Occurrence,Antimicrobial Resistance Profile,and Characterization of Extended-Spectrum β-Lactamase–Producing Escherichia coli Isolates from Minced Meat at Local Markets in Thailand

Abstract

Extended-spectrum β-lactamase (ESBL)–producing Escherichia coli exhibits strong multidrug resistance (MDR) to ampicillin and third-generation cephalosporins. This study examined the occurrence, antimicrobial susceptibility, and molecular genetic features of ESBL-producing E. coli isolates from three commonly consumed minced meat varieties, namely pork, chicken, and beef. In total, 150 samples were collected from 10 local markets in Thailand. ESBL-producing E. coli was identified in 78 samples (52%), and minced chicken meat was most contaminated (79.17%). The isolates exhibited potential susceptibility to amikacin (96.16%) and carbapenems (91–95%). However, ESBL-producing E. coli displayed strong resistance to ampicillin and cefpodoxime (100%) and high MDR to 3–5 antibiotic classes (94.87%). Most presumptive ESBL producers harbored ESBL resistance genes (97.44%), most commonly bla_TEM (78.21%). Indeed, our results demonstrated that raw minced meat has a high occurrence of ESBL-producing E. coli harboring ESBL resistance genes, highlighting the importance of implementation of sanitary handling practices to reduce microbial contamination in commercial meat as well as the need for consumer education on safe handling and cooking of meat products.

Introduction

E scherichia coli is the most common commensal Gram-negative rod bacterium found in the intestinal tract in warm-blooded species, and it is used as an industrial food safety indicator (Gözde and Emek, 2019; Ramos et al., 2020). E. coli are common bacteria that exist as normal flora. However, some E. coli strains produce a toxin that can cause severe foodborne illness and bacteremia in humans and animals (Ramos et al., 2020). Extended-spectrum β-lactamase (ESBL)–producing E. coli also has implications in human and veterinary medicine, and it exhibits multidrug resistance (MDR), particularly against ampicillin and third-generation cephalosporins (Ramos et al., 2020).

ESBL-producing E. coli are a concern in health care settings and the community. They can rapidly spread and cause or complicate infections in healthy people. ESBL-producing E. coli is transmitted through the fecal or oral route, and it can be present in several foods such as meat, vegetable, and fruit (Boonyasiri et al., 2014; Kim et al., 2018; Ramos et al., 2020). Therefore, identifying the sources of exposure to ESBL-producing E. coli is crucial for providing information about consumption by people and reducing the risk of infectious disease.

Meat consumption had globally increased by consumers during the 2020s (OECD et al., 2020). The consumption of the most commonly consumed meats including pork, poultry, beef, and lamb also will predictably increase in Thailand by 2029 to 10.2, 8.7, 1.3, and 0.1 kg/capita, respectively (OECD et al., 2020). Consuming raw or undercooked meat can increase the risk of exposure to microbial contamination. Raw minced or ground meat is popular, and it is a common ingredient in several recipes.

Thai people frequently prepare minced meat for dishes such as soups, curry, and salads. Furthermore, meat, regardless of the style of preparation, is higher in nutrients, especially essential amino acids (De Smet and Vossen, 2016; Rabia et al., 2018). A balanced diet containing meat also has implications for human health (De Smet and Vossen, 2016; Rabia et al., 2018). However, raw meat can increase the risk of microbial contamination (Biswas et al., 2011). Previous studies reported that ESBL-producing E. coli could be present in meat such as chicken, pork, and beef, but few reports have discussed ESBL-producing E. coli contamination in minced meat (Kaesbohrer et al., 2019; Mgaya et al., 2021).

This study investigated the occurrence, antimicrobial susceptibility, and genetic characteristics of ESBL-producing E. coli isolated from raw minced meat samples, namely chicken, pork, and beef, from retail local markets in southern Thailand.

Materials and Methods

Minced meat collection

In total, 150 minced raw meat samples (50 g) including pork (80), chicken (48), and beef (22) were randomly purchased from 10 local retail markets located in Mueang (4), Tha Sala (4), and Sichon (2) in Nakhon Si Thammarat, Thailand. All the samples were collected between January 2021 and February 2021. The sample selection is based on a nonprobability sampling method, which selects markets by convenience sampling. After purchase, the samples were labeled and stored in sterile containers at 4°C until analysis, which was performed within 24 h.

Bacteria identification and presumptive ESBL-producing bacterium isolation

The samples (25 g) were weighted, suspended in 225 mL of 0.1% buffered peptone water (Oxoid, Hampshire, United Kingdom), and incubated at 37°C for 24 h. To screen ESBL-producing bacteria, microbial enrichments were streaked onto ESBL agar (HiMedia Laboratories, Mumbai, India) and incubated for 24 h at 37°C with aerobics. The E. coli colonies were pink to purple. The E. coli isolates were then identified and confirmed by matrix-assisted laser desorption ionization-time of flight mass spectrometry (MALDI-TOF MS) (Romyasamit et al., 2021). In brief, isolated colonies were spotted onto MALDI target plate. After drying, the spots were covered with matrix solution. All mass spectra were acquired using an Autoflex II. The data were analyzed with Flexanalysis version 2.4. The confirmed isolates were stored at 2°C–8°C until future testing.

