Prevalence and Antimicrobial Resistance of Salmonella spp. in Aquacultured Nile Tilapia ( Oreochromis niloticus ) Commercialized in Federal District,Brazil

Abstract

This study aimed to assess Salmonella spp. prevalence in aquaculture Nile tilapia commercialized in the Federal District, Brazil, and determine the antimicrobial resistance profile of the isolates. Fifty-seven Salmonella spp. strains were isolated from 101 samples of fresh tilapia fillets collected in the Federal District, Brazil. These isolates were subjected to antimicrobial susceptibility testing by the Kirby–Bauer disk diffusion method and analyzed for the presence of blaCTX, tetB, sul2, and floR resistance genes. The Salmonella spp. prevalence in fresh tilapia fillets was 45.5%; that is, 46 of 101 samples were positive for the InvA gene. The antimicrobial resistance profile showed high resistance rates for amoxicillin/clavulanic acid (87.7%), tetracycline (82.5%), sulfonamide (57.9%), and chloramphenicol (26.3%). Additionally, 56.1% of Salmonella spp. isolates were multidrug-resistant (MDR) isolates. The beta-lactam-resistant gene blaCTX was identified in 66.7% of isolates, the tetracycline resistance gene tetA in 54.4%, and the chloramphenicol resistance gene floR in 50.9%, while the sulfonamide resistance gene sul2 was present in 49.1%. The results revealed that tilapia fillets were highly contaminated with MDR Salmonella. These Salmonella spp. strains carried multiple antimicrobial resistance genes, which might facilitate their dissemination to consumers along the production chain. Hence, there is an evident need to control Salmonella in fish production systems to ensure public health.

Introduction

Tilapia is the second most farmed freshwater fish worldwide, after carps (FAO, 2018). Today, all commercially important tilapia outside of Africa belong to the genus Oreochromis, and more than 90% of these farmed fish are Nile tilapia (Oreochromis niloticus) (Wang and Lu, 2015). In Brazil, strong consumer demand and continuous investments in the tilapia farming sector have resulted in continued production growth, with 311.500 tons produced in 2018, corresponding to 60% of the Brazilian aquaculture fish production (IBGE, 2018). Tilapia is considered one of the most accepted fish in the consumer market due to its attractive characteristics, such as white and tasty fillets (Barroso et al., 2019).

In recent years, tilapia fillet consumption has increased significantly in Brazil. Simultaneously, this food's safety, particularly related to microbiological contamination, has become a source of concern. Salmonella spp. is not part of the healthy fish microbiota, and its presence indicates fecal contamination either from polluted water or cross-contamination during the production chain (Wang and Lu, 2015; Fernandes et al., 2018). Salmonella spp. is one of the most widespread, zoonotic foodborne pathogens worldwide (Heredia and García, 2018; Draeger et al., 2019). In Brazil, Salmonella spp. is the second most prevalent foodborne pathogen, while Escherichia coli is the first (Draeger et al., 2019). The European Union reports salmonellosis as the second most prevalent zoonosis, after campylobacteriosis (Pepe et al., 2009; EFSA and ECDC, 2021). Therefore, the presence of Salmonella spp. in tilapia may represent a reason for an increasing number of enteric disease outbreaks (Heredia and García, 2018). Nevertheless, the prevalence of the gastrointestinal pathogen Salmonella in fish in Brazil is seldom reported in the literature (Fernandes et al., 2018).

The expanding antimicrobial resistance in foodborne pathogens, such as Salmonella spp., has caused a significant increase in public health safety concerns. The rise in resistant strains has been attributed to the inappropriate use of antimicrobial agents in human and veterinary medicine and their usage as growth promoters in animal production. This acquired antimicrobial resistance can be further transmitted to the human population through the food chain. Considering that multiresistant strains of Salmonella spp. have been isolated from different animal-origin foods worldwide, expanding resistance poses a serious threat to public health (Yang et al., 2015; Nair et al., 2018).

