Antimicrobial Resistance and Molecular Characterization of Class 1 Integron in Salmonella Isolates Recovered from Pig Farms in Chongqing,China

Abstract

Salmonella is considered one of the leading causes for foodborne diseases in humans. Pork and its products contaminated with Salmonella are increasingly recognized as an important source of human salmonellosis. The aim of this study was to investigate the antimicrobial resistance and prevalence of integrons in Salmonella isolates from pig farms. In total, 92 of 724 (12.7%) samples were Salmonella-positive, including 64 (15.0%) from fecal samples, 27 (12.6%) from floor samples, 1 (4.5%) from water samples, and 0 from feed and air samples. These isolates showed the highest resistance to tetracycline (85.9%), followed by trimethoprim (67.4%), ampicillin (60.9%), and chloramphenicol (51.1%). In addition, 51 isolates carried the complete class 1 integron, most of which (42/51) harbored antibiotic resistance cassettes. A total of six gene cassettes including orfF, est-X, dfrA1+aadA1, aadA1, dfrA12+aadA2, and sat were identified, in which the most prevalent one was orfF (29.4%). Furthermore, all 19 class 1 integron-positive isolates harboring dfr genes showed resistance to trimethoprim (SXT), suggesting that the trimethoprim resistance gene (dfr) may contribute to the emergence of SXT resistance phenotype. Therefore, considering the significance of integrons and related resistance genes for public health, special measures should be taken to control Salmonella spp. on the pig farms and to prevent spread of integrons and associated resistance genes.

Introduction

As a major zoonotic pathogen, Salmonella can cause sporadic gastrointestinal infections and foodborne outbreaks worldwide (Newell et al., 2010). It has been estimated that Salmonella could be responsible for more than 93.8 million infections worldwide each year. In China, it was reported that at least 70% of foodborne diseases were caused by Salmonella (Li et al., 2019).

Previously, poultry products including eggs and meat have been identified as the most important sources of human salmonellosis (Freitas et al., 2010; Painter et al., 2013). However, pigs and pork products are also increasingly considered as an important source of human salmonellosis. For example, it has been estimated that 15% of salmonellosis cases in the Netherlands in 1998 (Berends et al., 1998), 9% of cases in Denmark in 1999 (Hald et al., 2004), and 1.5–17.5% of annual cases in the United States are associated with the consumption of pork (Miller et al., 2005). Therefore, it is necessary to investigate and monitor Salmonella infection in pigs to reduce its threat to public health.

Salmonella enterica is the main pathogen of swine salmonellosis, which is one of the most important enteric diseases in swine, leading to severe diarrhea in pigs (Kim and Isaacson, 2017). Pigs of all ages are susceptible to S. enterica infection, but weaned and growing–finishing pigs are more sensitive to its infection (Meurens et al., 2009). Salmonella enterica serovars Typhisuis and Choleraesuis infections usually cause severe systemic disease in pigs called swine typhoid (Boyen et al., 2008). Most Salmonellae in pigs are low pathogenic and rarely cause systemic infections. However, some clinically asymptomatic carrier pigs may shed Salmonella to the environment when exposed to stress (e.g., during transfer to the slaughterhouse) (Rönnqvist et al., 2018). Therefore, the asymptomatic swine Salmonella infection poses a huge threat to both the pig industry and public health.

Antimicrobial agents including antibiotics have been widely used in the pig industry to treat or prevent infections, which contribute greatly to the development of pig industry (Zhang et al., 2019). However, the improper use of antibiotics also causes the increase of antibiotic resistance bacteria and food chain contamination events. Recently, epidemiological studies in China showed that swine products in slaughterhouses were contaminated with multidrug-resistant (MDR) Salmonella commonly (Li et al., 2019; Jiu et al., 2020). In Europe, 15–23% of salmonellosis cases in humans are related to the contaminated pork, some of which could even result in death (Bolton et al., 2013). Therefore, contaminated pork with MDR Salmonella may become a serious public health issue in the near future.