Confirmation of ESBL-producing isolates

The double disk synergy method was used to confirm ESBL-producing isolates after they displayed strong resistance to cefotaxime (CTX) (≤27 mm) and ceftazidime (CAZ) (≤22 mm). E. coli suspensions were placed on Muller–Hinton agar (MHA). Then, 30 μg CTX and CAZ disks were placed at the center of the plate, and disks containing CTX plus clavulanic acid (30/10 μg) or CAZ plus clavulanic acid (30/10 μg) were placed 20 mm from the central disk on the same plate. All plates were incubated at 37°C for 24 h. Isolates with inhibition zone diameters of ∼5 mm were considered ESBL producers, as recommended by the 2020 Clinical and Laboratory Standards Institute (CLSI) guidelines (CLSI, 2020).

Antibiotic susceptibility testing

To examine the antibiotic sensitivity of ESBL-producing E. coli isolated from minced meat, the Kirby–Bauer disk diffusion technique was used. The isolates were suspended and inoculated onto MHA. The inoculated plates were then treated with β-lactam (ampicillin [AMP, 10 μg], imipenem [IMP, 10 μg], meropenem [MEM, 10 μg], CTX [30 μg], ceftriaxone [CRO, 30 μg], CAZ [30 μg], cefpodoxime [CPD, 10 μg], and aztreonam [ATM, 30 μg]) and non-β-lactam antibiotics (amikacin [AK, 30 μg], gentamycin [GM, 10 μg], and tetracycline [TE, 30 μg]). All plates were incubated at 37°C for 24 h. The inhibition zone was measured and interpreted through comparison with Kirby–Bauer's inhibition zone chart as recommended by the CLSI 2020 guidelines. MDR was defined as resistance to at least one agent in more than equal to three antimicrobial classes (Magiorakos et al., 2012; Abayneh et al., 2019).

DNA extraction

Overnight cultures of E. coli isolates in tryptic soy broth were centrifuged at 8000 g for 5 min and washed three times in Tris-EDTA buffer. The cells were resuspended in 250 μL of Tris-EDTA buffer and boiled using a heating box for 10 min. After immediate cooling on ice for 10 min, cells were centrifuged at 8000 g for 5 min. The supernatant was transferred to a 1.5-mL polymerase chain reaction (PCR) tube. DNA was evaluated for purity using a NanoDrop 2000c spectrophotometer at A260/280 (Thermo Fisher Scientific, Wilmington, DE) and stored at −20°C until use.

Characterization of genotypic ESBL-producing isolates

Multiplex PCR was used to screen ESBL-producing genes, including bla_CTX-M , bla_TEM , and bla_SHV from ESBL-positive E. coli isolates. Specific primers were designed, as presented in Table 1 (Monstein et al., 2007). Multiplex PCR (20 μL) was performed using 1 × Hot FIREPol^® MultiPlex Mix (Solis BioDyne, Tartu, Estonia) containing 1 U of DNA polymerase, 1 × multiplex buffer with 2 mM MgCl₂, and 400 μM dNTPs. In addition, forward and reverse primers (0.4 mM), 5 ng/μL of template DNA (2 μL), and H₂O₂ (12.8 μL) were added to the reaction. The PCR cycling conditions comprised of predenaturation at 95°C for 10 min before the denaturation, annealing, and extension steps. The final step was extension at 72°C for 10 min. DNA amplification was then performed for 30 repetitive cycles. After PCR processing, PCR products were analyzed by 1.5% agarose gel electrophoresis in TBE buffer at 120 V for 30 min.

Table 1.

Primers Used for Multiplex-Polymerase Chain Reaction Amplification

Genes	Primer names	Primer sequences	Product size (bp)	Reference
bla_CTX-M	CTX-M-U1	ATGTGCAGACCAGTAAGATGGC	593	Monstein et al. (2007)
bla_CTX-M	CTX-M-U2	TGGGTAATAGTACCAGAACAGCGG
bla_TEM	TEM-164.SE	TCGCCGCATACACTATTCTCAGAATGA	445
bla_TEM	TEM-165.AS	ACGCTCACCGGCTCCAGATTTAT
bla_SHV	SHV.SE	ATGCGTTATATTCGCCTGTG	747
bla_SHV	SHV.AS	TGCTTTGTTATTCGGGCCAA

Results

Occurrence of ESBL-producing bacteria in minced meat samples

ESBL-producing and non-ESBL-producing E. coli isolates were found in 78 (52%) and 72 (48%) samples, respectively (Table 2). Among seventy-eight ESBL-producing E. coli that were frequently found in minced chicken (38/48 samples, 79.17%), pork (35/80 samples, 43.75%), and beef (5/22 samples, 22.73%). The occurrence of ESBL-producing E. coli isolates in minced meat differed by location (Table 2). ESBL-producing E. coli was frequently found in samples from Sichon (66.67%), Mueang (52.87%), and Tha Sala (42.86%) markets. The occurrence of ESBL-producing E. coli in four markets in an urban area (Mueang) was moderate to high (45–100%). Variable growth was also detected in minced meat (44–69%).

Table 2.