According to McMillan et al. (2019), Salmonella spp. can carry genes encoding resistance to several classes of antimicrobials, including β-lactams, tetracyclines, sulfonamides, and phenicols. The authors reported that a diverse group of plasmids present in strains of Salmonella enterica isolated from food animals, carrying antimicrobial resistance genes, is responsible for its phenotypic resistance. The antimicrobial resistance transfer ability between bacteria on mobile genetic elements can cause the rapid establishment of multidrug resistance in bacteria from animals, thus creating a foodborne risk to human health.

Few studies in Brazil have focused on Salmonella prevalence in tilapia and on its antimicrobial resistance characterization. Thus, this study evaluated Salmonella spp. prevalence in fresh tilapia fillet samples collected in the Federal District, Brazil, and determined the isolates' antimicrobial susceptibility and the presence of blaCTX, tetB, sul2, and floR resistance genes.

Materials and Methods

Sample collection, Salmonella isolation, and biochemical confirmation

From March 2018 to March 2020, 101 samples of fresh tilapia fillets were collected from different supermarkets in the Federal District, Brazil. These fish came from several Brazilian states (Paraná, São Paulo, Rondônia, Santa Catarina, Minas Gerais, and Federal District). Samples were stored in an icebox and immediately transported to the laboratory and analyzed within 2 h.

Salmonella strains were isolated as described in the Technical Guide for Laboratory Detection of Salmonella spp. (Brasil, Ministério da Saúde, 2011). For Salmonella spp. detection, in triplicate, 25 g of each sample was transferred into 225 mL of buffered peptone water (BPW; Kasvi, Brazil), homogenized, and incubated at 37°C for 18–20 h. Then, 1.0 mL each of the pre-enrichment BPW aliquots was transferred into 10 mL of tetrathionate broth (Himedia) and selenite cystine broth (Acumedia), respectively, and incubated at 37°C for 24 h. A loopful (10 μL) of enriched broth was streaked onto the xylose lysine deoxycholate (XLD) agar (Himedia) and Salmonella Shigella (SS) agar (Himedia) and incubated at 37°C for 24 h. Presumptive Salmonella colonies in XLD and SS agars were confirmed biochemically using triple sugar iron (TSI) agar (Himedia) and lysine iron agar (LIA; Himedia) slants. These slants were incubated at 37°C for 24 h. The presumptive Salmonella isolates, tested positive on TSI and LIA biochemical testing, were confirmed by amplifying a targeted Salmonella-specific invasive (invA) gene by polymerase chain reaction (PCR; Table 1).

Table 1.

Primer Sequences and Polymerase Chain Reaction Conditions Used to Amplify the Virulence Gene InvA and the Resistance Genes, blaCTX, tetB, sul2, and floR

Target gene	Primer sequence (5′→ 3′)	Product size (bp)	PCR amplification conditions	Reference
invA	CATTGGTGATGGTCTTGTCG	298	Denaturation for 2 min at 95°C, followed by 35 cycles for 1 min at 95°C, annealing for 1 min at 60°C, and a final extension for 1 min at 72°C	Cruz et al. (2019)
invA	CTCGCCTTTGCTGGTTTTAG	298		Cruz et al. (2019)
blaCTX	CGATGTGCAGTACCAGTAA	585	Denaturation for 5 min at 94°C, followed by 30 cycles for 30 s at 94°C, annealing for 30 s at 55°C, 50 s at 72°C, and a final extension for 7 min at 72°C	Li et al. (2013)
blaCTX	AGTGACCAGAATCAGCGG	585		Li et al. (2013)
tetB	TTGGTTAGGGGCAAGTTTTG	659	Denaturation for 5 min at 94°C, followed by 34 cycles for 25 s at 94°C, annealing for 30 s at 55°C, 50 s at 72°C, and a final extension for 7 min at 72°C	Zishiri et al. (2016)
tetB	GTAATGGGCCAATAACACCG	659		Zishiri et al. (2016)
sul2	GCGCTCAAGGCAGATGGCATT	285	Denaturation for 10 min at 95°C, followed by 35 cycles for 45 s at 94°C, annealing for 50 s at 55°C, 50 s at 72°C, and a final extension for 10 min at 72°C	Zhu et al. (2017)
sul2	GCGTTTGATACCGGCACCCGT	285		Zhu et al. (2017)
floR	CACGTTGAGCCTCTATAT	868	Denaturation for 5 min at 94°C, followed by 30 cycles for 30 s at 94°C, annealing for 30 s, 1 min at 72°C, and a final extension for 5 min at 72°C	Thai et al. (2012)
floR	ATGCAGAAGTAGAACGCG	868		Thai et al. (2012)