Integron system has shaped the evolution of bacteria for hundreds of millions of years, which could help bacteria to acquire novel resistance genes. Integrons are essentially mobile DNA elements capable of capturing and integrating exogenous resistance genes in cassette-like structures by site-specific recombination system. All integrons share three key elements located within the 5′-conserved segment. These elements include a gene (intI) encoding an integrase; a primary recombination site (attI); and an outward-orientated promoter (Pc) that directs transcription of the captured genes (Escudero et al., 2015). At present, a total of four classes of integrons have been identified to play a role in the dissemination of antimicrobial resistance genes. Class 1 to 3 integrons are strongly associated with the multidrug resistance phenotype, whereas class 1 integron is the most prevalent and plays a major role in the development of multidrug resistance of Salmonella and other Gram-negative bacteria (Mafulul et al., 2018).

In our previous study, we have investigated the contamination of Salmonella from chicken, pork, and the environment in slaughtering and retail processes in Chongqing, China. Nearly half of the isolates (50.43%) were MDR, and Salmonella was more frequently isolated in pork production chain than in chicken (Chen et al., 2019). However, there are limited data on the antibiotic resistance profiles of Salmonella isolates at the pig farm level. The objective of this study was to characterize the antibiotic resistance profiles of Salmonella isolates from farms and their relationship to integrons and resistance genes.

Materials and Methods

Samples collection

From November 2018 to January 2019, for convenience sampling, a total of 724 samples from the healthy pigs were randomly collected by farmers in 6 districts of Chongqing, China. In total, 12 pig farms were investigated in this study and about 60 samples were collected from each farm. These samples included fecal samples (n = 426), floor samples (n = 215), water samples (n = 22), feed samples (n = 20), and air samples (n = 41). All collected samples were stored in an icebox and transported immediately to our laboratory for initial processing and then held in a refrigerator at 4°C. The study was approved by Institutional Animal Care and Use Committee of Southwest University (IACUC-2018-0907-04).

Isolation and identification of Salmonella

The Salmonella isolation method in this study was carried out according to our previous study (Chen et al., 2019). Briefly, each sample was pre-enriched in sterile buffered peptone water and incubated overnight at 37°C. Then, each pre-enriched suspension was added into Rappaport–Vassiliadis enrichment Broth (RVB) and Tetrathionate Broth (TTB) for 24 h at 42°C. One loopful of each RVB and TTB culture was streaked onto Xylose Lysine Tergitol 4 selective media and incubated for 24–48 h at 37°C. The suspected colonies were picked up from each plate and then further confirmed by polymerase chain reaction (PCR) analysis using primers (Table 1) targeting the Salmonella stn gene (Kumar et al., 2015). A reference strain of Salmonella Typhimurium (ATCC 50115) was used as a positive control during PCR. Each identified Salmonella isolate was stored at −80°C in 50% glycerol until further testing.

Table 1.

Primer Sequences for Polymerase Chain Reaction Assays Used in the Study

Primer	Target gene	Sequence (5′–3′)	PCR product size (bp)	Reference
stn-F	stn	CTTTGGTCGTAAAATAAGGCG	260	Kumar et al. (2015)
stn-R	stn	TGCCCAAAGCAGAGAGATTC	260	Kumar et al. (2015)
intI1-F	intI-1	CCTCCCGCACGATGATC	280	Zhu et al. (2017)
intI1-R	intI-1	TCCACGCATCGTCAGGC	280	Zhu et al. (2017)
intI2-F	intI-2	TTATTGCTGGGATTAGGC	233	Moura et al. (2007)
intI2-R	intI-2	ACGGCTACCCTCTGTTATC	233	Moura et al. (2007)
intI3-F	intI-3	AGTGGGTGGCGAATGAGTG	600	Chuah et al. (2018)
intI3-R	intI-3	TGTTCTTGTATCGGCAGGTG	600	Chuah et al. (2018)
qacEΔ1-F	3′CS	ATCGCAATAGTTGGCGAAGT	800	Zhang et al. (2004)
sul1B-R	3′CS	GCAAGGCGGAAACCCGCGCC	800	Zhang et al. (2004)
intI1-k	Variable region 1	ACCGAAACCTTGCGCTCGT	Variable	Xu et al. (2007)
lnB	Variable region 1	AAGCAGACTTGACCTGAT	Variable	Xu et al. (2007)

3′CS, 3′ conserved segment.