Occurrence of Extended-Spectrum β-Lactamase–Producing Escherichia coli in Minced Meat from Retail Markets in Mueang, Tha Sala, and Sichon Districts, Nakhon Si Thammarat, Thailand

Original market	Location	Total no. of ESBL producers		Meat samples
		Total no. of ESBL producers		Pork		Chicken		Beef
		No. of ESBL producers (n)	%	No. of ESBL producers (n)	%	No. of ESBL producers (n)	%	No. of ESBL producers (n)	%
A	Mueang	6 (8)	75	4 (5)	80	2 (3)	66.67	0	0
B		19 (37)	51.35	11 (20)	55	8 (14)	57.14	0 (3)	0
C		18 (40)	45	6 (25)	24	9 (11)	81.82	3 (4)	75
D		2 (2)	100	0	100	1 (1)	100	1 (1)	100
Total		46 (87)	52.87	22 (50)	44	20 (29)	68.97	4 (8)	50
E	Tha Sala	3 (7)	42.86	1 (4)	25	2 (2)	100	0 (1)	0
F		5 (12)	41.67	1 (4)	25	4 (4)	100	0 (4)	0
G		6 (12)	50	1 (3)	33.33	5 (6)	83.33	0 (3)	0
H		4 (11)	36.36	1 (5)	20	3 (3)	100	0 (3)	0
Total		18 (42)	42.86	4 (16)	25	14 (15)	93.33	0 (11)	0
I	Sichon	0 (3)	0	0 (3)	0	0	0	0	0
J	Sichon	14 (18)	77.78	9 (11)	81.82	4 (4)	100	1 (3)	33.33
Total		14 (21)	66.67	9 (14)	64.29	4 (4)	100	1 (3)	33.33
Total		78 (150)	52	35 (80)	43.75	38 (48)	79.17	5 (22)	22.73

A, Thaphae Market; B, Khu Khwang Fresh Market; C, Hua It Market; D, Corner Fresh Market; E, Nub Anusorn Fresh Market; ESBL, extended-spectrum β-lactamase; F, Choice Fresh Market; G, Wat Node Market; H, Ban Klai Fresh Market; I, Mae Kim Song Fresh Market; J, Thewada Fresh Market.

Contamination by ESBL-producing E. coli in all three meat types (minced pork (24%), chicken (81.82%), and beef (75%)) was observed in only one market in Mueang. Furthermore, high rates of ESBL-producing E. coli contamination were found in two markets in a rural area (Sichon, >50%). Of these two markets, only one had contamination by ESBL-producing E. coli isolates in minced pork (81.82%), chicken (100%), and beef (33.33%). Conversely, low rates of total ESBL-producing E. coli contamination were recorded in four rural markets in Tha Sala (≤50%). Of these markets, none displayed contamination by ESBL-producing E. coli isolates in minced beef, but bacteria were isolated from both pork (25%) and chicken samples (93.33%).

Antibacterial susceptibility phenotype

Eleven antibiotic agents were used to assess the antimicrobial susceptibility of 78 ESBL-producing E. coli isolates from minced meat samples using the disk diffusion method, as presented in Table 3. The isolates were most susceptible to AK (96.16%). In addition, ESBL-producing E. coli isolates were frequently susceptible to MEM (94.87%) and IMP (91.03%) but less susceptible to GM (52.47%), CAZ (21.79%), ATM (16.67%), TE (12.82%), CRO (6.41%), and CTX (3.85%).

Table 3.

Antimicrobial Resistance of Extended-Spectrum β-Lactamase–Producing Escherichia coli Isolates

Antibiotics			No. of antibiotic-resistant ESBL-producing Escherichia coli isolates (%)
Mode of action	Classes	Drug names	Total (%)	Pork (%)	Chicken (%)	Beef (%)
Targeted β-lactam ring	Aminopenicillin	Ampicillin	78 (100)	35 (100)	38 (100)	5 (100)
	Carbapenem	Imipenem	2 (2.56)	1 (2.86)	0	1 (20)
		Meropenem	3 (3.85)	2 (5.71)	1 (2.63)	0
		Aztreonam	63 (80.77)	30 (85.71)	29 (76.32)	4 (80)
	Cephalosporin	Cefotaxime	72 (92.30)	35 (100)	32 (84.22)	5 (100)
		Ceftriaxone	71 (91.03)	35 (100)	31 (81.78)	5 (100)
		Ceftazidime	46 (58.98)	21 (60)	21 (55.26)	4 (80)
		Cefpodoxime	78 (100)	35 (100)	38 (100)	5 (100)
Nontargeted β-lactam ring	Aminoglycoside	Gentamicin	35 (44.87)	20 (57.14)	14 (36.84)	1 (20)
	Aminoglycoside	Amikacin	1 (1.28)	1 (2.86)	0	0
	Tetracycline	Tetracycline	61 (78.21)	26 (74.28)	34 (89.47)	1 (20)

ESBL, extended-spectrum β-lactamase.

ESBL-producing E. coli isolated from minced pork were most susceptible to MEM (94.29%) and AK (94.29%), followed by IMP (82.85%), GM (37.14%), CAZ (17.14%), ATM (11.43%), and TE (11.43%). ESBL producers displayed most intermediate susceptibility to CAZ (22.86%), followed by IMP (14.29%), TE (14.29%), GM (5.71%), ATM (2.86%), and AK (2.86%). Furthermore, ESBL-producing E. coli isolates from minced chicken exhibited the greatest susceptibility to IMP (100%) and AK (100%).

Isolates from chicken were also susceptible to MEM (94.74%) but less frequently susceptible to GM (63.15%), CAZ (26.32%), ATM (23.68%), CRO (13.16%), CTX (7.89%), and TE (5.26%). Fifteen isolates exhibited intermediate susceptibility to CAZ (18.42%), CTX (7.89%), CRO and TE (2.56%), and MEM (2.63%). In addition, ESBL-producing E. coli isolates from minced beef were more susceptible to MEM (100%) than to other antibiotics (IMP, GM, AK, and TE, 80%; CAZ, 20%). One isolate each (20%) possessed intermediate susceptibility to ATM and AK.

