Prevalence,Antimicrobial Resistance,and Molecular Characterization of Staphylococcus aureus Isolated from Animals,Meats,and Market Environments in Xinjiang,China

Abstract

Staphylococcus aureus has been recognized as an important foodborne pathogen. However, knowledge about the epidemiology and genetic characteristics of S. aureus in the meat production chain from farm to market is limited. The aim of this study was to investigate the genetic characteristics of S. aureus in animal samples isolated from Xinjiang province farms and farmer’ markets, by determining staphylococcal protein A (spa) repeat region and virulence factor typing, and by assessment of antimicrobial resistance. Out of 1324 samples, 128 (9.7%) were positive for S. aureus, 26 (2.0%) of them were identified as methicillin-resistant S. aureus (MRSA) and 88 (6.6%) of them were identified as vancomycin-resistant S. aureus (VRSA). Antimicrobial resistance was determined using the disk diffusion method. S. aureus isolates showed resistance to penicillin G (98.4%), clarithromycin (69.5%), erythromycin (69.5%), vancomycin (68.8%), and tetracycline (67.2%). A total of 80.4% of isolates showed resistance to three or more antimicrobial classes. PCR was used to detect ten virulence genes such as the enterotoxin (sea, seb, and sec), hemolysin (hla and hlb), clumping factor (clfA), and fibronectin-binding proteins A and B (fnbA and fnbB). Our study showed that isolates harbored two or seven virulence genes. All strains encode hla and clfA, and half of them encode hlb and enterotoxin genes. The spa typing results showed that the 128 isolates were grouped into 32 spa types. The main spa types were t127 (22.7%), t2592 (12.5%), t437 (10.9%), and t2616 (10.9%). Notably, isolates of t437 type accounted for 46.2% of the MRSA. Our data indicate that meats in the slaughterhouse and farmers' markets were contaminated with S. aureus. S. aureus virulence genes and spa types were diverse, and its antibiotic resistance was serious. The presence of MRSA and VRSA represents potential public health risks and warrants further investigation regarding the driving factors of such resistance and their transmission to humans.

Introduction

S taphylococcus aureus is an important foodborne pathogen found worldwide. S. aureus lead to severe health problems due to the broad spectrum of virulence factors and the ability to develop antibiotics resistance (Wang et al., 2019). Since the methicillin-resistant S. aureus (MRSA) strain and vancomycin-resistant S. aureus (VRSA) strain identified from a human patient, attentions have been paid to public health significance (Al-Amery et al., 2019). These illnesses may be caused by the ingestion of food containing staphylococcal heat-stable enterotoxins (Tang et al., 2013). Food contaminated with pathogenic bacteria is one of the main causes of digestive illnesses in developing countries and can be counted as one of the major causes for morbidity and mortality (Edwards et al., 2012). The presence of S. aureus in food can be considered an indicator for poor hygiene and considered improper storage conditions (Gammoudi et al., 2019).

Because the use of antimicrobial drugs is poorly controlled, multidrug-resistant S. aureus are frequently isolated from animals (Haftu et al., 2012). The pathogens across a wide range of hosts provide numerous opportunities for sharing their genetic material as meat may be contaminated with Staphylococci spp. during slaughter or later during meat preparation (Doyle et al., 2012). As a result, food and food production may be a vehicle for antibiotic-resistant bacteria transmitting to humans and can further have an impact on public health (Caniça et al., 2019).

Presently, genotyping uses the staphylococcal protein A (spa) typing and multilocus sequence typing of S. aureus isolates to gain insight into their likely origin (Gurjar et al., 2012). Genotyping does not only provide information about the mode of transmission but also can be used to identify virulence factors of the bacteria (Mekonnen et al., 2018). Genetic similarity of isolates from different farms suggests the contagious transmission in the spread of bacteria (Zadoks et al., 2011), whereas a greater variety of genotypes within herds or regions is more suggestive of environmental pathogens (Lam et al., 1997).

The Xinjiang Province is one of China's largest provinces with vast pasture lands and is thus known for the breeding and husbandry of cattle and sheep. To elucidate the relationship between farm, slaughterhouse, and farmers market isolates, and to assess transmission from slaughterhouses to farmers' markets in Xinjiang, we investigated the characteristics of S. aureus from fecal samples, slaughterhouse-linked (carcass and tool) samples, and farmers' market (meat and tool) samples. Describing antimicrobial resistance patterns in foodborne pathogens may contribute to the knowledge on the importance of the issue in Xinjiang and to a more prudent and effective antimicrobial use.

Materials and Methods

Sample collection and S. aureus isolation

From January 2018 to December 2019, 1324 samples (fecal materials, meats, and operation tools) were collected from farms, slaughterhouses, and farmers' markets in four cities (Urumqi, Korla, Changji, Shihezi) in Xinjiang. Table 1 lists the number and types of all the samples. Our sampling method is to comply with the guidelines of Xinjiang Agricultural University's Ethics Committee. These strains were identified according to the methods described in the GB 4789.10-2016 food microbiological examination: S. aureus, and confirmed by sequencing of 16S rRNA and nuc (Table 2) (Tang et al., 2006, 2011). The mecA gene in the S. aureus isolates was detected to confirm MRSA (Table 2) (Haftu et al., 2012).

Table 1.