Antimicrobial susceptibility testing

The susceptibility of all Salmonella isolates to 15 antimicrobials was determined by the Kirby–Bauer disk diffusion method (Bauer et al., 1966), and the interpretation for the categories of susceptible, intermediate, or resistant was made according to the Clinical and Laboratory Standards Institute (CLSI) guidelines (CLSI, 2018). The antimicrobials and their respective disk potencies were as follows: amikacin (30 μg), ampicillin (10 μg), chloramphenicol (30 μg), ceftriaxone (30 μg), cephalothin (30 μg), ciprofloxacin (5 μg), cefoxitin (30 μg), gentamicin (10 μg), sulfamethoxazole/trimethoprim (1.25/23.75, 25 μg), amoxicillin (20 μg), norfloxacin (10 μg), tetracycline (30 μg), streptomycin (10 μg), nitrofurantoin (30 μg), and nalidixic acid (30 μg). The reference strain of Escherichia coli ATCC 25922 was used as a quality control.

Detection and characterization of class 1, 2, and 3 integrons

All Salmonella isolates were examined for the presence of class 1, 2, and 3 integrons. Briefly, the genomic DNA of each Salmonella isolate was extracted by boiling method. Then, the presence of class 1, 2, and 3 integrases were tested by PCR with the intI1-, intI2-, and intI3-specific primers (Table 1) as described in previous studies, respectively (Moura et al., 2007; Zhu et al., 2017; Chuah et al., 2018). To characterize the 3′ conserved segment (3′CS) of class 1 integrons, a specific PCR targeting two genes in 3′CS region (sul1 and qacEΔ1) was performed according to a previous report (Zhang et al., 2004). Reaction mixtures without a DNA template were used as negative control. All the amplified products were electrophoresed on agarose gel and then visualized in a gel document system. The DNA sequence data were compared with data deposited in the GenBank database via the Basic Local Alignment Search Tool (BLAST) tool (www.ncbi.nlm.nih.gov/blast).

Detection of integron-associated gene cassettes

All intI1-positive isolates were examined for the presence of internal gene cassettes. Each gene cassette was detected by PCR with intI1-k and lnB primers (Table 1) as previously described (Xu et al., 2007). Then, PCR products were analyzed through 1.5% (w/v) agarose gel electrophoresis and sent for DNA sequencing by the Sanger method. The DNA sequence data were then compared with data in the GenBank database by the BLAST tool (www.ncbi.nlm.nih.gov/blast) and that in the Integron Database INTEGRALL (http://integrall.bio.ua.pt).

Results

Prevalence and antimicrobial susceptibility of Salmonella in pig farms in Chongqing

Of 724 samples, 92 (12.7%) were identified as Salmonella-positive by stn gene-based PCR (Table 2). These positive samples include 64 (15.0%) from fecal samples, 27 (12.6%) from floor samples, 1 (4.5%) from water samples, and 0 from feed and air samples (Table 2).

Table 2.