PCR, polymerase chain reaction.

Antimicrobial susceptibility testing

Antimicrobial susceptibility testing was performed following the standard Kirby–Bauer disk diffusion method as per Brazilian Committee on Antimicrobial Susceptibility Testing (BRCAST, 2019) guidelines. The bacterial inoculum was obtained from a microbial growth suspension in Mueller-Hinton broth with turbidity equivalent to 0.5 McFarland standard (1.0 × 108 CFU/mL), adjusted to an optical density between 0.08 and 0.10 at 625 nm using a spectrophotometer (BRCAST, 2019). All the antimicrobial disks were purchased from Newprov (Brazil). The analyzed antimicrobial agents' concentrations and abbreviations are as described: amoxicillin/clavulanic acid (AMC, 20/10 μg), ceftazidime (CAZ, 30 μg), cefotaxime (CTX, 30 μg), gentamicin (GEN, 10 μg), chloramphenicol (CLO, 30 μg), tetracycline (TET, 30 μg), imipenem (IMP, 10 μg), sulfonamide (SUL, 300 μg), and ciprofloxacin (CIP, 5 μg). The isolates were classified as susceptible (S), intermediate (I), or resistant (R), according to the CLSI guidelines for Enterobacteriaceae (CLSI, 2020). Salmonella isolates resistant to three or more antimicrobials were defined as multidrug-resistant (MDR) isolates.

Salmonella molecular confirmation and antimicrobial resistance gene detection by PCR

The InvA gene PCR amplification confirmed the biochemically presumptive Salmonella isolates. The confirmed strains (n = 57) were then screened, by PCR, for the presence of antimicrobial resistance genes: blaCTX for beta-lactams, tetB for tetracycline, sul2 for sulfonamide, and floR for chloramphenicol.

For DNA extraction, the biochemically identified Salmonella isolates were cultivated overnight in Mueller-Hinton broth and their DNA was extracted by employing the NucleoSpin Food^® kit (Macherey-Nagel, Düren, Germany), as per the manufacturer's instructions. The DNA concentrations were then determined using a NanoDrop 2000 (Thermo Scientific, Pittsburgh), and DNA integrity was confirmed by agarose gel electrophoresis.

Table 1 shows the primer sequences and PCR conditions used to amplify the virulence gene InvA and the resistance genes, blaCTX, tetB, sul2, and floR. All PCRs were performed in a 25-μL final volume reaction mixture containing 2.5 μL of PCR buffer; 0.7 μL of MgCl2; 1.5 μL of dNTP (2.5 mM); 0.5 μL of Taq DNA polymerase; 1.5 μL of each primer, forward and reverse; and 18.3 μL of Milli-Q water. These thermal cycling reactions were conducted with Techne TC-512 thermal cycler (Bibby Scientific, Inc.), and each PCR run included negative and reagent controls. The reagent control consisted of all PCR components except for the DNA template. The amplified DNA was separated by electrophoresis at 100 V for 50 min in 1.5% (w/v) agarose gel, stained with ethidium bromide, and visualized under UV light. A 100 bp DNA ladder was used as a molecular weight marker.