Resistance to antibiotics is also highlighted in Table 3. Overall, all ESBL-producing E. coli isolates were most frequently resistant to AMP (100%) and CPD (100%), followed by CTX (92.30%), CRO (91.30%), ATM (80.77%), TE (78.21%), CAZ (58.98%), GM (44.87%), MEM (3.85%), IMP (2.56%), and AK (1.28%). All ESBL-producing E. coli isolates from pork were resistant to AMP, CTX, CRO, and CPD, whereas the isolates were less frequently resistant to ATM (85.71%), TE (74.28%), CAZ (60%), GM (57.14%), MEM (5.71%), IMP (2.86%), and AK (2.86%).

ESBL-producing E. coli isolates from beef exhibited greater resistance to AMP (100%), CTX (100%), CRO (100%), and CPD (100%) than to ATM (80%), CAZ (80%), IMP (20%), GM (20%), and TE (20%). ESBL-producing E. coli isolates from chicken also exhibited strong resistance to AMP (100%) and CPD (100%). The isolates were less frequently resistant to TE (89.47%), CTX (84.22%), CRO (81.78%), ATM (76.32%), CAZ (55.26%), GM (36.84%), and MEM (2.63%).

MDR patterns

The study revealed that ESBL-producing E. coli isolates were frequently resistant to three to five antibiotic classes (94.87%). Multidrug-resistant isolates were obtained from pork (97.14%), chicken (97.74%), and beef (80%), as presented in Table 4. ESBL-producing E. coli isolates resistant to all five examined antibiotic classes (aminopenicillins, carbapenems, cephalosporins, aminoglycosides, and TEs) were detected in minced pork (45.71%) and chicken (31.58%). Isolates resistant to four antibiotic classes (aminopenicillins, carbapenems, cephalosporins, and TEs) were detected in pork (25.71%), chicken (39.47%), and beef (20%).

Table 4.

Multidrug Resistance Patterns of Extended-Spectrum β-Lactamase–Producing Escherichia coli Isolates

MDR patterns (no. of classes of antibiotic resistance)	No. of ESBL-producing resistant Escherichia coli isolates (code)			Total resistant isolates (n = 78)	No. of drug-resistant isolates by location (%)
MDR patterns (no. of classes of antibiotic resistance)	Pork (n = 35)	Chicken (n = 38)	Beef (n = 5)	Total resistant isolates (n = 78)	M (n = 46)	T (n = 18)	S (n = 21)
AP, CP, CS (3)	5 (BP6/11, BP11/16, BP15/20, BP17/22, DP2/56)	2 (CC9/26, GC3/40)	2 (CB4/6, CB5/7)	9 (11.54)	8 (17.39)	1 (5.56)	0
AP, CS, AG (3)	2 (CP12/39, JP8/83)	None	None	2 (2.56)	1 (2.17)	0	1 (4.76)
AP, CS, TE (3)	None	5 (BC8/11, BC9/12, DC1/29, GC1/38, JC2/48)	None	5 (6.41)	3 (6.52)	1 (5.56)	1 (4.76)
AP, CS, AG, TE (4)	1 (HP5/72)	2 (HC2/45, HC3/46)	None	3 (3.85)	0	3 (16.67)	0
AP, CP, CS, AG (4)	1 (AP4/4)	None	1 (DB1/8)	2 (2.56)	2 (4.35)	0	0
AP, CP, CS, TE (4)	9 (BP1/6, BP18/23, BP20/25, BP21/26, CP1/28, CP11/38, CP13/40, EP1/57, JP1/76)	15 (AC3/3, BC11/14, BC14/17, CC1/18, CC2/19, CC3/20, CC4/21, CC7/24, FC1/33, FC5/37, GC2/39, GC4/41, HC1/44, JC1/47, JC4/50)	1 (CB3/5)	25 (32.05)	16 (34.78)	6 (33.33)	3 (14.29)
AP, CP, CS, AG, TE (5)	16 (AP3/3, AP5/5, BP13/18, BP14/19, BP16/21, CP5/32, CP22/49, FP4/64, GP2/66, JP4/79, JP5/80, JP6/81, JP7/82, JP9/84, JP10/85, JP11/86)	12 (AC1/1, BC4/7, BC5/8, BC6/9, BC13/16, CC5/22, CC6/23, CC8/25, EC2/31, FC2/34, FC4/36, GC5/42)	None	28 (35.90)	15 (32.61)	6 (33.33)	7 (33.33)
Total	34 (97.14%)	36 (97.74%)	4 (80%)	74 (94.87%)	42 (91.03%)	17 (94.44%)	12 (57.14)

AG, aminoglycoside; AP, aminopenicillin; CP, carbapenem; CS, cephalosporin; ESBL, extended-spectrum β-lactamase; M, Mueang; MDR, multidrug resistance; S, Sichon; T, Tha Sala; TE, tetracycline.

Several isolates were also completely resistant to three and four antibiotic classes (28.38%). Notably, a high rate of MDR was noted among ESBL-producing resistant E. coli isolates from Tha Sala (94.44%), and similar results were observed for samples from Mueang (91.03%). Conversely, the proportion of samples with resistant isolates was lower in Sichon (57.14%). Furthermore, almost ESBL-producing E. coli isolates from minced meat samples were proportionally resistant to four to five antibiotic classes, especially in samples obtained from Tha Sala and Mueang.

The resistance genes carried by ESBL-producing E. coli isolates from minced meats according to multiplex PCR were bla_TEM (78.21%), bla_CTX-M (12.82%), and bla_SHV (6.41%), as presented in Table 5. ESBL-producing E. coli isolates strongly expressing resistance genes were detected in minced chicken (100%), beef (100%), and pork (94.29%). Meanwhile, bla_TEM was commonly carried by isolates from minced pork (68.57%), chicken (86.84%), and beef (80%). bla_CTX-M was found in isolates from minced pork (17.14%), chicken (7.89%), and beef (20%), whereas bla_SHV was detected in isolates from pork (8.57%) and chicken (5.26%).