The Prevalence of Salmonella from Different Sampling Sources

Source	No. of samples from each source	No. (%) of positive isolates
Feces	426	64 (15.0)
Floor	215	27 (12.6)
Water	22	1 (4.5)
Feed	20	0
Air	41	0
Total	724	92 (12.7)

In the antimicrobial susceptibility study, the isolated Salmonella showed the highest resistance to tetracycline (85.9%), followed by trimethoprim (67.4%), ampicillin (60.9%), and chloramphenicol (51.1%), whereas the lowest resistance was observed against amoxicillin (0%), nalidixic acid (0%), and nitrofurantoin (0%), followed by amikacin (2.2%), norfloxacin (3.3%), cephalothin (4.3%), ciprofloxacin (6.5%), and gentamicin (9.8%) (Table 3). Furthermore, a total of 59 (64.1%) identified Salmonella isolates were MDR strains (Supplementary Table S1). These strains include 12 Salmonella isolates (13.0%) against 3 antibiotic classes, 23 Salmonella isolates (25.0%) against 4 antibiotic classes, 15 Salmonella isolates (16.3%) against 5 antibiotic classes, but only 9 Salmonella isolates (9.8%) showed MDR phenotype against 6 antibiotic classes (Table 4).

Table 3.

Antimicrobial Resistance of the 92 Salmonella Isolates in This Study

Antimicrobial class	Antimicrobial agent	No. (%) of resistant isolates
β-Lactams	Cefoxitin	10 (10.9)
	Ceftriaxone	12 (13.0)
	Cephalothin	4 (4.3)
	Ampicillin	56 (60.9)
	Amoxicillin	0 (0)
Chloramphenicol	Chloramphenicol	47 (51.1)
Quinolones	Nalidixic acid	0 (0)
Fluoroquinolones	Ciprofloxacin	6 (6.5)
	Norfloxacin	3 (3.3)
	Nitrofurantoin	0 (0)
Aminoglycosides	Gentamicin	9 (9.8)
	Streptomycin	34 (37.0)
	Amikacin	2 (2.2)
Tetracycline	Tetracycline	79 (85.9)
Sulfonamides	Trimethoprim	62 (67.4)

Table 4.

Multidrug Resistance Profile of Salmonella Isolates Against Seven Antibiotic Classes

Isolates (n)	No. of antibiotic (class)	Multidrug profile	No. of MDR isolates (n = 59)	MDR rate (%)
Salmonella (n = 92)	3	C-TET-SXT CIP-TET-CX AMP-STR-TET AMP-C-TET AMP (CRO)-STR-TET AMP (CF, CRO)-STR-TET	2 1 6 1 1 1	12 (13.0)
Salmonella (n = 92)	4	AMP-C-TET-SXT AMP-C-STR-SXT C-TET-CX-SXT AMP-CIP-STR-TET AMP-STR-TET-SXT AMP (CX)-C-TET-SXT AMP (CRO)-TET-AMK-SXT AMP (CF, CRO)-GEN-C-SXT AMP (CF, CRO)-C-STR-TET	11 3 1 1 1 2 1 1 2	23 (25.0)
	5	AMP-C-TET-AMK-SXTAMP-C-STR-TET-SXTAMP-GEN-C-TET-SXTCIP-TET-CX (CRO)-NOR-SXT	11211	15 (16.3)
	6	AMP-GEN-C-STR-TET-SXTAMP (CX)-CIP-C-STR-TET-SXTCIP-C-TET-CX (CRO)-NOR-SXT	612	9 (9.8)

AMK, amikacin; AMP, ampicillin; C, chloramphenicol; CF, cephalothin; CIP, ciprofloxacin; CRO, ceftriaxone; CX, cefoxitin; GEN, gentamicin; MDR, multidrug-resistant; NOR, norfloxacin; STR, streptomycin; SXT, trimethoprim; TET, tetracycline.

Detection and characterization of class 1, 2, and 3 integrons

All the identified Salmonella isolates were detected with specific PCR for the presence of class 1, 2, and 3 integrons. Among the 92 isolates, 71 (77.2%) isolates were found positive for class 1 integrase gene intI1 with an amplicon of 280 bp (data not shown), and 51 of 71 isolates had the complete 5′ and 3′ components of class 1 integron (Supplementary Table S1). However, neither class 2 integron gene intI2 nor class 3 integron gene intI3 was found in the isolates (data not shown).