Results

Salmonella spp. prevalence in fresh tilapia fillets

Salmonella spp. prevalence was 45.5%, that is, 46 of 101 samples of fresh tilapia fillets analyzed presented this bacterium confirmed by invA gene detection.

Antimicrobial resistance profile of Salmonella isolates

Figure 1 shows the antimicrobial resistance profile of 57 Salmonella isolates. Overall, only 5.3% (3/57) of isolates were susceptible to all tested antimicrobials and 38.6% (22/57) were resistant to one or two antimicrobials, while 56.1% (32/57) presented multidrug resistance (Table 2). High resistance rates were observed for amoxicillin/clavulanic acid (87.7%, 50/57), tetracycline (82.5%, 47/57), sulfonamide (57.9%, 33/57), and chloramphenicol (26.3%, 15/57), whereas lower resistance rates were found for ciprofloxacin (1.8%), imipenem (1.8%), ceftazidime (3.5%), and cefotaxime (3.5%). Notably, all the isolates were susceptible to gentamicin.

FIG. 1.

Antimicrobial resistance profile of Salmonella isolates.

Table 2.

Antimicrobial Resistance and Multidrug Resistance Profile of Salmonella Isolates

No. of antimicrobials with resistance	Number and percentage of isolates
No. of antimicrobials with resistance	n	%
0	3	5.3
1	5	8.8
2	17	29.8
3	19	33.3
4	11	19.3
5	2	3.5
Total	57	100
MDR (sum of 3, 4, and 5)	32	56.1

MDR, multidrug-resistant.

Mainly, 12 resistance patterns of Salmonella isolates were detected, as seen in Table 3. The dominant resistance pattern was SUL AMC TET (24.6%, 14/57), followed by AMC TET (21.1%, 12/57) and SUL AMC TET CLO (17.5%, 10/57).

Table 3.

Antimicrobial Resistance Patterns of Salmonella Isolates

Resistant phenotypes		n	%
1	CAZ AMC CTX TET CLO	1	1.8
2	SUL CAZ AMC CTX TET	1	1.8
3	SUL AMC TET CLO	10	17.5
4	SUL IMP AMC TET	1	1.8
5	AMC TET CLO	4	7.0
6	SUL AMC TET	14	24.6
7	SUL CIP AMC	1	1.8
8	AMC TET	12	21.1
9	SUL AMC	2	3.5
10	SUL TET	3	5.3
11	AMC	4	7.0
12	SUL	1	1.8

AMC, amoxicillin/clavulanic acid; CAZ, ceftazidime; CIP, ciprofloxacin; CLO, chloramphenicol; CTX, cefotaxime; GEN, gentamicin; IMP, imipenem; SUL, sulfonamide; TET, tetracycline.

Antimicrobial resistance genotypes of Salmonella isolates

Antimicrobial resistance genes were screened in all 57 Salmonella isolates and 66.7% (38/57) presented the blaCTX gene associated with resistance to beta-lactams, 54.4% (31/57) presented the tetb gene associated with resistance to tetracycline, 49.1% (28/57) presented the sul2 gene associated with resistance to sulfonamide, and 50.9% (29/57) presented the floR gene associated with resistance to chloramphenicol (Table 4). Resistance genes were also detected in phenotypically susceptible and intermediate isolates (Table 4), blaCTX in 8.8% (4/38), tetb in 7.0% (4/31), and sul2 in 15.8% (8/28), whereas floR was detected in 31.6% (18/29).

Table 4.

Presence of Antimicrobial Resistance Genes Screened from 57 Salmonella Isolates

Resistance genes	Antimicrobial resistance profile			Total n (%)
Resistance genes	R n (%)	S n (%)	I n (%)	Total n (%)
blaCTX	33 (57.9)	1 (1.8)	3 (7.0)	38 (66.7)
tetb	27 (47.4)	2 (3.5)	2 (3.5)	31 (54.4)
sul2	19 (33.3)	6 (10.5)	3 (5.3)	28 (49.1)
floR	11 (19.3)	14 (24.6)	4 (7.0)	29 (50.9)

Table 5 displays the various resistance gene patterns found in each of the Salmonella isolates. All 57 Salmonella strains in this study, including those susceptible to all antimicrobials, had at least one of the resistance genes tested in their genome. The isolated Salmonella registered 15 distinct genotype resistance profiles, indicating considerable resistance gene pattern diversity.

