samples and 100 samples from each other category). During the sampling process, fish wholesale market, fish market, fish hawker, and bazaar were scanned as sales points (50 samples from each point of sale category for each raw sea fish species). Gilt-head sea bream, sea bass, bluefish, or horse mackerel/50 samples for each fish species, which are frequently consumed by consumers, were preferred for sampling. Only raw fish samples consist of Sparus aurata, Dicentrarchus labrax, Pomatomus saltatrix, and Trachurus mediterraneus species caught in the Marmara sea (Table 1). During sampling protocol, consumable parts of all the samples were analyzed microbiologically for the chosen parameters. For this purpose, internal organs were removed for the raw fish but skins and muscles were analyzed. For the mussels and shrimps, inner parts that can be eaten by the consumers were chosen for the microbiological analysis. For the shrimps, internal organs were removed.

Table 1.

Details of the Collected Samples

table>

Microbiological analyses

Listeria monocytogenes

Listeria monocytogenes: 25-g samples were transferred into 225-mL Buffered Listeria Enrichment Broth Base (BLEB) (Merck, Germany), incubated at 30°C for 4 h, and finally supplemented with selective agents and 25 mg/L natamycin in media at 48°C for 48 h. At the 24th hour of incubation, Oxford Agar (Merck, Germany) and Palcam Agar (Merck, Germany) were passaged and incubated for 48 h at 35°C. At the end of the 48th hours of incubation, passage was made to the Chromogenic Listeria Agar Base (Merck, Germany), one of the L. monocytogenes/ivanovii differential selective agar. Listeria spp. cultures were purified by passage of susceptible Trypticase anagen (TSA) (Merck, Germany) agar containing yeast extract. Identification of suspicious isolates was performed by Gram staining, catalase, motility, dextrose, maltose, rhamnose, mannitol, xylose fermentation, esculin hydrolysis, and nitrate reduction (FDA, 2001).

Total Coliforms

Total coliforms were isolated by surface plating on violet red bile agar (Merck, Germany). Plates were incubated at 37°C for 24 h (Hitchins et al., 2000).

Escherichia coli

E. coli were examined by surface plating on TBX Agar (Merck, Germany). Plates were incubated at 44°C for 24 h for enumeration (FDA, 2001).

Vibrio vulnificus

Each 25 g of sample was pre-enriched in 225 mL of alkaline peptonated water (APW) and incubated at 35–37°C for 6–8 h. Then, pre-enriched samples were passed to Thiosulfate Citrate Bile Salts Sucrose Agar (TCBSA), Vibrio Vulnificus Agar (VVA), Vibrio Vulnificus Enumeration Agar (VVEA), and Cellobiose Colistin Agar (CCA) in parallel by the surface plating method. CCA was incubated at 40°C whereas the other agars were incubated at 37°C for 24 h. After the incubation period, green colonies on TCBSA, dark gray centered colonies on VVA, blue colonies with zones on SPSA, blue–green colonies on VVEA, and yellow colonies on CCA were evaluated as positive. Because of unclear biochemical reactions and behaviors of Vibrio vulnificus there are different opinions declared by different researchers. Because of this reason in this study biochemical tests were not applied to the isolates (Harwood et al., 2004).

Vibrio cholerae

Each 25 g of sample was pre-enriched in 225-mL APW and incubated at 35–37°C for 6–8 h. Then, pre-enriched samples were passed to TCBSA, which is selective agar for Vibrio cholerae, and incubated at 37°C for 24 h. V. cholerae has hemolytic activity. For this reason, all the samples were also passed to Blood Agar (BA) and they were incubated at 37°C for 24 h. Hemolytic colonies with 2–3-cm diameter, bright yellow colonies on TCBSA were evaluated as suspected. For identification, oxidase test (+), string test (+), Triple Sugar Iron Agar (TSIA) (yellow bottom and red surface, acid/alkali, no gas formation), lysine decarboxylation (+), Gram staining (Gram-negative, small bacillus), and O129 disk sensitivity (most Vibrio species are sensitive) were applied to the suspected samples (CDC, 1999).

Molecular method

DNA extraction

PCR mixture was as follows: 2 mL DNA sample, 2.5 mM MgCl₂, 10 mM Tris–HCl pH 8.0, 5 mM KCl (0.2 mM for each nucleotide), for each primer 0.8 rmol/mL, and 1 U of Taq DNA polymerase (final 25 μL). Amplification procedures were performed according to Cerit and Aroguz (2017). Initial denaturation temperature was 94°C for 5 min. Then, for denaturation 94°C for 1 s and afterward 55°C for 1 s for binding of primers and 72°C for 21 s for elongation was applied (35 cycles in total). Finally, for the last elongation process 72°C for 21 s heat treatment was applied to the products and PCR protocol was completed.