Among the 51 Salmonella isolates carrying the complete 5′ and 3′ components of class 1 integron, the majority of which (42/51) harbored antibiotic resistance gene cassettes (Table 5). Furthermore, 15 (29.4%), 4 (7.8%), and 1 (2.0%) of the 51 isolates harbored less common gene cassettes orfF, estX, and sat, respectively. Three (5.9%) of the 51 isolates harbored a spectinomycin/streptomycin resistance gene aadA1. Thirteen (25.5%) and 6 (11.7%) of the 51 isolates, respectively, possessed the gene cassette arrays dfrA1+aadA1 and dfrA12+aadA2, both of which encode resistance to trimethoprim and spectinomycin/streptomycin (Table 5).

Table 5.

The Prevalence of Gene Cassettes Among Class 1 Integron-Positive Salmonella Isolates

No. of intI1-positive isolates (n = 71) carrying complete class 1 integron	Array of gene cassettes	No. (%) of isolates carrying different cassettes	Antibiotic resistance profile (no. of isolates)
	orfF	15 (29.4)	AMP-GEN-C-STR-TET-SXT (5)AMP-C-STR-SXT (3)AMP-C-STR-TET-SXT (5)CIP-C-TET-CX (CRO)-NOR-SXT (1)AMP (CRO)-TET-AMK-SXT (1)
	estX	4 (7.8)	C-TET-SXT (1)CIP-C-TET-CX (CRO)-NOR-SXT (1)CIP-TET-CX (CRO)-NOR-SXT (1)TET-SXT (1)
51	dfrA1+aadA1	13 (25.5)	TET-SXT (13)
	aadA1	3 (5.9)	AMP-GEN-C-TET-SXT (1)AMP (CF, CRO)-GEN-C-SXT (1)AMP (CF, CRO)-C-STR-TET (1)
	dfrA12+aadA2	6 (11.7)	AMP-C-STR-TET-SXT (5)AMP-STR-TET-SXT (1)
	sat	1 (2.0)	AMP (CF, CRO)-STR-TET (1)

Furthermore, 7/22 (31.8%) of isolates harboring aad genes (aadA1 and aadA2) presented resistance to streptomycin (STR). Among 19 class 1 integron-positive isolates harboring dfr genes (dfrA1 and dfrA12), all these isolates showed resistance to trimethoprim (SXT). In addition, isolates harboring sat, estX, and orfF presented at least two antibiotic resistance profile, and up to six antibiotic resistance profile (Table 5).

Discussion

Salmonella infection has become a leading cause of foodborne disease worldwide and is often associated with the consumption of pork and other animal foods. Recently, the rising antibiotic resistance of Salmonella from both human and food animals further exacerbates the threat to public health (Mejia et al., 2021; Yue et al., 2020). As an important source of human salmonellosis, Salmonella in pig abattoirs and the retail stages have been well documented in previous studies. However, the examination of Salmonella in pig farms is less reported so far.

In this study, 12.7% (92/724) of samples from pig farms were found to be positive for the presence of Salmonella as confirmed by PCR, and the highest isolation rate (15.0%) was found in fecal samples. Furthermore, feces-derived Salmonella isolates showed a higher extent of resistance against different antibiotics than those derived from floor and water (as shown in Supplementary Table S1), indicating that feces may play a vital role in the spread of resistant bacteria within the farm environment.

In addition, the Salmonella isolates tested in our study were most frequently resistant to tetracycline (85.9%) and sulfonamides (67.4%), which is extremely consistent with the antimicrobial resistance profile of Salmonella isolates from pigs with diarrhea in 26 provinces in China from 2014 to 2016 (Su et al., 2018). It is quite similar to the findings concerning on the antimicrobial resistance of Salmonella isolates recovered from retail pork products in Chongqing and Xuzhou, China (Chen et al., 2019; Zhu et al., 2019). The abuse of antimicrobials in animals exerts a selection pressure on bacteria, so it can be speculated that the prevalence of these resistant Salmonellae may be associated with the long-term use of these antimicrobials (tetracycline and sulfonamides). Furthermore, 64.1% (59/92) of Salmonella isolates were found to be resistant to three or more antimicrobial agents, which will probably be a challenge for both farm husbandry and public health. By contrast, the low resistance was observed against amoxicillin, nitrofurantoin, amikacin, and several other antibiotics, which indicated that these types of antibiotics are effective and can be used for the prevention and treatment of Salmonella infection in pigs in priority.