Background Information, Number of Isolated, and Isolation Rate of Staphylococcus aureus in the Animal Samples

Animal	Farms				Slaughterhouses				Farmers' markets				S. aureus detection				MRSA detection
Animal	Types	Samples (No)	Isolation (No/%)	95% CI (%)	Types	Samples (No)	Isolation (No/%)	95% CI (%)	Types	Samples (No)	Isolation (No/%)	95% CI (%)	Samples (No)	Isolation (No/%)	95% CI (%)	p	Isolation (No/%)	95% CI (%)
Cattle	Fecal swab	274	17/6.2	4.7–7.7	Carcass swab	151	27/17.9	14.8–21.0	Beef swab	93	13/14.0	10.4–17.6	573	62/10.8	9.5–12.1	0.08	11/1.9	1.3–2.5
Cattle	\	\	\	\	Beef	10	0/0.0	0.0	Beef	45	5/11.1	6.4–15.8	573	62/10.8	9.5–12.1		11/1.9	1.3–2.5
Sheep	Fecal swab	117	4/3.4	1.7–5.1	Carcass swab	134	17/12.7	9.8–15.6	Mutton swab	114	9/7.9	5.4–10.4	422	35/8.3	7.0–9.6	0.07	3/0.7	0.3–1.1
Sheep	\	\	\	\	Mutton	29	2/6.9	2.2–11.6	Mutton	28	3/10.7	4.9–16.5	422	35/8.3	7.0–9.6		3/0.7	0.3–1.1
Cattle and sheep	\	\	\	\	Operation tools	38	2/5.3	1.7–8.9	Operation tools	69	7/10.1	6.5–13.7	107	9/8.4	5.7–11.1	0.20	3/2.8	1.2–4.4
Pig	\	\	\	\	\	\	\	\	Pork swab	76	8/10.5	7.0–14.0	134	18/13.4	10.5–16.1	NA	8/6.0	4.0–8.0
Pig									Operation tools	58	10/17.2	12.2–22.2	134	18/13.4	10.5–16.1		8/6.0	4.0–8.0
Chicken	\	\	\	\	\	\	\	\	Fecal swab	76	3/3.9	1.7–6.1	88	4/4.5	2.3–6.7	NA	1/1.1	0–2.2
Chicken	\	\	\	\	\	\	\	\	Operation tools	12	1/8.3	0.3–16.3	88	4/4.5	2.3–6.7		1/1.1	0–2.2
Total	\	391	21/5.4	4.3–6.5	\	362	48/13.3	11.5–15.1	\	571	59/10.3	9.0–11.6	1324	128/9.7	8.9–10.5	\	26/2.0	1.6–2.4
p	\	\	0.32	\	\	\	0.04	\	\	\	0.36	\	\	0.38	\	\	\	\

Note: The percentages of samples positive for S. aureus: 9.7%; the percentages of samples positive for MRSA: 2.0%. Statistical Package for Social Sciences (version 16.0) to determine whether there were statistically significant differences in the frequency of isolation of S. aureus among the risk factors associated with S. aureus contamination. p-Value: the positive rates of the farm, slaughterhouses, farmers' markets, and all samples in S. aureus.

\, without these data; %, isolation rate; CI, confidence interval; NA, not applicable; No, number of isolated.

Table 2.

The Virulence Genes, spa, 16S rRNA, and nuc of Staphylococcus aureus of Primer Sequence, Tm Value, and Sizes of Target Fragments

Gene names	Primer sequence (3′-5′)	Tm value (°C)	Product sizes (bp)	References
nuc	nuc-F ATCATTATTGTAGGTGTATTAGC	54	223	Tang et al. (2006)
nuc	nuc-R CAGGCGTATTCGGTTTC	54	223	Tang et al. (2006)
16S rRNA	16S-1F GTGCACATCTTGACGGTACC	54	565	Tang et al. (2006)
16S rRNA	16S-2R CGAAGGGGAAGGCTCTATC	54	565	Tang et al. (2006)
spa	spa-1113f TAAAGACGATCCTTCGGTGAGC	60	301–438	SeqNet.org
spa	spa-1514r CAGCAGTAGTGCCGTTTGCTT	60	301–438	SeqNet.org
mecA	mecA-F ACCAGATTACAACTTCACCAGG	47	162	Haftu et al. (2012)
mecA	mecA-R CCACTTCATATCTTGTAACG	47	162	Haftu et al. (2012)
hla	hla-F CTGATTACTATCCAAGAAATTCGATTG	57	209	Li et al. (2018b)
hla	hla-R CTTTCCAGCCTACTTTTTTATCAGT	57	209	Li et al. (2018b)
hlb	hlb-F GTGCACTTACTGACAATAGTGC	58	309	Li et al. (2018b)
hlb	hlb-R GTTGATGAGTAGCTACCTTCAGT	58	309	Li et al. (2018b)
sea	sea-F GAAAAAAGTCTGAATTGCAGGGAACA	57	560	Li et al. (2018b)
sea	sea-R CAAATAAATCGTAATTAACCGAAGGTTC	57	560	Li et al. (2018b)
seb	seb-F ATTCTATTAAGGACACTAAGTTAGGGA	57	404	Li et al. (2018b)
seb	seb-R ATCCCGTTTCATAAGGCGAGT	57	404	Li et al. (2018b)
sec	sec-F GTAAAGTTACAGGTGGCAAAACTTG	56	297	Li et al. (2018b)
sec	sec-R CATATCATACCAAAAAGTATTGCCGT	56	297	Li et al. (2018b)
fnbA	fnbA-F GTGAAGTTTTAGAAGGTGGAAAGATTAG	57	643	Li et al. (2018b)
fnbA	fnbA-R GCTCTTGTAAGACCATTTTTCTTCAC	57	643	Li et al. (2018b)
fnbB	fnbB-F GTAACAGCTAATGGTCGAATTGATACT	57	524	Li et al. (2018b)
fnbB	fnbB-R CAAGTTCGATAGGAGTACTATGTTC	57	524	Li et al. (2018b)
tst	tst-F TTCACTATTTGTAAAAGTGTCAGACCCACT	57	180	Li et al. (2018b)
tst	tst-R TACTAATGAATTTTTTTATCGTAAGCCCTT	57	180	Li et al. (2018b)
pvl	pvl-F TCATTAGGTAAAATGTCTGGACATGATCCA	56	433	Li et al. (2018b)
pvl	pvl-R GCATCAASTGTATTGGATAGCAAAAGC	56	433	Li et al. (2018b)
clfA	clfa-F ATTGGCGTGGCTTCAGTGCT	57	292	Li et al. (2018b)
clfA	clfa-R CGTTTCTTCCGTAGTTGCATTTG	57	292	Li et al. (2018b)

F, forward; R, reverse.