Table 5.

Extended-Spectrum β-Lactamase Genes in Escherichia coli Isolates

Meat samples	No. of isolates carrying ESBL genes (code)			Total gene expressing isolates (%)	No. of gene-encoding ESBL producers by location (%)
	ESBL-encoding genes				Location
	bla_TEM	bla_CTX-M	bla_SHV		M (n = 46)	T (n = 18)	S (n = 21)
Pork (n = 35)	24 (AP2/2, AP4/4, AP5/5, BP11/16, BP14/19, BP16/21, BP18/23, BP20/25, BP21/26, CP1/28, CP11/38, CP13/40, CP22/49, EP1/57, FP4/64, GP2/66, HP5/72, JP4/79, JP5/80, JP6/81, JP7/82, JP8/83, JP9/84, JP11/86)	6 (BP1/6, BP6/11, BP15/20, CP5/32, CP12/39, JP1/76)	3 (AP3/3, BP17/22, JP10/85)	33 (94/29)	20 (43.48)	4 (22.22)	9 (42.86)
Chicken (n = 38)	33 (AC1/1, AC3/3, BC4/7, BC5/8, BC6/9, BC8/11, BC9/12, BC11/14, BC13/16, BC14/17, CC1/18, CC2/19, CC3/20, CC4/21, CC5/22, CC6/23, CC7/24, DC1/29, EC2/31, EC3/32, FC2/34, FC4/36, FC5/37, GC1/38, GC2/39, GC4/41, GC5/42, HC1/44, HC2/45, HC3/46, JC1/47, JC2/48, JC4/50)	3 (CC8/25, CC9/26, JC3/49)	2 (FC1/33, GC3/40)	38 (100)	20 (43.48)	14 (77.78)	4 (19.05)
Beef (n = 5)	4 (CB3/5, CB5/7, DB1/8, JB2/14)	1 (CB4/6)	None	5 (100)	4 (8.70)	0	1 (4.76)
Total (n = 78)	61 (78.21%)	10 (12.82%)	5 (6.41%)	76 (97.44%)	44 (95.65%)	18 (100%)	14 (66.67%)

ESBL, extended-spectrum β-lactamase.

All ESBL-producing E. coli isolates obtained from Tha Sala expressed resistance genes. The proportion of isolates expressing resistance genes was higher in Mueang (95.65%) than in Sichon (66.67%). Resistance genes were most frequently found in isolates from minced chicken and pork (both 43.48%) than in isolates from pork (42.86%).

Discussion

In this study, we frequently detected ESBL-producing E. coli in raw minced meat samples from Thai markets. ESBL-producing E. coli strains are distributed in various food-associated resources, including animal-derived foods (Gözde and Emek, 2019; Ramos et al., 2020). According to the results of prior studies, ESBL-producing E. coli is highly prevalent in animal foodstuffs; for example, isolates were obtained from 77% to 98% of various samples such as raw milk and fresh meat (Ojer-Usoz et al., 2017; Alegria et al., 2020).

Furthermore, ESBL-producing E. coli was prevalent in various raw meat samples, including pork, poultry, and beef (Boonyasiri et al., 2014; Kim et al., 2018). Several studies reported a high prevalence of ESBL-producing E. coli (>50%) in raw chicken or fresh chicken in regions such as the United Kingdom, the United States, and the EU (Kim et al., 2018; Guo et al., 2021). Conversely, the prevalence of ESBL-producing E. coli in raw beef and pork was low in the United Kingdom, Germany, Turkey, China, Singapore, South Korea, and Vietnam (Kim et al., 2018; Guo et al., 2021). Meanwhile, ESBL-producing E. coli has been isolated at low rates from raw minced beef and pork in both developing and developed countries, including Switzerland, Germany, Turkey, and Ethiopia (Abayneh et al., 2019; Kaesbohrer et al., 2019).

These results accorded with our findings in minced beef, whereas we observed higher rates of positivity for ESBL-producing E. coli in minced beef and pork. Notably, the occurrence of ESBL-producing E. coli positivity in minced beef was significantly lower in this study than in Indonesia (43.3%), in which the population frequently consumes minced beef (Wardhana et al., 2021). In addition, the recorded rate of ESBL-producing E. coli contamination in pork was higher in this study than in studies from the EU (0–25%) (Bergspica et al., 2020).

It was noted that uncut raw chicken had high levels of ESBL-producing E. coli contamination in various regions over the last decade, whereas this bacterium was rarely found in minced meat, especially chicken. Surprisingly, we recorded a high rate of ESBL-producing E. coli contamination in raw minced chicken. Meanwhile, the occurrence of ESBL-producing E. coli contamination in minced chicken or other meats remains continuous.

In one study, Mollenkopf et al. recovered E. coli expressing an ESBL resistance phenotype from retail ground chicken samples (11.1%) (Mollenkopf et al., 2018), which was lower than the rate reported in this study. Antibiotic-resistant bacteria have arisen because of the widespread use of antibiotics are an important contributor to the development of antimicrobial resistance (Kawamura et al., 2017). Antibiotic resistance genes of pathogens can be transferred to other intestinal bacteria as horizontal transferring (Huddleston, 2014).