Integrons are mobile genetic elements, which help to transfer antimicrobial resistance genes among bacteria. In this study, 71 of the 92 (77.2%) isolates harbored the intI1 gene, which is similar to the case of 77% Salmonella isolates from pigs in Spain (Argüello et al., 2018), but the data were significantly higher than that of Salmonella isolates (5.0%) from pigs in Shandong Province, China (Zhao et al., 2017). Additionally, class 2 and 3 integrons were not detected here, which is highly consistent with the result from another study (Argüello et al., 2018). These results indicate the potential correlation between class 1 integron and observed multidrug resistance phenotype. Furthermore, 42 of 51 class 1 integrons harbored different antimicrobial resistance gene cassettes with the gene cassette array orfF (29.4%), dfrA1+aadA1 (25.5%), and dfrA12+aadA2 (11.7%) as the most prevalent ones. The dfr gene has been known to contribute to the resistance to trimethoprim. Here, all class 1 integron-positive isolates harboring dfr gene showed resistance to trimethoprim, suggesting the close relationship between the corresponding antibiotic resistance type and resistance gene. In addition, some gene cassettes including orfF, estX, and sat identified in this study are still functionally unclear. Presently, it is only known that the estX gene encodes for a hypothetical esterase or hydrolase, which is suggested to be similar with the sat gene (Partridge and Hall, 2005) and responsible for resistance to streptothricin; the orfF gene encodes for a protein with an unknown function (Partridge et al., 2009). In this study, the isolates harboring these gene cassettes always presented multidrug resistance phenotypes, implying that these genes could contribute to the observed resistance profile to a large extent. Generally, class 1 integron could complete the horizontal transfer of resistance gene cassettes among bacteria through intI1 recombinase enzyme activity. Therefore, the presence of class 1 integron and the prevalence of resistance genes in Salmonella isolates are of great potential hazard to the health and food safety of humans.

Conclusions

In this study, Salmonella isolates from pig farms showed high resistance to tetracycline, trimethoprim, ampicillin, and chloramphenicol. Furthermore, the majority of isolates harbored class 1 integron and resistance gene cassettes, which may contribute largely to the observed antibiotic resistance types. All above characteristics of these Salmonella isolates imply a potential public health issue and also reflect an urgent need for the rational use and rigorous control of antibiotics in animal husbandry. Further investigations are needed to explore mechanisms of multidrug resistance occurrence in Salmonellae recovered from pig farms, and more strategies are encouraged to reduce the multidrug resistance and public health risk of Salmonellae in pig farms.

Footnotes

Disclosure Statement

No competing financial interests exist.

Funding Information

This study was supported by the National Key Research and Development Program of China (2018YFD0500500), the earmarked fund for China Agriculture Research System (CARS-37), the National Agricultural Product Quality and Safety Risk Assessment Project (GJFP2020007) and the Innovation Research Group in Chongqing Unviersities (CXQT20004). The funding bodies had no role in the study design, data collection or analysis, and decision to publish or preparation.

Supplementary Material

Supplementary Table S1

References

Argüello

, Guerra

, Rodríguez

, Rubio

, Carvajal

. Characterization of antimicrobial resistance determinants and class 1 and class 2 integrons in Salmonella enterica spp., multidrug-resistant isolates from pigs. Genes (Basel), 2018; 9:256.

Bauer

, Kirby

, Sherris

, Turck

. Antibiotic susceptibility testing by a standardized single disk method. Am J Clin Pathol, 1966; 45:493–496.