Antimicrobial resistance testing

The antimicrobial resistance of S. aureus isolates for 15 antibiotics was performed using the disk diffusion method according to the Clinical and Laboratory Standards Institute (CLSI) guidelines (CLSI, 2013). The following antibiotics were used: penicillin G (PG), ampicillin, cefoxitin, oxacillin (OX), erythromycin (ERY), spectinomycin (SH), gentamycin (CN), tetracycline (TE), clarithromycin (CLR), norfloxacin, sulfamethoxazole/trimethoprim, vancomycin (VAN), ciprofloxacin, minocycline, and teicoplanin (TEC). All tests were performed using the Muller–Hinton agar following 0.5 McFarland standards (1.5 × 10⁸). The S. aureus ATCC 29213 was used as a control. The zone of inhibition was compared with the standard value recommended by the CLSI. Table 3 shows the abbreviation, concentration, and resistance thresholds of the antibiotics. The S. aureus isolates were resistant to VAN to confirm VRSA.

Table 3.

The Antimicrobial Resistance of Staphylococcus aureus

	CLR	SXT	VAN	PG	NOR	CIP	CN	TE	AMP	SH	MH	TEC	ERY	OX	FOX
Isolates	No/%	No/%	No/%	No/%	No/%	No/%	No/%	No/%	No/%	No/%	No/%	No/%	No/%	No/%	No/%
S. aureus (128)	89/69.5	41/32.0	88/68.8	126/98.4	36/28.1	46/35.9	23/18.0	86/67.2	7/5.5	54/42.2	17/13.3	50/39.1	89/69.5	60/46.9	6/4.7
MRSA (26)	12/46.2	5/19.2	15/57.7	26/100.0	4/15.4	4/15.4	2/7.7	19/73.1	1/3.9	8/30.8	3/11.5	5/19.2	13/50.0	10/38.5	2/7.7
VRSA (88)	66/75.0	35/39.8	88/100.0	87/98.9	31/35.2	37/42.0	19/21.6	69/78.4	5/5.7	46/52.3	14/15.9	48/54.5	67/76.1	55/62.5	4/4.5

Note: CLR (clarithromycin, 15 μg), zone of inhibition ≤13 mm = R; SXT (sulfamethoxazole/trimethoprim, 23 μg), zone of inhibition ≤10 mm = R; VAN (vancomycin, 30 μg), zone of inhibition ≤14 mm = R; PG (penicillin G, 10 μg), zone of inhibition ≤18 mm = R; NOR (norfloxacin, 10 μg), zone of inhibition ≤12 mm = R; CIP (ciprofloxacin, 5 μg), zone of inhibition ≤15 mm = R; CN (gentamycin, 10 μg), zone of inhibition ≤12 mm = R; TE (tetracycline, 30 μg), zone of inhibition ≤14 mm = R; AMP (ampicillin, 10 μg), zone of inhibition ≤11 mm = R; SH (spectinomycin, 100 μg), zone of inhibition ≤14 mm = R; MH (minocycline, 30 μg), zone of inhibition ≤13 mm = R; TEC (teicoplanin, 30 μg), zone of inhibition ≤14 mm = R; ERY (erythromycin, 15 μg), zone of inhibition ≤13 mm = R; OX (oxacillin, 1 μg), zone of inhibition ≤10 mm = R; FOX (cefoxitin, 30 μg), zone of inhibition ≤14 mm = R.

%, detection rate or resistance rate; MRSA, methicillin-resistant S. aureus; No, number of detected or resistant; R, resistant; VRSA, vancomycin-resistant S. aureus.

Detection of virulence genes

Genomic DNA was extracted as described in Tang et al. (2006). The presence of virulence genes in S. aureus isolates was screened by PCR assays using primers previously reported, Panton–Valentine leukocidin (pvl) toxin, enterotoxin (sea, seb, and sec), toxic shock syndrome toxin-1 (tst), hemolysin (hla and hlb), clumping factor A (clfA), and fibronectin-binding proteins A and B (fnbA and fnbB) (Li et al., 2018b). All primers and sizes of target fragments and Tm values of the protocols are summarized in Table 2. The PCR mixture and PCR conditions were manipulated as described in Li's publication (Li et al., 2018b). All PCR products were analyzed by electrophoresis with 1% agarose gels. The PCR products were visualized with the Gel Doc XR+ imaging system (Bio-Rad, USA). The positive control strain used was the Staphylococcus aureus ATCC 29213.

Spa typing

The polymorphic X region of spa was amplified from the extracted genomic DNA using primers spa-1113f and spa-1514r (Table 2). The DNA amplification and sequencing were completed by the Tsingke biological technology (Tsingke, the Xi'an), described in Li's publication (Li et al., 2018b). The spa types were assigned to use the Centers for Disease Control and Prevention SpaServer (https://cge.cbs.dtu.dk/services/spatyper). A minimum spanning tree (MST) was constructed in BioNumerics using the spa clustering method of the spa typing plugin. Repeat successions were aligned using a gap creation cost of 100%, gap extension cost of 50%, duplicate creation and duplicate extension costs of both 25%, and a maximum duplication number of three repeats. The MST was built using the MST cluster method and the default cost matrix with a 1% grouping distance bin to evaluate the S. aureus isolates' relationship with animal in Xinjiang.

Results

Isolation and identification of S. aureus strains from fecal materials of animals, meats, and operation tools

Preliminary judgment for the microbial isolates was carried out by purplish red colony characteristics in the CHROMagar S. aureus Chromogenic medium. Furthermore, species-specific PCR amplifications showed that 128 S. aureus (9.7%) were isolated from the 1324 animal samples. In the farms, 21 S. aureus (5.4%) were isolated from the 391 samples. Of the slaughterhouses, 48 S. aureus (13.3%) were isolated from 362 samples. In the farmers' markets, 59 S. aureus (10.3%) were isolated from the 571 samples (Table 1). Of all of the S. aureus-isolated strains, 26 carrying the mecA gene were MRSA strains (20.3%).