Polymerase chain reaction

Table 2 depicts the species-specific primer sets used during the real-time PCR procedure (Cerit and Aroguz, 2017).

Table 2.

Specific Primer Sets That Were Used in the Study
City	District	Sample type	Sales point type	No. of samples	Explanation
İstanbul<	Europe	Raw fish (gilt-head sea bream, sea bass, bluefish, horse mackerel/50 samples for each fish species)	Fish wholesale market/fish market/fish hawker/bazaar	200	Unpackaged, with ice, ready-to-eat
İstanbul	Europe	Raw mussel	Fish wholesale market/fish market/fish hawker	50	Unpackaged, with ice, ready-to-eat
İstanbul	Europe	Raw shrimp	Fish wholesale market/fish market	50	Unpackaged, with ice, ready-to-eat
İstanbul	Europe	Raw squid	Fish wholesale market/fish market	50	Unpackaged, with ice, ready-to-eat
İstanbul	Anatolia	Raw fish (gilt-head sea bream, sea bass, bluefish, horse mackerel/50 samples for each fish species)	Fish wholesale market/fish market/fish hawker/bazaar	200	Unpackaged, with ice, ready-to-eat
İstanbul	Anatolia	Raw mussel	Fish wholesale market/fish market/fish hawker	50	Unpackaged, with ice, ready-to-eat
İstanbul	Anatolia	Raw shrimp	Fish wholesale market/fish market	50	Unpackaged, with ice, ready-to-eat
İstanbul	Anatolia	Raw squid	Fish wholesale market/fish market	50	Unpackaged, with ice, ready-to-eat

Primer no.	Sequence (5′-3′)	Target gene/Amp (bp)	Target pathogen
1	GCTGATTTAAGAGATAGAGGAACA	actA/827	Listeria monocytogenes
1	TTTATGTGGTTATTTGCTGTC	actA/827	Listeria monocytogenes
2	CAATTTTCGTGTCCCCTTCG	23S/450	Escherichia coli
2	GTTAATGATAGTGTGTCGAAAC	23S/450	Escherichia coli
3	GGATCACAAAATGAAAAAATTAGTCG	vvbfp/720	Vibrio vulnificus
3	CGTTGTTGACTAATACGT CC	vvbfp/720	Vibrio vulnificus
4	CGGCGTGGCTGGATACATTG	tdh or trh/389	Vibrio cholerae
4	GTCACACTTAAATAGAGGTCC	tdh or trh/389	Vibrio cholerae

All of the obtained data were analyzed by the SPSS statistics program (IBM SPSS Statistics Version 18). Numerical variables are represented by numbers (n) and percent (%). Risk ranking of the factors examined in the study was evaluated by Kendall's Tau-b analysis method. The confidence interval was 95% in all analyses, and the results were assumed to be statistically significant for p < 0.005.

Results

According to the results, 337 (48.14%) of the total of 700 seafood products analyzed were found to be contaminated with Coliform bacteria. Of the total samples, 131 (18.71%) samples were contaminated with Escherichia coli, 60 (8.57%) samples with L. monocytogenes, and 24 (3.42%) samples with V. vulnificus. V. cholerae was not found among the samples examined. The number of positive samples for coliform bacteria for raw fish, raw mussels, raw shrimp, and raw squid were 210 (52.5%), 47 (47%), 41 (41%), and 39 (39%), respectively. The number of positive samples for E. coli for raw fish, raw mussels, raw shrimp, and raw squid were 67 (16.75%), 21 (21%), 24 (24%), and 19 (19%), respectively. The number of positive samples for L. monocytogenes for raw fish, raw mussels, raw shrimp, and raw squid were 29 (7.25%), 16 (16%), 11 (11%), and 4 (4%), respectively. The number of positive samples for V. vulnificus for raw fish, raw mussels, raw shrimp, and raw squid were 11 (2.75%), 9 (9%), 4 (4%), and 0 (0%), respectively (Table 3).

Table 3.