In Thailand, many researchers have worried about contamination in raw meat samples and fecal specimens from animals, including chicken, cattle, and pigs in areas such as slaughterhouses, retail markets, and supermarkets; however, no report has described the prevalence of ESBL-producing E. coli in raw minced meat (Bhumibhamon et al., 2018; Rodroo et al., 2020). This is the first report to emphasize the occurrence of ESBL-producing E. coli in meat samples and characterize its genotype in southern Thailand. To reduce ESBL-producing E. coli contamination in minced meat, good hygiene during and after animal slaughter must be stressed.

ESBL-producing E. coli isolates frequently exhibited antibiotic resistance in this study. Similar results were recorded in several studies examining uncut meat preparations (Day et al., 2019). ESBL-producing E. coli is commonly resistant to AMP and third-generation cephalosporins (Kim et al., 2018; Ramos et al., 2020). High rates of resistance to TE (78.21%), particularly in pork and chicken, remain concerning (Ye et al., 2018; Guo et al., 2021), and these findings were corroborated by our results. Therefore, preventive and curative strategies are needed to control antibiotic resistance in the livestock industry in southern Thailand.

This study revealed that most ESBL-producing E. coli exhibited MDR and carried antimicrobial resistance genes. bla_TEM , bla_CTM , and bla_SHV are common genes found in ESBL-producing Enterobacteriaceae family (Pitout and Laupland, 2008; Zurfluh et al., 2015). Frequently, bla_CTX-M types harbored in ESBL-producing E. coli isolated from meat samples have been reported (Day et al., 2019; Bergspica et al., 2020).

Meanwhile, the occurrence of ESBL-producing E. coli resistant to TE has been rarely reported, including rates of 6.3% in chicken and 12.6% in pork and beef (Kaesbohrer et al., 2019). This contradicted our data. Nevertheless, many studies recorded high rates of bla_TEM positivity in meat samples. In one study, 45.3% of ESBL-producing E. coli isolates from raw meat in Singapore carried bla_TEM (Guo et al., 2021). bla_TEM was also detected in raw meat samples (58%) (Abdallah et al., 2015; Gundran et al., 2019). In general, bla_TEM and bla_SHV have been isolated from both patients in the clinic and asymptomatic animals. Five bla_CTX-M types were originally found in environmental bacteria, and in particular bla_CTX-M1 dominated in disease-associated isolates (Olsen et al., 2014; Zurfluh et al., 2015).

The relevant genes are believed to have been mobilized into conjugative plasmids and transferred to pathogenic bacteria (Zurfluh et al., 2015). ESBL-producing E. coli can be ingested by consumers through the consumption of raw or undercooked meat. These isolates might subsequently colonize humans or transfer resistance genes to other bacteria during passage through the intestinal tract. Ryu et al. suggested that the transfer of resistance genes between E. coli of animal and human origin in the human intestine is extremely likely (Ryu et al., 2012).

AK and carbapenems (IMP and MEM) are active against ESBL-producing E. coli (Pehlivanlar et al., 2015; Ye et al., 2018). Carbapenems are widely regarded as the antibiotics of choice for severe infections caused by ESBL-producing Enterobacteriaceae (Pitout and Laupland, 2008). ESBL-producing E. coli isolates were susceptible to AK, IMP, and MEM in this study, in line with previously reported susceptibility rates of 90–100% (Nguyen do et al., 2016; Dsani et al., 2020; Kanokudom et al., 2021). IMP and MEM are the treatments of choice for serious infections by ESBL-producing E. coli in humans. Thus, the low rates of IMP resistance in this study are likely attributable to the low use of this drug in livestock (Pehlivanlar et al., 2015).

Moreover, many classes of antimicrobials that are used for humans are being used in food animals. In Thailand, several farms used antibiotics for animals such as amoxicillin, colistin, and tetracycline. The total weight of antibiotics used per chicken was 303 mg/kg. This is overusing of antibiotics that FDA recommendations (Bodhidatta et al., 2013; Lekagul et al., 2021). Thus, biosecurity and other prevention measures are needed on farm to promote good antimicrobial stewardship and minimize the need for antimicrobial use.

High rates of ESBL-producing E. coli contamination were found in both rural and urban regions in this study. Thus, efforts are needed to ensure that merchants apply proper measures to control bacterial spread during slaughter and retail. Furthermore, ESBL-producing E. coli frequently exhibited antibiotic resistance and harbored resistance genes in Tha Sala and Mueang than in Sichon. This finding might be explained by the fact that Mueang is a central economic hub in Nakhon Si Thammarat. Thus, it is possible that meat transported through this region carried drug resistance genes from farms in rural regions to retail shops in urban regions.

Conclusion

This is the first study surveying the ESBL-producing E. coli contamination in retail minced meat in southern Thailand retail market. These results raise serious concerns regarding public health and food safety because retail meat could serve as a reservoir for drug-resistant bacteria, which could be transferred to humans through the food chain.

Footnotes

Authors' Contributions

C.R. and P.S. conceived and designed the experiments. C.R., P.S., A.A., S.K., and H.M. performed the experiments. C.R., P.S., and S.C. analyzed the data. C.R. contributed reagents, materials, and analysis tools. C.R. and S.C. wrote the article.

Acknowledgments

The authors thank the Research Institute for Health Sciences Walailak University and School of Allied Health Sciences, Walailak University for providing the required laboratory instruments. This research was financially supported by the new strategic research project (P2P), Walailak University, Thailand.

Ethics Approval

This study did not include any experiments on human participants or animals.

Disclosure Statement

No competing financial interests exist.

Funding Information

No funding was received for this article.