Antibiotic resistance

The antibiotic resistance results of 128 S. aureus isolates are shown in Table 3. Resistance to PG was observed in the majority (98.4%), highly resistant antibiotics are ERY (69.5%), CLR (69.5%), VAN (68.8%), and TE (67.2%). A total of 100.0% of the MRSA were resistant to PG. Followed by TE (73.1%), VAN (57.7%) and ERY (50.0%) have higher resistance (Table 3). The VRSA were high resistant to PG (98.9), TE (78.4%), ERY (76.1%), CLR (75.0%), OX (62.5%), TEC (54.5%), and SH (52.3%) (Table 3).

The antimicrobial class resistance of the 128 S. aureus isolates is shown in Table 4. Moreover, 80.4% of isolates showed resistance to three or more antimicrobial classes. One of the isolates was resistant to 9 antimicrobial classes and 14 of the 15 antibiotics tested, and one strain (0.8%) was susceptible to all tested antimicrobial agents. Among them, 20.3% of isolates had resistance toward 4 antimicrobial classes, followed by 17.2%, 16.4%, and 13.3% of isolates resistant to 3, 7, and 5 antimicrobial classes, respectively. In addition, the S. aureus in the farms can be resistant to up to 7 classes of antibiotics, the most resistance profiles were 4 classes of antibiotics (28.6%) and 7 classes of antibiotics (28.6%). The S. aureus in the slaughterhouses were resistant to up to 8 classes of antibiotics; the most resistance profiles were resistant to 3 classes of antibiotics (20.8%), followed by 4 (18.8%) and 5 (14.6%) classes of antibiotics, respectively. The S. aureus in the farmers' markets can be resistant to up to 9 classes of antibiotics, and the most resistance profiles were resistant to up to 4 classes of antibiotics (18.6%), followed by 3 (16.9%), 7 (16.9%), and 5 (13.6%) classes of antibiotics, respectively.

Table 4.

Antimicrobial Class Resistance Profiles of Staphylococcus aureus Isolates

Resistant profiles		0	1	2	3	4	5	6	7	8	9
Total of S. aureus (128)	No	1	7	17	22	26	17	11	21	5	1
	%	0.8	5.5	13.3	17.2	20.3	13.3	8.6	16.4	3.9	0.8
	95% CI	0.0–1.6	3.5–7.5	10.3–16.3	13.9–20.5	16.7–23.9	10.3–16.3	6.1–11.1	13.1–19.7	2.2–5.6	0.0–1.6
S. aureus from farms (21)	No	0	0	1	2	6	2	4	6	0	0
	%	0.0	0.0	4.8	9.5	28.6	9.5	19.1	28.6	0.0	0.0
	95% CI	0.0–0.0	0.0–0.0	0.1–9.5	3.1–15.9	18.7–38.5	3.1–15.9	10.5–27.7	18.7–38.5	0.0–0.0	0.0–0.0
S. aureus from slaughterhouses (48)	No	1	2	10	10	9	7	2	5	2	0
	%	2.1	4.2	20.8	20.8	18.8	14.6	4.2	10.4	4.2	0.0
	95% CI	0.0–4.2	1.3–7.1	14.9–26.7	14.9–26.7	13.2–24.4	9.5–19.7	1.3–7.1	6.0–14.8	1.3–7.1	0.0–0.0
S. aureus from farmers' markers (59)	No	0	5	6	10	11	8	5	10	3	1
	%	0.0	8.5	10.2	16.9	18.6	13.6	8.5	16.9	5.1	1.7
	95% CI	0.0–0.0	4.9–12.1	6.3–14.1	12.0–21.8	13.5–23.7	9.1–18.1	4.9–12.1	12.0–21.8	2.2–8.0	0.0–3.4

%, resistance rate; No, number of resistant.

S. aureus virulence genes

All S. aureus isolates carried the virulence genes clfA and hla. The hemolysin hlb gene was detected in 79 S. aureus isolates (61.7%). The enterotoxin genes sea, seb, and sec were detected in 16 (12.5%), 26 (20.3%), and 31 (24.2%) of S. aureus isolates, respectively. The toxins pvl and tst were detected in 3 (2.3%) and 14 (10.9%) of S. aureus isolates. The fnbA and fnbB were detected in 1 (0.8%) and 30 (23.4%) of S. aureus isolates (Table 5). Twenty-six MRSA strains all carried the virulence genes clfA and hla, followed by hlb (80.8%), sea (19.2%), seb (69.2%), sec (15.4%), tst (3.9%), pvl (7.7%), fnbA (0.0%), and fnbB (19.2%), respectively (Table 5). Eighty-eight VRSA strains all carried the virulence genes clfA and hla, followed by hlb (58.0%), sea (9.1%), seb (17.0%), sec (25.0%), tst (12.5%), pvl (2.3%), fnbA (0.0%), and fnbB (20.5%), respectively (Table 5).

Table 5.

The Virulence Genes of Staphylococcus aureus

	hla	hlb	sea	seb	sec	tst	pvl	clfA	fnbA	fnbB
Isolates	No/%	No/%	No/%	No/%	No/%	No/%	No/%	No/%	No/%	No/%
S. aureus (128)	128/100.0	79/61.7	16/12.5	26/20.3	31/24.2	14/10.9	3/2.3	128/100.0	1/0.8	30/23.4
MRSA (26)	26/100.0	21/80.8	5/19.2	18/69.2	4/15.4	1/3.9	2/7.7	26/100.0	0/0.0	5/19.2
VRSA (88)	88/100.0	51/58.0	8/9.1	15/17.0	22/25.0	11/12.5	2/2.3	88/100.0	0/0.0	18/20.5

%, detection rate or resistance rate; No, number of detected or resistant.

S. aureus spa

In total, 32 known spa types and three unknown spa types were found in the 128 strains of S. aureus in Xinjiang (Fig. 1). The majority of the spa types of S. aureus isolates were t127, t2592, t437, t2616, t091, and t223. Of these, 29 t127 (22.7%) were isolated from cattle, sheep, pigs, and chickens, 16 t2592 (12.5%), 14 t2616 (10.9%), 7 t091 (5.5%), and 6 t223 (4.7%) were isolated from cattle and sheep, and 14 t437 (10.9%) were isolated from pigs, cattle, and sheep (Table 6; Fig. 1). Furthermore, 62 cattle origin-, 37 sheep origin-, and 18 pig origin-S. aureus isolates have 16, 19, and 6 known spa types and 1 unknown spa type, respectively. Also, 4 chicken-origin S. aureus isolates have 4 known spa types (Fig. 1).