Table 5.

Antimicrobial Resistance Genotype Patterns of Salmonella Isolates

	Resistance genes	n	%
1	blaCTX, tetB, sul2, floR	5	8.8
2	blaCTX, sul2, floR	5	8.8
3	blaCTX, tetB, floR	4	7.0
4	blaCTX, tetB, sul2	2	3.5
5	tetB, sul2, floR	4	7.0
6	blaCTX, floR	7	12.3
7	blaCTX, sul2	3	5.3
8	blaCTX, tetB	5	8.8
9	tetB, floR	1	1.8
10	tetB, sul2	5	8.8
11	sul2, floR	1	1.8
12	blaCTX	6	10.5
13	Tetb	4	7.0
14	sul2	3	5.3
15	floR	2	3.5
Total		57	100

Discussion

Salmonella spp. prevalence in fresh tilapia fillets commercialized in Federal District, Brazil, was 45.5%; that is, 46 samples were unfit for consumption according to the Brazilian legislation, which prohibits the Salmonella spp. presence in fish (Brasil, Agência Nacional Vigilância Sanitária, 2019). Other studies also reported high rates of tilapia contamination with Salmonella. Budiati et al. (2013) isolated Salmonella spp. from 43.8% (14/32) of the tilapia samples obtained from Malaysia. Elhadi (2014) reported a 64.9% Salmonella spp. prevalence in tilapia imported from Thailand and 28.0% prevalence in those imported from India. Seel et al. (2016) found that of 20 fresh tilapia samples collected in different Bangladesh markets, 75% (15/20) were positive for Salmonella spp. Lerma-Fierro et al. (2020) also detected Salmonella spp. in 41.7% (5/12) of fresh Nile tilapia fillets marketed in Tepic Nayarit city, Mexico.

Similar to our study, Zishiri et al. (2016) used the invA gene to confirm Salmonella spp. isolated from commercial chickens in South Africa and Brazil. The invasion A gene (invA) is a well-known virulence gene in Salmonella, which is responsible for host invasion. This gene located in Salmonella pathogenicity island 1 (SPI-1) is conserved in all Salmonella serovars. Consequently, researchers use it as a marker to detect Salmonella isolated from different sources (Zishiri et al., 2016).

This study demonstrated a high incidence of resistance to amoxicillin/clavulanic acid (87.7%), tetracycline (82.5%), and sulfonamide (57.9%) in Salmonella isolates. These results were comparable with findings of Elhadi (2014), in which the highest antimicrobial resistance was for tetracycline (90%) and amoxicillin/clavulanic acid (45%) in Salmonella spp. isolated from freshwater fish imported by the eastern province of Saudi Arabia. Zhang et al. (2015) reported high resistance to sulfonamides (56.5%) and tetracycline (34.1%) in Salmonella serovars isolated from retail aquaculture products in China. The resistance to chloramphenicol (26.3%) observed in our study was similar to findings of Budiati et al. (2013), in which Salmonella isolates were resistant to chloramphenicol (37.2%) and tetracycline (67.4%). Furthermore, MDR Salmonella spp. was often found in our study (56.1%). Yang et al. (2015) and Zhang et al. (2015) reported 34.0% and 43.3%, respectively, of MDR Salmonella isolated from aquatic food products from retail markets in China. This increased antimicrobial resistance of Salmonella may limit therapeutic options for treating salmonellosis in humans and animals (Elhadi, 2014; Heredia and García, 2018).