Rate of Contamination with Pathogens of the Analyzed Samples

Sample type	Sample number (n)	Pathogens	No. of positive samples, n (%)
Raw sea fish	400	Coliform bacteria	210 (52.5)
		Escherichia coli	67 (16.75)
		Listeria monocytogenes	29 (7.25)
		Vibrio vulnificus	11 (2.75)
		Vibrio cholerae	0 (0)
Raw mussels	100	Coliform bacteria	47 (47)
		E. coli	21 (21)
		L. monocytogenes	16 (16)
		V. vulnificus	9 (9)
		V. cholerae	0 (0)
Raw shrimp	100	Coliform bacteria	41 (41)
		E. coli	24 (24)
		L. monocytogenes	11 (11)
		V. vulnificus	4 (4)
		V. cholerae	0 (0)
Raw squid	100	Coliform bacteria	39 (39)
		E. coli	19 (19)
		L. monocytogenes	4 (4)
		V. vulnificus	0 (0)
		V. cholerae	0 (0)

Since V. cholerae was not detected in any sample in the study, the factor was excluded from the evaluation. Numbers written in bold characters are statistically significant (p < 0.005). The significance is that for each binary parameter it stimulates the reproduction of the other. There is a correlation between both significant parameters (Table 4).

Table 4.

Demonstration of the Dual Correlation Connections of the Samples Analyzed in This Study in Terms of the Factors Examined by Kendall's Tau-b Correlation Analysis Method

Pathogens	Correlation	Listeria monocytogenes	Coliform bacteria	Escherichia coli	Vibrio vulnificus
L. monocytogenes	Correlation coefficient	1.000	0.312	0.466	0.701
L. monocytogenes	Sig. (two-tailed)	—	0.000	0.000	0.003
Coliform bacteria	Correlation coefficient	0.286	1.000	0.584	0.556
Coliform bacteria	Sig. (two-tailed)	0.000	—	0.000	0.004
E. coli	Correlation coefficient	0.743	0.490	1.000	0.202
E. coli	Sig. (two-tailed)	0.003	0.004	—	0.000
V. vulnificus	Correlation coefficient	0.699	0.623	0.401	1.000
V. vulnificus	Sig. (two-tailed)	0.005	0.000	0.000	—

Numbers written in bold characters are statistically significant (p < 0.005).

Discussion

Many fishing products are susceptible to the development of L. monocytogenes during refrigerated storage due to their physicochemical properties, which may result in products exceeding the <100 cfu/g criterion during shelf life (Scallan et al., 2011). Almost all of the studies in the world medical literature for the presence of L. monocytogenes are on different meat products and dairy products, and research on seafood is extremely limited. However, in our study, 8.57% L. monocytogenes was found in different types of raw seafood (60/700 samples). According to the results obtained from the study, L. monocytogenes concentrations in the positive samples varied between 1.2 × 10¹ and 4 × 10² cfu/g. Therefore, it is believed that detailed studies investigating the presence of L. monocytogenes and its effects on potential consumer health in food groups other than meat and dairy products may be beneficial. Studies show that Listeria has the second-highest value after meat with 28% of fresh seafood (Dillon et al., 1992). At the same time, it is reported that some of the seafoods again became a current issue because of the contamination of L. monocytogenes and that these are frozen, canned, cooked crab meat; cooked shrimp; frozen shrimps, fresh and canned frozen combs; smoked salmon; frozen, canned lobster; and surimi products (Dillon et al., 1992). It is known that the lack of an effective lethal application in such products can increase the risk of contamination of foodborne pathogens such as L. monocytogenes (EFSA, 2013). L. monocytogenes was detected in 3 (7.5%) of 40 fresh mussel samples collected from markets in Spain and 2 (1.5%) of 147 shelled samples (apart from oysters) collected in Japan (Ben Embarek, 1994). Fuchs and Sirvas (1991) examined tropical fish and seafood in terms of the presence of L. monocytogenes. It was found that 3 of 10 fresh product samples and 5 of 14 frozen products were contaminated with L. monocytogenes. It was concluded that L. monocytogenes could seriously risk seafood in the light of the information mentioned earlier and the results of our study. In particular, the lack of understanding of the epidemiology of the factor in seafood is considered to increase the risk factors for consumer health.

Coliform bacteria and E. coli are other microbiological factors analyzed in our study. Analysis results showed that different samples were exposed to various degrees of Coliform bacteria and E. coli contamination. According to the results obtained from the study, E. coli concentrations in the positive samples varied between 8 × 10¹ and 2.8 × 10³ cfu/g. E. coli, which is a very important indicator of fecal contamination, can easily be transmitted by contaminated water when the seafood is still in the sea (De Sousa et al., 2002). In recent food-based studies, Coliform bacteria are accepted as fecal contamination indicators because they are more resistant to the freezing process than fecal E. coli, are tolerant to 6.5% salt, and are included in microbiological criteria (Gonzalez et al., 2003). This situation is considered a risky situation in terms of microbiological quality of seafood and consumer health. In a study published by Bhaskar and Shasckindra (2006), shrimps are a group of products that contain pathogens such as Salmonella, Vibrio spp., Listeria spp., Coliform bacteria, and E. coli and should be processed separately from other products to prevent cross-contamination. Kocatepe et al. (2016) compared the E. coli load of the mussels that were sold by both fish hawkers and restaurants, and they declared that no E. coli was detected in the mussels sampled from the restaurants whereas 48 mussel samples were positive for E. coli that were taken from the fish hawkers.