FIG. 1.

Genetic relatedness of the 128 Staphylococcus aureus isolates in this study based on spa type. Each pie represents a cluster of isolates assigned to the same spa type; the size of a pie is proportional to the number of isolates in the group. The colors of and within each pie indicates the source of the isolates: green, cattle; red, sheep; blue, pig; yellow, sheep/cattle operation tools; turquoise, chicken. Color images are available online.

Table 6.

The Genetic Characterization of Staphylococcus aureus Isolates Detected in Xinjiang from Animal Food Industrial Chain

Spa type	S. aureus (128)	MRSA (26)	VRSA (88)	Virulence gene patterns (No)	Farms	Slaughterhouses	Farmers' markets
Spa type	No/%	No/%	No/%	Virulence gene patterns (No)	No	No	No
t127	29/22.7	1/3.8	21/23.9	hla+sec+clfA (10); hla+hlb+sec+clfA (9); hla+sec+tst+clfA (2); hla+hlb+sea+seb+sec+clfA+fnbB (1); hla+hlb+ sea+sec+clfA (1); hla+hlb+sea+seb+sec+clfA (1); hla+hlb+sec+tst+clfA (1); hla+hlb+ sea+clfA (1); hla+hlb+clfA (1); hla+seb+clfA (1); hla+clfA (1)	1	8	20
t2592	16/12.5	1/3.8	13/14.8	hla+clfA+fnbB (7); hla+hlb+clfA+fnbB (7); hla+hlb+sea+tst+clfA+fnbB (1); hla+clfA (1)	3	13	0
t437	14/10.9	12/46.2	8/9.1	hla+hlb+seb+clfA (5); hla+hlb+seb+sec+clfA (3); hla+hlb+sea+seb+clfA (2); hla+hlb+seb+pvl+clfA (1); hla+hlb+seb+tst+clfA (1); hla+hlb+sec+clfA (1); hla+hlb+sea+clfA (1)	3	1	10
t2616	14/10.9	4/15.4	11/12.5	hla+clfA (6); hla+hlb+clfA (2); hla+hlb+seb+clfA (2); hla+tst+clfA (2); hla+hlb+clfA+fnbB (1); hla+clfA+fnbB (1)	6	4	3
t091	7/5.5	0/0	4/4.5	hla+hlb+clfA (4); hla+clfA (2); hla+hlb+clfA+fnbB (1)	1	4	2
t223	6/4.7	0/0	4/4.5	hla+hlb+clfA (3); hla+hlb+tst+clfA (1); hla+tst+clfA (1); hla+hlb+tst+clfA+fnbB (1)	0	3	3
t189	4/3.1	1/3.8	2/2.3	hla+hlb+sea+seb+clfA (2); hla+hlb+seb+clfA (1); hla+ clfA (1)	0	0	4
t164	3/2.3	0/0	2/2.3	hla+clfA+fnbB (1); hla+hlb+clfA (1); hla+hlb+sea+seb+clfA+fnbB (1)	2	0	1
t078	3/2.3	2/7.7	0/0	hla+hlb+seb+sec+clfA+fnbB (1); hla+hlb+seb+clfA+fnbB (1); hla+hlb+sea+clfA+fnbB (1)	0	1	2

%, isolation rate; No, number of isolated.

Table 6 summarizes the spa typing results and their different virulence gene patterns. Among the 29 t127 isolates, hla+sec+clfA (n = 10) was the most common type, followed by hla+hlb+sec+clfA (n = 9) and hla+tsst+clfA (n = 2). Surprisingly, most of the t127 strains that encoded the enterotoxin gene of the meat swab samples from the slaughterhouses and farmers' markets were from the same region studied. Among the 16 t2592 isolates, hla+clfA+fnbB (n = 7) and hla+hlb+clfA+fnbB (n = 7) were the most common type. In the t2592 isolates, carcass swab and fecal swab samples from farms and slaughterhouses positive for the fnbB virulence gene were collected from different regions studied. Among the 14 t437 isolates, hla+hlb+seb+clfA (n = 5) was the most common type, followed by hla+hlb+seb+sec+clfA (n = 3) and hla+hlb+sea+seb+clfA (n = 2). In most of the t437 isolates, the virulence genes of hlb and seb were positive for farms and farmers' market samples of different regions studied. Notably, the t437 isolates accounted for most of the mecA gene-positive samples. Among the 14 t2616 isolates, hla+clfA (n = 6) was the most common type, followed by hla+hlb+clfA (n = 2), hla+tst+clfA (2), and hla+hlb+seb+clfA (n = 2).

In addition, 11 spa types were found in the 26 MRSA strains in Xinjiang. The majority of the spa types of MRSA isolates were t437 and t2616. Among these, 12 t437 (46.2%) MRSA isolates were from pig, cattle, and sheep, and 4 t2616 (15.4%) MRSA isolates were from cattle and sheep. Furthermore, 2 t078 MRSA isolates were from pig and sheep (Table 6).

In addition, 24 spa types were found in the 88 VRSA strains in Xinjiang. Most of the spa types of VRSA isolates were t127, t2592, t437, and t2616. Of these, 21 t127 (23.9%) S. aureus isolates were from cattle, sheep, pig, and chicken, 13 t2592 (14.8%) S. aureus isolates were from cattle and sheep, 8 t437 (9.1%) S. aureus isolates were from pig, cattle, and sheep, and 11 t2616 (12.5%) S. aureus isolates were from cattle and sheep (Table 6).