Berends

, Van Knapen

, Mossel

, Burt

, Snijders

. Impact on human health of Salmonella spp. on pork in The Netherlands and the anticipated effects of some currently proposed control strategies. Int J Food Microbiol, 1998; 44:219–229.

Bolton

, Ivory

, McDowell

. A study of Salmonella in pigs from birth to carcass: Serotypes, genotypes, antibiotic resistance and virulence profiles. Int J Food Microbiol, 2013; 160:298–303.

Boyen

, Haesebrouck

, Maes

, Immerseel F

Van

, Ducatelle

, Pasmans

. Non-typhoidal Salmonella infections in pigs: A closer look at epidemiology, pathogenesis and control. Vet Microbiol, 2008; 130:1–19.

Chen

, Jiang

, Ye

, Xie

, Chen

, Xu

, Zeng

, Peng

, Hu

, Fang

. Genotypic characterization and antimicrobial resistance profile of Salmonella isolated from chicken, pork and the environment at abattoirs and supermarkets in Chongqing, China. BMC Vet Res, 2019; 15:456.

Chuah

, Syuhada

AKS

, Suhaimi

, Hanim

, Rusul

. Genetic relatedness, antimicrobial resistance and biofilm formation of Salmonella isolated from naturally contaminated poultry and their processing environment in northern Malaysia. Food Res Int, 2018; 105:743–751.

CLSI. M02 Performance Standards for Antimicrobial Disk Susceptibility Tests, 13th ed. Wayne, PA: CLSI, 2018.

Escudero

, Loot

, Nivina

, Mazel

. The integron: Adaptation on demand. Microbiol Spectr, 2015; 3:MDNA3-0019-2014.

10.

Freitas Neto

OC de

, Penha Filho

RAC

, Barrow

, Berchieri Junior

. Sources of human non-typhoid salmonellosis: A review. Braz J Poult Sci, 2010; 12:1–11.

11.

Hald

, Vose

, Wegener

, Koupeev

. A Bayesian approach to quantify the contribution of animal-food sources to human salmonellosis. Risk Anal, 2004; 24:255–269.

12.

Jiu

, Meng

, Hong

, Huang

, Wang

, Chen

, Zhao

, Liu

, Lu

, Li

. Prevalence and characterization of Salmonella in three typical commercial pig abattoirs in Wuhan, China. Foodborne Pathog Dis, 2020; 17:620–627.

13.

Kim

, Isaacson

. Salmonella in swine: Microbiota interactions. Annu Rev Anim Biosci, 2017; 5:43–63.

14.

Kumar

, Datta

, Lalitha

. Salmonella grows vigorously on seafood and expresses its virulence and stress genes at different temperature exposure. BMC Microbiol, 2015; 15:254.

15.

, Yin

, Li

, Du

, Guo

, Bellefleur

, Wang

, Shi

. Serotype distribution, antimicrobial susceptibility, antimicrobial resistance genes and virulence genes of Salmonella isolated from a pig slaughterhouse in Yangzhou, China. AMB Express, 2019; 9:210.

16.

Mafulul

, Onwuliri

, Onyimba

, Itelima

. Integron-associated multidrug resistance among gram-negative bacteria: A review. Microbiol Infect Dis, 2018; 2:1–6.

17.

Mejia

, Vela

, Zapata

. High occurrence of multiresistant Salmonella infantis in retail meat in Ecuador. Foodborne Pathog Dis, 2021; 18:41–48.

18.

Meurens

, Berri

, Auray

, Melo

, Levast

, Virlogeux-Payant

, Chevaleyre

, Gerdts

, Salmon

. Early immune response following Salmonella enterica subspecies enterica serovar Typhimurium infection in porcine jejunal gut loops. Vet Res, 2009; 40:5.

19.

Miller

, Liu

, McNamara

, Barber

. Influence of Salmonella in pigs preharvest and during pork processing on human health costs and risks from pork. J Food Prot, 2005; 68:1788–1798.

20.