Among the 87.7% (50/57) isolates of Salmonella resistant to amoxicillin/clavulanic acid, 57.9% (33/57) presented the resistance gene blaCTX. Studies have exposed a wide range of beta-lactamase genes occurring in Salmonella. Moreover, among Enterobacteriaceae, including Salmonella, the blaCTX gene is the most widespread beta-lactamase-resistant gene and is mainly associated with a diverse set of transmissible plasmids (Zhang et al., 2019).

In this study, 47.4% (27/57) of the 82.5% (47/57) isolates of Salmonella phenotypically resistant to tetracycline presented the resistance gene tetB. According to Zishiri et al. (2016), tetA and tetB are the most common genes found in tetracycline-resistant Salmonella isolates. These genes are responsible for encoding efflux pumps associated with plasmids, transposons, or both and are often conjugative, highlighting the potential transference of these genes to other bacteria, environment, animals, and humans (Mąka and Popowska, 2016).

The resistance gene sul2 was present in 33.3% (19/57) of the 57.9% (33/57) isolates of Salmonella phenotypically resistant to sulfonamide. The two most frequently found genes among sulfonamide-resistant isolates are sul1 and sul2, both encode forms of dihydropteroate synthase whose product has a low affinity for sulfonamides. The sul1 gene is regularly linked to other resistance genes in class 1 integrons, while the sul2 gene is usually associated with small multicopy plasmids or large, transmissible multiresistance plasmids (Mąka et al., 2015).

Among the 26.3% (15/57) of Salmonella isolates phenotypically resistant to chloramphenicol, 19.3% (11/57) had the resistance gene floR. This gene has been identified mainly in Gram-negative bacteria and is responsible for encoding drug efflux pumps. It has been identified on both chromosomes and plasmids, often associated with mobile genetic elements and genomic islands (Lu et al., 2018).

Our study also detected resistant genes in phenotypically susceptible and intermediate isolates. Curiously, the floR gene was more prevalent in phenotypically susceptible and intermediate isolates than in resistant isolates. According to Adesiji et al. (2014), some antimicrobial-resistant genes are silent in bacteria in vitro and can spread to other bacteria or turn on in vivo, especially under the selective pressure of antibiotic use.

The extensive use of antimicrobials in animal production systems for controlling bacterial infections and growth promotion has contributed to the development of drug-resistant bacteria. The fecal excretion of antibiotic-resistant pathogens such as Salmonella from livestock and poultry causes water system contamination. Aquaculture isolates have shown similar resistance patterns to the isolates recovered from terrestrial agriculture, indicating that the water source contamination comes from farmland (Nair et al., 2018). According to Wang and Lu (2015), integrated fish farming involves raising fish alongside livestock, and aquatic environment and product investigations revealed an increase of pathogens, such as Salmonella, in the water and intestine of tilapia in these cases.

Conclusions

This study revealed a high Salmonella spp. prevalence in fresh tilapia fillets collected in the Federal District, Brazil. Furthermore, these Salmonella isolates frequently exhibited multidrug resistance patterns, and antimicrobial resistance genes, blaCTX, tetB, sul2, and floR, were also prevalent among them. This high Salmonella spp. occurrence in fresh tilapia fillets indicates the need for programs to monitor microbiological safety in tilapia production systems and rational use of antimicrobials in aquaculture production to reduce the risk of developing and spreading antimicrobial resistance.

Footnotes

Disclosure Statement

No competing financial interests exist.

Funding Information

This research was funded by Coordenação de Aperfeiçoamento de Pessoal de Nível Superior, Brasil (CAPES - Finance Code 001), by Fundação de Apoio à Pesquisa do Distrito Federal (FAPDF - Edital 3/2018), and by UnB (Edital DPG 0004/2021).

References

Adesiji

, Deekshit

, Karunasagar

. Antimicrobial-resistant genes associated with Salmonella spp. isolated from human, poultry, and seafood sources. Food Sci Nutr, 2014; 2:436–442.

Barroso

, Muñoz

AEP

, Cai

. Social and economic performance of tilapia farming in

Brazil

. FAO Fisheries and Aquaculture

Circular no

. 1181. Rome, FAO. Licence: CC BY-NC-SA 3.0 IG, 2019.