Discussion

The contamination of food-producing animals by S. aureus, especially those strains expressing spa typing, virulence genes, and AMR, remains an urgent public health issue (Abdel-Moein and Zaher, 2019). The results showed that the isolation rate of S. aureus in the farms, slaughterhouses, and farmers' markets was detected to a range from 5.4% to 13.3% in Xinjiang, China. Overall, the isolation rates from samples of cattle, sheep, pig, and chicken were 10.8%, 8.3%, 13.4%, and 4.5%, respectively. Similar findings concerning the prevalence of S. aureus in different animal samples were reported from other subparts of China, such as the prevalence rate of chickens (3.3%) in Shandong, raw milk samples (27.7%) in four cities of northern China, and meat and meat products (27.6%) in Shanxi (Qiu et al., 2011; Luan et al., 2016; Liu et al., 2017). To the best of our knowledge, this is the first production chain study from Xinjiang. In our study, the isolation rates of the slaughterhouses and farmers' markets were higher than those of farms. Furthermore, 2.0% (26/1324) of animal samples were positive for MRSA in the present study. This value is significantly lower than that in previous reports, which indicated that the occurrence rate of MRSA in raw meat samples of human consumption was 39.7% in Benin City, Nigeria (Igbinosa et al., 2016), 28.6% in Czech Republic (Tegegne et al., 2019), and 24.2% in Turkey (Siiriken et al., 2016), but it still poses a threat to humans who ingest food contaminated from meat directly carrying S. aureus and MRSA.

In our study S. aureus has a combination of two to seven virulence genes. The detection of hla, hlb, and clfA virulence genes was similar to that of other reports on S. aureus in food surveillance (Liao et al., 2018) and bovine clinical mastitis (Zhang et al., 2018). A total of 45.3% (58/128) of the S. aureus isolates harbored the classical SE genes (sea, seb, and sec). The sec gene was the most frequent SE genes detected, which is consistent with previous studies (Sharma et al., 2017; Zhou et al., 2017). Thus, the hazard posed by these isolates harboring SE genes should not be ignored. A previous study showed that 25 strains isolated from nasal samples of cattle and sheep detected fnbA (100%, 100%) and fnbB (66.6%, 63.1%) (Agabou et al., 2017). However, in our collections, the proportion of isolates positive for fnbA (0.8%) and fnbB (23.4%) genes was low. In our study, the detection rate (2.3%) of the pvl gene in S. aureus was similar to the detection rate (4.6%) of S. aureus in retail foods in China (Wu et al., 2019). The results of detection of S. aureus in Xinjiang showed that they all encoded hla and clfA, and half of them also encoded hlb and SE genes.

In this study, S. aureus involved 32 spa-type species, and the spa types t127, t2592, t437, and t2616 were dominant types, together representing 55.5% (71/128) of the isolates. Wu et al. (2018) reported that the dominant spa types of t127, t091, t002, t189, t034, t701, t437, t899, t796, t084, t3092, t085, t164, and t1376 were presented in the S. aureus isolates from retail foods in China. In addition, the prevalent spa types were t701, t091, t437, and t002 in S. aureus isolates from food surveillance in Southwest China (Liao et al., 2018). In addition, t127 was reported to be the most prevalent S. aureus isolate from 40 dairy farms in northern Greece (Papadopoulos et al., 2019). It is worth noting that t437 accounted for 50% of MRSA isolates. Similarly, the MRSA strains with a prevalence of t437 in teaching hospitals in China increased from 2013 to 2016 (Li et al., 2018a). However, the pandemic MRSA clonal complex 97 isolates belonged to the spa types t4795, t1730, t1236, t2112, t267, t345, t3992, t5487, and t426 were found in dairy cattle and pigs in Italy (Feltrin et al., 2016). Thus, the strains of S. aureus and MRSA from different regions have the same spa types.

Over the last few decades, S. aureus strains with antimicrobial resistance have been frequently reported in food, leading to substantial financial and economic losses (Richter et al., 2012). In our study, a substantially higher number of S. aureus strains were found to be resistant against penicillin, ERY, VAN, clarithromycin, and tetracycline, and similar findings were reported in China previously (Wang et al., 2017). In South Africa, the frequency of resistance was high to spectinomycin (98.4%), nalidixic acid (85.7%), and penicillin (84.1%), but low to CN (1.6%) and cefotaxime (1.6%) for S. aureus strains (Adigun et al., 2020). In this study, 98.4% of the S. aureus strains showed resistance to PG, which was higher than S. aureus strains' resistance to penicillin (85.2%) from dairy herds in North China (Liu et al., 2017), and S. argenteus strains resistance to penicillin (84.2%) from food in South China (Wu et al., 2020). It is worth noting that the VAN resistance is up to 68.8% in S. aureus strains, which was much higher than S. aureus strains' resistance to VAN (4.6%) from shared bicycles in Chengdu, China (Gu et al., 2020), but was lower than S. aureus strains' resistance to VAN (95.7%) from naturally fermented Chinese cured beef (Wang et al., 2018). Furthermore, 80.5% of S. aureus strains in the study sample were observed to be multi-drug resistant (MDR), which was higher than S. aureus strains' MDR to 38.9% in bulk Ready-To-Eat Foods (Lin et al., 2019). Thus, drawing public attention and the controlled use of antimicrobials would limit the emergence of drug-resistant bacteria.

Conclusions

This study shows that S. aureus isolates from farms and meats in Xinjiang, China, harbor important antimicrobial resistance genes and virulence determinants. Notably, there are MRSA (2.0%) and VRSA (6.6%) strains in Xinjiang, China. The detected S. aureus strains showed a high percentage of antimicrobial resistance. Therefore, it is important to monitor the use of antimicrobial agents in Xinjiang, China. Our study is the first systematic investigation of the prevalence of these S. aureus isolates from farm to market, revealing the genetic background of animal-related S. aureus isolates in Xinjiang, China. However, the presence of these isolates in meat-producing animal poses a potential health risk to consumers and requires further attention.

Footnotes

Authors' Contributions

G.Y. and Y.L. conceived and designed the experiments. L.X. and M.Z. performed the experiments. Y.L., B.P., and X.Z. analyzed the data. Y.L., B.P., and G.Y. contributed reagents/materials/analysis tools. Y.L., B.P., X.Z., and P.T. wrote the article. All authors contributed, read, and approved the final article.