References

Abayneh

, Tesfaw

, Woldemichael

, Yohannis

, Abdissa

. Assessment of extended-spectrum beta-lactamase (ESBLs)—Producing Escherichia coli from minced meat of cattle and swab samples and hygienic status of meat retailer shops in Jimma town, Southwest Ethiopia. BMC Infect Dis, 2019; 19:897.

Abdallah

, Reuland

, Wintermans

, Al Naiemi

, Koek

, Abdelwahab

, Ammar

, Mohamed

, Vandenbroucke-Grauls

. Extended-spectrum beta-lactamases and/or carbapenemases-producing Enterobacteriaceae. isolated from retail chicken meat in Zagazig, Egypt. PLoS One 2015;10: e013, 6052.

Alegria

, Arias-Temprano

, Fernandez-Natal

, Rodriguez-Calleja

, Garcia-Lopez

, Santos

. Molecular diversity of ESBL-producing Escherichia coli from foods of animal origin and human patients. Int J Environ Res Public Health, 2020; 17:1312.

Bergspica

, Kaprou

, Alexa

, Prieto

, Alvarez-Ordonez

. Extended spectrum beta-lactamase (ESBL) producing Escherichia coli in pigs and pork meat in the European Union. Antibiotics, 2020; 9:678.

Bhumibhamon

G KJ

, Boonprab

, Pourpun

. Antimicrobial resistance of Escherichia coli from pig and chicken caecum in Southern Thailand. Thai NIAH e-J, 2018; 13:23–29.

Biswas

, Kondaiah

, Anjaneyulu

ASR

, Mandal

. Causes, concerns, consequences and control of microbial contaminants in meat-a review. Int J Meat Sci, 2011; 1:27–35.

Bodhidatta

, Srijan

, Serichantalergs

, Bangtrakulnonth

, Wongstitwilairung

, McDaniel

, et al. Bacterial pathogens isolated from raw meat and poultry compared with pathogens isolated from children in the same area of rural Thailand. Southeast Asian J Trop Med Public Health, 2013; 44:259–272.

Boonyasiri

, Tangkoskul

, Seenama

, Saiyarin

, Tiengrim

, Thamlikitkul

. Prevalence of antibiotic resistant bacteria in healthy adults, foods, food animals, and the environment in selected areas in Thailand. Pathog Global Health, 2014; 108:235–245.

CLSI. Performance Standards for Antimicrobial Susceptibility Testing CLSI supplement M100. Wayne, PA: CLSI, 2020.

10.

Day

, Hopkins

, Wareham

, Toleman

, Elviss

, Randall

, Teale

, Cleary

, Wiuff

, Doumith

, Ellington

, Woodford

, Livermore

. Extended-spectrum beta-lactamase-producing Escherichia coli in human-derived and foodchain-derived samples from England, Wales, and Scotland: An epidemiological surveillance and typing study. Lancet Infect Dis, 2019;19:1325–1335.

11.

De Smet

, Vossen

. Meat. The balance between nutrition and health. A review. Meat Sci, 2016; 120:145–156.

12.

Dsani

, Afari

, Danso-Appiah

, Kenu

, Kaburi

, Egyir

. Antimicrobial resistance and molecular detection of extended spectrum beta-lactamase producing Escherichia coli isolates from raw meat in Greater Accra region, Ghana. BMC Microbiol, 2020; 20:253.

13.

Gözde

, Emek

. Escherichia coli and Food Safety. The Universe of Escherichia coli, Marjanca Starčič Erjavec. IntechOpen, 2019. DOI: 10.5772/intechopen.82375.

14.

Gundran

, Cardenio

, Villanueva

, Sison

, Benigno

, Kreausukon

, Pichpol

, Punyapornwithaya

. Prevalence and distribution of blaCTX-M, blaSHV, blaTEM genes in extended- spectrum β- lactamase- producing E. coli isolates from broiler farms in the Philippines. BMC Vet Res, 2019; 15:227.

15.

Guo

, Aung

, Leekitcharoenphon

, Tay

MYF

, Seow

KLG

, Zhong

, Ng

, Aarestrup

, Schlundt

. Prevalence and genomic analysis of ESBL-producing Escherichia coli in retail raw meats in Singapore. J Antimicrob Chemother, 2021; 76:601–605.

16.

Huddleston

JR.

Horizontal gene transfer in the human gastrointestinal tract: Potential spread of antibiotic resistance genes. Infect Drug Resist, 2014; 7:167–176.

17.

Kaesbohrer

, Bakran-Lebl

, Irrgang

, Fischer

, Kämpf

, Schiffmann

, Werckenthin

, Busch

, Kreienbrock

, Hille

. Diversity in prevalence and characteristics of ESBL/pAmpC producing E. coli in food in Germany. Vet Microbiol, 2019; 233:52–60.

18.

Kanokudom

, Assawakongkarat

, Akeda

, Ratthawongjirakul

, Chuanchuen

, Chaichanawongsaroj

. Rapid detection of extended spectrum beta-lactamase producing Escherichia coli isolated from fresh pork meat and pig cecum samples using multiplex recombinase polymerase amplification and lateral flow strip analysis. PLoS One, 2021; 16:e0248536.

19.

Kawamura

, Nagano

, Suzuki

, Wachino

, Kimura

, Arakawa

. ESBL-producing Escherichia coli and its rapid rise among healthy people. Food Saf (Tokyo), 2017; 5:122–150.

20.

Kim

, Moon

, Oh

, Chon

, Song

, Lim

, et al. Genotypic characterization of ESBL-producing E. coli from imported meat in South Korea. Food Res Int, 2018; 107:158–164.