Brasil, Agência Nacional Vigilância

Sanitária

. Instrução normativa n° 60, de 23 de dezembro de 2019. Establish the lists of microbiological standards for foods. 2019. Available at: https://www.gov.br/agricultura/pt-br/assuntos/inspecao/produtos-vegetal/legislacao-1/biblioteca-de-normas-vinhos-e-bebidas/instrucao-normativa-ndeg-60-de-23-de-dezembro-de-2019.pdf/view accessed November 5, 2020 .

Brasil

Ministério da Saúde

. Secretaria de Vigilância Sanitária. Manual Técnico de Diagnóstico Laboratorial de Salmonella spp. 1th Edition, Brasília: Ministério da Saúde, 2011.

[BRCAST] Brazilian Committee on Antimicrobial Susceptibility Testing. Disc-diffusion method for antimicrobial susceptibility testing. 2019. Available at: http://brcast.org.br/documentos/ accessed March 5, 2021 .

Budiati

, Rusul

, Wan-Abdullah

, Arip

, Ahmad

, Thong

. Prevalence, antibiotic resistance and plasmid profiling of Salmonella in catfish (Clarias gariepinus) and tilapia (Tilapia mossambica) obtained from wet markets and ponds in Malaysia. Aquaculture, 2013; 372:127–132.

[CLSI] Clinical and Laboratory Standards Institute. Performance Standards for Antimicrobial Susceptibility Testing. 30th ed. Wayne: CLSI M100, 2020.

Cruz

MRG

, Leite

YJBS

, Marques

, Pavelquesi

SLS

, Oliveira

LRA

, Silva

ICR

, Orsi

. Microbiological quality of minimally processed vegetables commercialized in Brasilia, DF, Brazil. Food Sci Technol, 2019; 39(Suppl. 2):498–503.

Draeger

, Akutsu

RCCA

, Zandonadi

, da Silva

ICR

, Botelho

RBA

, Araújo

WMC

. Brazilian foodborne disease national survey: Evaluating the landscape after 11years of implementation to advance research, policy, and practice in public health. Nutrients, 2019; 40:2–10.

10.

[ EFSA and EC DC] European Food Safety Authority and European Center for Disease Prevention and

Control

. The European Union one health 2019 zoonoses report. EFSA J, 2021; 191–283.

11.

Elhadi

. Prevalence and antimicrobial resistance of Salmonella spp. in raw retail frozen imported freshwater fish to Eastern Province of Saudi Arabia. Asian Pac J Trop Biomed, 2014; 4:234–238.

12.

[FAO] Food and Agriculture Organization of the United Nations. Tilapia markets and producers diversifying as traditional large players lag. Globefish—Analysis and information on world fish trade. 2018. Available at: http://www.fao.org/in-action/globefish/market-reports/resource-detail/en/c/1156017 accessed June 22, 2020 .

13.

Fernandes

DVGS

, Castro

, da Cunha Neto

, Figueiredo

EES

. Salmonella spp. in the fish production chain: A review. Cienc Rural, 2018; 48:1–11.

14.

Heredia

, García

. Animals as sources of food-borne pathogens: A review. Anim Nutr, 2018; 4:250–255.

15.

[IBGE] Instituto Brasileiro de Geografia e Estatística. Produção da Pecuária Municipal. 2018. Available at: https://biblioteca.ibge.gov.br/visualizacao/periodicos/84/ppm_2018_v46_br_informativo.pdf accessed July 25, 2020 .

16.

Lerma-Fierro

, Flores-López

, Guzmán-Robles

, Cortés-Sánchez

. Microbiological evaluation of minimally processed and marketed fish in popular market of the city of Tepic Nayarit, Mexico sanitary quality of tilapia (Oreochromis niloticus). Tropic, 2020; 38 :1–19.

17.