Ethics Statement

Owners of the farms, slaughterhouses, and farmers' markets were informed of the study and expressed their approval for sampling of their animals. All experimental procedures involving animals and meat were approved by the Animal Welfare and Ethics Committee of Xinjiang Agricultural University, Xinjiang Province, China (Animal protocol number: 2017014).

Disclosure Statement

The authors declare that they have no competing interests.

Funding Information

This work was supported by The National Key Research and Development Program of China (2018YFD0500504), the Xinjiang Uygur Autonomous Region Tianshan Youth Program (2017Q021), and the National Key Research and Development Program of China (31702267).

References

Abdel-Moein

, Zaher

. Occurrence of multidrug-resistant methicillin-resistant Staphylococcus aureus among healthy farm animals: A public health concern. Int J Vet Sci Med, 2019; 7:55–60.

Adigun

, Gcebe

, Jambwa

, Fasina

, Adesiyun

. Molecular and phenotypic characterization of Staphylococcus aureus strains isolated from carcass swabs and carcass drips of chickens slaughtered in the informal market in Gauteng Province, South Africa. J Food Saf, 2020; 40:e12806.

Agabou

, Ouchenane

, Ngba Essebe

, Khemissi

, Chehboub

MTE

, Chehboub

, Sotto

, Dunyach-Remy

, Lavigne

. Emergence of nasal carriage of ST80 and ST152 PVL⁺ Staphylococcus aureus isolates from livestock in Algeria. Toxins (Basel), 2017; 9:303–311.

Al-Amery

, Elhariri

, Elsayed

, El-Moghazy

, Elhelw

, El-Mahallawy

, El Hariri

, Hamza

. Vancomycin-resistant Staphylococcus aureus isolated from camel meat and slaughterhouse workers in Egypt. Antimicrob Resist Infect Control, 2019; 8:129–141.

Caniça

, Manageiro

, Abriouel

, Moran-Gilad

, Franz

. Antibiotic resistance in foodborne bacteria. Trends Food Sci Technol, 2019; 84:41–44.

CLSI. Performance Standards for Antimicrobial Susceptibility Testing: Twenty-Third Informational Supplement (M100-S23). Wayne, PA: CLSI, 2013.

Doyle

, Hartmann

, Lee Wong

. Methicillin-resistant Staphylococci: Implications for our food supply?. Anim Health Res Rev, 2012; 13:157–180.

Edwards

, O'Neill

, Furman

, Hicks

, Torrente

, Pérez-Machado

, Wellington

, Phillips

, Murch

. Enterotoxin-producing Staphylococci cause intestinal inflammation by a combination of direct epithelial cytopathy and superantigen-mediated T-cell activation. Inflamm Bowel Dis, 2012; 18:624–640.

Feltrin

, Alba

, Kraushaar

, Ianzano

, Argudín

, Di Matteo

, Porrero

, Aarestrup

, Butaye

, Franco

, Battisti

. A livestock-associated, multidrug-resistant, methicillin-resistant Staphylococcus aureus clonal complex 97 lineage spreading in dairy cattle and pigs in Italy. Appl Environ Microbiol, 2016; 82:816–821.

10.

Gammoudi

, Moawad

, Barbieri

, Eldaghayes

. Occurrence, characterization, and antibiogram of Staphylococcus aureus in meat, meat products, and some seafood from Libyan retail markets. Vet World, 2019; 12:925–931.

11.

, Xie

, Liu

, Shui

, Zhang

, Feng

, Liu

, Li

, Lan

, Jin

, Li

, Peng

, Lei

, Zhang

. Prevalence and transmission of antimicrobial-resistant Staphylococci and Enterococci from shared bicycles in Chengdu, China. Sci Total Environ 2020;738:139735.

12.

Gurjar

, Gioia

, Schukken

, Welcome

, Zadoks

, Moroni

. Molecular diagnostics applied to mastitis problems on dairy farms. Vet Clin North Am Food Anim Pract, 2012; 28:565–576.

13.

Haftu

, Taddele

, Gugsa

, Kalayou

. Prevalence, bacterial causes, and antimicrobial susceptibility profile of mastitis isolates from cows in large-scale dairy farms of Northern Ethiopia. Trop Anim Health Prod, 2012; 44:1765–1771.

14.

Igbinosa

, Beshiru

, Akporehe

, Oviasogie

, Igbinosa

. Prevalence of methicillin-resistant Staphylococcus aureus and other Staphylococcus species in raw meat samples intended for human consumption in Benin City, Nigeria: Implications for public health. Int J Environ Res Public Health, 2016; 13:949–957.

15.

Lam

, Lipman

, Schukken

, Gaastra

, Brand

. Epidemiological characteristics of bovine clinical mastitis caused by Staphylococcus aureus and Escherichia coli studied by DNA fingerprinting. Am J Vet Res, 1997; 57:39–42.

16.

, Sun

, Yang

, Chen

, Yin

, Li

, Zhao

, Wang

. The changing pattern of population structure of Staphylococcus aureus from Bacteremia in China from 2013 to 2016: ST239-030-MRSA replaced by ST59-t437. Front Microbiol, 2018a;9:332.

17.

, Fang

, Zhao

, Lou

, Li

, Huang

, Li

Molecular characteristics and virulence gene profiles of Staphylococcus aureus causing bloodstream infection. Braz J Infect Dis, 2018b;22:487–494.

18.

Liao

, Gu

, Yang

, Mo

, Fan

, Guo

, Fu

, Xu

, Li

, Dai

. Molecular characteristics of Staphylococcus aureus isolates from food surveillance in Southwest China. BMC Microbiol, 2018; 18:91–100.

19.

Lin

, Sun

, Yao

, Cai

, Ren

, Chi

. The prevalence, antibiotic resistance and biofilm formation of Staphylococcus aureus in bulk ready-to-eat foods. Biomolecules, 2019; 9:524.

20.