In a study published by the Feldhusen (2000), in Turkey, Staphylococcus aureus, V. cholerae, Salmonella spp., E. coli, and Listeria monocytogenes were reported encountered in frozen shrimp, fish, tuna, and sea snails. The results obtained from our study are similar to those of Feldhusen, and Coliform bacteria, E. coli, L. monocytogenes, and V. vulnificus were detected in different types of seafood analyzed.

Another of the factors studied, Vibrio's species are specific to the aquatic environment and their presence and number are influenced by factors such as temperature, salinity, and algae density (Vogel, 2009). Major human pathogenic Vibrio species are Vibrio parahaemolyticus, V. vulnificus, and V. cholerae. These are important pathogens that cause outbreaks and sporadic diseases associated with consumption of raw or undercooked contaminated seafood. V. vulnificus, which has a strong invasive feature and high pathogenicity among the Vibrios, causes primary septicemia and the mortality rate is ∼37%. Biotype 1 of V. vulnificus is pathogenic for humans through consumption of seafood or wounds, but biotypes 2 and 3 are responsible for wound infection only. These are formed as a result of wounds from cleaning or preparing mussels, crabs, or oysters, or from the contaminated seawater through skin lesions during swimming. V. vulnificus is responsible for ∼96 diseases, 91 hospitalizations, and 35 deaths per year (Scallan et al., 2011; Elbashir et al., 2018). According to the results obtained from our study, V. vulnificus concentrations in positive samples varied between 5 × 10¹ and 2 × 10² cfu/g. V. vulnificus is found in major fish and shellfish species. In addition, V. vulnificus was isolated from raw mussel samples at the highest rates. During the study, most of the raw mussel samples were collected from the fish hawkers. When the pathogenicity of V. vulnificus and possible infection results are taken into account, raw mussels sold uncontrolled by fish hawkers are very serious risk factors for public health. Another important danger related to V. vulnificus is that it does not cause appearance, odor, and taste disturbances in seafood, such as fish, oysters, and mussels from which the agent is isolated. It is estimated that only 1% of actual foodborne disease cases are reported. In many cases, it is difficult to identify both contaminated food and the responsible pathogenic agent. It has been reported that the most identified food in foodborne poisoning outbreaks between 1990 and 2005 is seafood (Vogel, 2009). According to the Foodborne Disease Outbreak Surveillance System (CDC) data, food workers contributed to 25% of outbreaks related to seafood that occurred between 1998 and 2013 (Angelo et al., 2016).

When the correlation connections were examined in terms of the microbiological parameters detected in the examined samples, statistically significant differences were found between each microorganism and the correlation between them (Since V. cholerae was not detected in any sample, it was excluded from the correlation analysis). In other words, the presence of each microorganism had a positive effect on the growth of other pathogens that were found to be positive during the study. It is determined that the positive correlated parameters would seriously increase the risk factor for the consumers if two or more positive correlated agents that were analyzed in the study contaminate the seafoods. In the medical literature in recent years, comparative subproteomic analysis techniques have been developed. In addition, the presence of differential proteins that are capable of interacting with other proteins has been reported in protein-containing food samples of some pathogen isolates (Liu et al., 2006). The findings obtained in our study support this idea.

Conclusions

The contamination of the foodborne pathogens from seafood to humans is frequently reported. However, further studies are also needed to reveal the detailed behaviors of the seafood pathogens and manner of contamination, epidemiology, and genetic structures of the seafood contaminants to maximize the consumers' health. Similar to the world, in our country too, the studies about seafood pathogens that threaten public health unfortunately seem to be inadequate. Due to the reasons mentioned earlier, to create public awareness training of the seafood employees at every stage of production is believed to be very important to decrease the incidence of the seafood pathogens threatening public health. Besides, it is also concluded that the effectiveness of the related government agencies in the seafood production sector is very important. According to the results obtained from the study, the possibility of transfer of the genetic material through this communication is likely to improve the characteristics of microorganisms that may pose risks to consumer health, such as virulence, pathogenicity, and toxicity. Therefore, we anticipate that extremely important measures such as total quality management and good hygiene practices should be meticulously applied at all sales points that sell ready-to-eat food and should be controlled at the ministerial level to minimize the incidence of microbiological/parasitological risk and in terms of consumer health.

Footnotes

Disclosure Statement

No competing financial interests exist.

Funding Information

This study was supported by Istanbul University, Cerrahpasa Scientific Researches Project Unit with the Issue Number 48022.