, Lai

, Wang

, Liu

, Li

, Liu

, Shen

, Wu

. Prevalence, and characterization of Salmonella species isolated from pigs, ducks and chickens in Sichuan Province, China. Int J Food Microbiol, 2013; 163:14–18.

18.

, Zhang

, Xu

, Liu

, Li

, Zhu

, Cheng

, Lu

, Xu

, Yi

, Li

, Zhou

, Li

, Ni

, Bao

. Spread of the florfenicol resistance floR gene among clinical Klebsiella pneumoniae isolates in China. Antimicrob Resist Infect Control, 2018; 7:2–9.

19.

Mąka

, Maćkiw

, Ścieżyńska

, Modzelewska

, Popowska

. Resistance to sulfonamides and dissemination of sul genes among Salmonella spp. isolated from food in Poland. Foodborne Pathog Dis, 2015; 12:383–389.

20.

Mąka Ł, Popowska

. Antimicrobial resistance of Salmonella spp. isolated from food. Rocz Panstw Zakl Hig, 2016; 67:343–358.

21.

McMillan

, Gupta

, Williams

, Jové

, Hiott

, Woodley

, Barrett

, Jackson

, Wasilenko

, Simmons

, Tillman

, McClelland

, Frye

. Antimicrobial resistance genes, cassettes, and plasmids present in Salmonella enterica associated with United States food animals. Front Microbiol, 2019; 10:1–18.

22.

Nair

DVT

, Venkitanarayanan

, Johny

. Antibiotic-resistant Salmonella in the food supply and the potential role of antibiotic alternatives for control. Foods, 2018; 7:3–24.

23.

Pepe

, Dominicis

, Esposito

, Ventrone

, Fratamico

, Cortesi

. Detection of Campylobacter from poultry carcass skin samples at slaughter in Southern Italy. J Food Prot, 2009; 72:1718–1721.

24.

Seel

, Kabir

SML

, Islam

. Molecular detection and characterization of Salmonella spp. isolated from fresh fishes sold in selected Upazila markets of Bangladesh. Bangl J Vet Med, 2016; 14 :283–287.

25.

Yang

, Wu

, Zhang

, Huang

, Chen

, Liu

, Yu

, Ca

. Prevalence, enumeration, and characterization of Salmonella isolated from aquatic food products from retail markets in China. Food Control, 2015; 57:308–313.

26.

Wang

, Lu

. Tilapia polyculture: A global review. Aquac Res, 2015; 1–12.

27.

Thai

, Lan

, Hirai

, Yamaguchi

. Antimicrobial resistance in Salmonella serovars isolated from meat shops at the markets in North Vietnam. Foodborne Pathog Dis, 2012; 9:986–991.

28.

Zhang

C-Z

, Ding

X-M

, Lin

X-L

, Sun

R-Y

, Lu

Y-W

, Cai

R-M

, Webber

, Ding

H-Z

, Jiang

H-X

. The emergence of chromosomally located blaCTX-M-55 in Salmonella from foodborne animals in China. Front Microbiol, 2019; 10:1–8.

29.

Zhang

, Yang

, Kuang

, Shi

, Xiao

, Zhang

, Gu

, Xu

, Men

. Prevalence of antimicrobial resistance of nontyphoidal Salmonella serovars in retail aquaculture products. Int J Food Microbiol, 2015; 210:47–52.

30.

Zhu

, Lai

, Zow

, Yin

, Wang

, Han

, Xia

, Hu

, He

, Zhou

, Chen

, Ao

, Liu

. Antimicrobial resistance and resistance genes in Salmonella strains isolated from broiler chickens along the slaughtering process in China. Int J Food Microbiol, 2017; 259:43–51.

31.

Zishiri

, Mkhize

, Mukaratirwa

. Prevalence of virulence and antimicrobial resistance genes in Salmonella spp. isolated from commercial chickens and human clinical isolates from South Africa and Brazil. Onderstepoort J Vet Res, 2016; 83:1–11.