Liu

, Li

, Meng

, Dong

, Zhao

, Lan

, Wang

, Zheng

. Prevalence, antimicrobial susceptibility, and molecular characterization of Staphylococcus aureus isolated from dairy herds in Northern China. J Dairy Sci, 2017; 100:8796–8803.

21.

Luan

, Wei

, Huang

, Ying

, Wu

, Wang

. Investigation on the status of Staphylococcus aureus contamination in commercially available food of Xi'an City during 2013-2015. Mod Prev Med, 2016; 43:3696–3698, 3712.

22.

Mekonnen

, Lam

, Hoekstra

, Rutten

, Tessema

, Broens

, Riesebos

, Spaninks

, Koop

. Characterization of Staphylococcus aureus isolated from milk samples of dairy cows in small holder farms of North-Western Ethiopia. BMC Vet Res, 2018; 14:246.

23.

Papadopoulos

, Angelidis

, Papadopoulos

, Kotzamanidis

, Zdragas

, Papa

, Filioussis

, Sergelidis

. Staphylococcus aureus and methicillin-resistant S. aureus (MRSA) in bulk tank milk, livestock and dairy-farm personnel in North-Central and North-Eastern Greece: Prevalence, characterization and genetic relatedness. Food Microbiol, 2019; 84:103249–103258.

24.

Qiu

, Hao

, Zhang

, Shen

, Wu

, Li

, Zhang

. Isolation and identification of Staphylococcus aureus from animals and drug resistance analysis. Chin Agric Sci Bull, 2011; 27:356–359.

25.

Richter

, Sting

, Popp

, Rau

, Tenhagen

, Guerra

, Hafez

, Fetsch

. Prevalence of types of methicillin-resistant Staphylococcus aureus in Turkey flocks and personnel attending the animals. Epidemiol Infect, 2012; 140:2223–2232.

26.

Sharma

, Sharma

, Dahiya

, Khan

, Mathur

, Sharma

. Coagulase gene polymorphism, enterotoxigenecity, biofilm production, and antibiotic resistance in Staphylococcus aureus isolated from bovine raw milk in North West India. Ann Clin Microbiol Antimicrob, 2017; 16:65–79.

27.

Siiriken

, Yildirim

, Güney

, Erol

, Durupinar

. Prevalence and molecular characterization of methicillin-resistant Staphylococcus aureus in foods of animal origin, Turkey. J Food Prot 2016;79:1990–1994.

28.

Tang

, Chen

, Li

, Zeng

, Li

. Characterization of adhesin genes, staphylococcal nuclease, hemolysis, and biofilm formation among Staphylococcus aureus strains isolated from different sources. Foodborne Pathog Dis, 2013; 10:757–763.

29.

Tang

, Tang

, Chen

, Du

, Yang

, Wang

, Zhang

, Yue

. Phenotypic characterization and prevalence of enterotoxin genes in Staphylococcus aureus isolates from outbreaks of illness in Chengdu City. Foodborne Pathog Dis, 2011; 8:1317–1320.

30.

Tang

, Shi

, Chen

. Characterization of a duplex polymerase chain reaction assay for the detection of enterotoxigenic strains of Staphylococcus aureus . J Rapid Methods Autom Microbiol, 2006; 14:201–217.

31.

Tegegne

, Florianová

, Gelbíčová

, Karpíšková

, Koláčková

. Detection and molecular characterization of methicillin-resistant Staphylococcus aureus isolated from bulk tank milk of cows, sheep, and goats. Foodborne Pathog Dis, 2019; 16:68–73.

32.

Wang

, Li

, Wang

, Liu

, Yang

, Zhang

, Fan

, Wei

. Antibiotic resistance of coagulase-negative staphylococci and lactic acid bacteria isolated from naturally fermented Chinese cured beef. J Food Prot, 2018; 81:2054–2063.

33.

Wang

, Sang

, Sun

, Chen

, Xie

. Characterisation of Staphylococcus aureus isolated from rabbits in Fujian, China. Epidemiol Infect, 2019; 147:e256.

34.

Wang

, Baloch

, Jiang

, Zhang

, Peng

, Li

, Fanning

, Ma

, Xu

. Enterotoxigenicity and antimicrobial resistance of Staphylococcus aureus isolated from retail food in China. Front Microbiol, 2017; 8:2256.

35.

, Huang

, Wu

, Zhang

, Yang

, Wu

, Zeng

, Chen

, Ding

, Wang

, Lei

, Zhang

, Xue

. Staphylococcus aureus isolated from retail meat and meat products in China: Incidence, antibiotic resistance and genetic diversity. Front Microbiol, 2018; 9:2767–2781.

36.

, Huang

, Zhang

, Dai

, Pang

, Zhang

, Zeng

, Gu

, Zhang

, Xue

, Wang

, Ding

, Wu

. Staphylococcus argenteus isolated from retail foods in China: Incidence, antibiotic resistance, biofilm formation and toxin gene profile. Food Microbiol, 2020; 91:103531.

37.

, Zhang

, Huang

, Wu

, Zhang

, Dai

, Zeng

, Yang

, Chen

, Pang

, Lei

, Zhang

, Xue

, Wang

, Ding

. Phenotypic and genotypic characterization of PVL-positive Staphylococcus aureus isolated from retail foods in China. Int J Food Microbiol, 2019; 304:119–126.

38.

Zadoks

, Middleton

, McDougall

, Katholm

, Schukken

. Molecular epidemiology of mastitis pathogens of dairy cattle and comparative relevance to humans. J Mammary Gland Biol Neoplasia, 2011; 16:357–372.

39.

Zhang

, Gao

, Barkema

, Ali

, Liu

, Deng

, Naushad

, Kastelic

, Han

. Virulence gene profiles: Alpha-hemolysin and clonal diversity in Staphylococcus aureus isolates from bovine clinical mastitis in China. BMC Vet Res, 2018; 14:63.

40.

Zhou

, Zhang

, Li

, Yang

, Li

, Song

, Wang

. Prevalence and molecular characterization of Staphylococcus aureus isolated from goats in Chongqing, China. BMC Vet Res, 2017; 13:352.