21.

Lekagul

, Tangcharoensathien

, Liverani

, Mills

, Rushton

, Yeung

. Understanding antibiotic use for pig farming in Thailand: a qualitative study. Antimicrob Res Infect Control, 2021; 10:3.

22.

Magiorakos

, Srinivasan

, Carey

, Carmeli

, Falagas

, Giske

, Harbarth

, Hindler

, Kahlmeter

, Olsson-Liljequist

, Paterson

, Rice

, Stelling

, Struelens

, Vatopoulos

, Weber

, Monnet

. Multidrug-resistant, extensively drug-resistant and pandrug-resistant bacteria: An international expert proposal for interim standard definitions for acquired resistance. Clin Microbiol Infect, 2012; 18:268–281.

23.

Mgaya

, Matee

, Muhairwa

, Hoza

. Occurrence of multidrug resistant Escherichia coli in raw meat and cloaca swabs in poultry processed in slaughter slabs in Dar es Salaam, Tanzania. Antibiotics (Basel), 2021; 10:343.

24.

Mollenkopf

, De Wolf

, Feicht

, Cenera

, King

, van Balen

, Wittum

. Salmonella spp. and extended-spectrum cephalosporin-resistant Escherichia coli frequently contaminate broiler chicken transport cages of an organic production company. Foodborne Pathog Dis, 2018; 15:583–588.

25.

Monstein

, Ostholm-Balkhed

, Nilsson

, Dornbusch

, Nilsson

. Multiplex PCR amplification assay for the detection of blaSHV, blaTEM and blaCTX-M genes in Enterobacteriaceae. APMIS, 2007; 115:1400–1408.

26.

Nguyen do

, Nguyen

, Le

, Tran

, Ngo

, Dang

, Kawai

, Kanki

, Kawahara

, Jinnai

, Yonogi

, Hirai

, Yamamoto

, Kumeda

. Dissemination of extended-spectrum β-lactamase- and AmpC β-lactamase-producing Escherichia coli within the Food Distribution System of Ho Chi Minh City, Vietnam. Biomed Res Int, 2016; 2016:8182096.

27.

OECD/FAO (2021). OECD-FAO Agricultural Outlook 2021–2030, OECD Publishing, Paris, https://doi.org/10.1787/19428846-en.

28.

Ojer-Usoz

, Gonzalez

, Vitas

. Clonal diversity of ESBL-producing Escherichia coli isolated from environmental, human and food samples. Int J Environ Res Public Health, 2017; 14:676.

29.

Olsen

, Bisgaard

, Löhren

, Robineau

, Christensen

. Extended-spectrum β-lactamase-producing Escherichia coli isolated from poultry: A review of current problems, illustrated with some laboratory findings. Avian Pathol, 2014; 43:199–208.

30.

Pehlivanlar

, Aslantas

, Sebnem

, Kurekci

. Prevalence of beta-lactamase producing Escherichia coli from retail meat in Turkey. J Food Sci, 2015; 80:M2023-9.

31.

Pitout

, Laupland

. Extended-spectrum beta-lactamase-producing Enterobacteriaceae: An emerging public-health concern. Lancet Infect Dis, 2008; 8:159–166.

32.

Rabia

, Ali

, Muhammad

. Nutritional Composition of Meat, Meat Science and Nutrition, Muhammad Sajid Arshad, IntechOpen, 2018. DOI: 10.5772/intechopen.77045.

33.

Ramos

, Silva

, Dapkevicius

MLE

, Caniça

, Tejedor-Junco

, Igrejas

, Poeta

. Escherichia coli as commensal and pathogenic bacteria among food-producing animals: Health implications of extended spectrum beta-lactamase (ESBL) production. Animals (Basel), 2020; 10:2239.

34.

Rodroo

, Intanon

, Kreausukon

, Kongkaew

, Bender

, Awaiwanont

Occurrence of extended-spectrum beta-lactamase producing E. coli in broiler farm workers and the farm environment in Chiang Mai-Lamphun, Thailand. Vet Integr Sci, 2020; 19:23–35.

35.

Romyasamit

, Sornsenee

, Chimplee

, Yuwalaksanakun

, Wongprot

, Saengsuwan

. Prevalence and characterization of extended-spectrum β-lactamase-producing Escherichia coli and Klebsiella pneumoniae isolated from raw vegetables retailed in Southern Thailand. Peer J, 2021; 9:e11787.

36.

Ryu

, Lee

, Park

, Song

, Park

, Jung

, Park

, Choi

, Kim

, Chae

, Park

, Lee

. Antimicrobial resistance profiles among Escherichia coli strains isolated from commercial and cooked foods. Int J Food Microbiol, 2012; 159:263–266.

37.

Wardhana

, Safitri

, Annisa

, Harijani

, Estoepangestie

ATS

, Maghfiroh

. Prevalence of extended-spectrum beta-lactamases in producing Escherichia coli in beef sold in traditional markets in Surabaya, Indonesia. Biodiversitas, 2021; 22:2789–2793.

38.

, Wu

, Zhang

, Yang

, Wang

, Xue

, Chen

. Characterization of extended-spectrum β-lactamase-producing Enterobacteriaceae from retail food in China. Front Microbiol, 2018; 9:1709.

39.

Zurfluh

, Nüesch-Inderbinen

, Morach

, Zihler Berner

, Hächler

, Stephan

. Extended-spectrum-β-lactamase-producing Enterobacteriaceae isolated from vegetables imported from the Dominican Republic, India, Thailand, and Vietnam. Appl Environ Microbiol, 2015;81:3115.