Moura

, Henriques

, Ribeiro

, Correia

. Prevalence and characterization of integrons from bacteria isolated from a slaughterhouse wastewater treatment plant. J Antimicrob Chemother, 2007; 60:1243–1250.

21.

Newell

, Koopmans

, Verhoef

, Duizer

, Aidara-Kane

, Sprong

, Opsteegh

, Langelaar

, Threfall

, Scheutz

, Giessen J Van

Der

, Kruse

. Food-borne diseases—the challenges of 20 years ago still persist while new ones continue to emerge. Int J Food Microbiol, 2010; 139:S3–S15.

22.

Painter

, Hoekstra

, Ayers

, Tauxe

, Braden

, Angulo

, Griffin

. Attribution of food-borne illnesses, hospitalizations, and deaths to food commodities by using outbreak data, United States, 1998–2008. Emerg Infect Dis, 2013; 19:407–415.

23.

Partridge

, Hall

. Correctly identifying the streptothricin resistance gene cassette. J Clin Microbiol, 2005; 43:4298–4300.

24.

Partridge

, Tsafnat

, Coiera

, Iredell

. Gene cassettes and cassette arrays in mobile resistance integrons. FEMS Microbiol Rev, 2009; 33:757–784.

25.

Rönnqvist

, Välttilä

, Ranta

, Tuominen

. Salmonella risk to consumers via pork is related to the Salmonella prevalence in pig feed. Food Microbiol, 2018; 71:93–97.

26.

, Zhu

, Ren

, Guo

, Yang

, Jiao

, Wang

. Distribution and antimicrobial resistance of Salmonella isolated from pigs with diarrhea in China. Microorganisms, 2018; 6:117.

27.

, Shi

, Zhang

, Li

, Cao

, Li

, Yamasaki

. Nosocomial infection caused by class 1 integron-carrying Staphylococcus aureus in a hospital in South China. Clin Microbiol Infect, 2007; 13:980–984.

28.

Yue

, Li

, Liu

, Hu

. Serotypes, antibiotic resistance, and virulence genes of Salmonella in children with diarrhea. J Clin Lab Anal, 2020; 14:e23525.

29.

Zhang

, Ku

, Yu

, Sun

, Wu

, Chen

, Zhang

, Guo

, Tang

, He

. Prevalence and antimicrobial susceptibilities of bacterial pathogens in Chinese pig farms from 2013 to 2017. Sci Rep, 2019; 9:9908.

30.

Zhang

, Shi

, Li

, Guo

, Zhang

, Yamasaki

, Miyoshi

, Shinoda

. Identification and characterization of class 1 integron resistance gene cassettes among Salmonella strains isolated from healthy humans in China. Microbiol Immunol, 2004; 48:639–645.

31.

Zhao

, Yang

, Zhang

, Sun

, Chang

. Characterization of integrons and resistance genes in Salmonella isolates from farm animals in Shandong province, China. Front Microbiol 2017;8:1300.

32.

Zhu

, Zhi

, Qiu

, Wei

, Tian

, Pan

, Kang

, Gu

, Duan

. Surveillance study of the prevalence and antimicrobial resistance of Salmonella in pork from open markets in Xuzhou, China. Food Control, 2019; 98:474–480.

33.

Zhu

, Lai

, Zou

, Yin

, Wang

, Han

, Xia

, Hu

, He

, Zhou

, Chen

, Ao

, Liu

. Antimicrobial resistance and resistance genes in Salmonella strains isolated from broiler chickens along the slaughtering process in China. Int J Food Microbiol, 2017; 259:43–51.

Supplementary Material

Please find the following supplemental material available below.

For Open Access articles published under a Creative Commons License, all supplemental material carries the same license as the article it is associated with.

For non-Open Access articles published, all supplemental material carries a non-exclusive license, and permission requests for re-use of supplemental material or any part of supplemental material shall be sent directly to the copyright owner as specified in the copyright notice associated with the article.

0.00 MB

0.03 MB