Genomic Characterization of Ciprofloxacin Resistance in Laboratory-Derived Mutants of Vibrio parahaemolyticus

Abstract

The quinolone ciprofloxacin is a broad-spectrum bactericidal antibiotic used for human medicine as well as the aquaculture industry. The emergence of ciprofloxacin-resistant Vibrio parahaemolyticus strains is currently a global public health concern. However, the mechanism of ciprofloxacin resistance in V. parahaemolyticus is not yet fully clarified. We generated mutants with decreased ciprofloxacin susceptibility using in vitro selection and investigated genes associated with ciprofloxacin resistance on a genetic level. Our selection process yielded mutants that possessed altered minimal inhibitory concentrations (MICs) for ciprofloxacin and other unrelated antibiotics. These included Ser83Ile mutations in GyrA and Val461Glu in ParE as well as mutations in the resistance nodulation cell division (RND) family transporter gene vmeD and the putative TetR family regulator gene vp0040 upstream of the vmeCD operon. Measurements of steady-state mRNA levels revealed that the ciprofloxacin-resistant mutants overexpressed vmeCD. Further, the introduction of the vp0040 mutated allele from H512 into the sensitive parental strain increased the MIC for ciprofloxacin 31.25-fold. Taken together, these results indicated that ciprofloxacin resistance in these mutants was due to the quinolone resistance determining region mutation as well as overexpression of vmeCD caused by a loss of vp0040 gene repression. This also accounted for the presence of the multidrug resistance phenotype for these mutant strains since RND efflux system can export structurally unrelated antibiotics.

Introduction

V ibrio parahaemolyticus is a halophilic Gram-negative bacterium and a cause of acute gastroenteritis from seafood consumption (DePaola et al., 2000; Wu et al., 2014). Outbreaks of this pathogen infection have been reported in many countries (Lozano-Leon et al., 2003; Gonzalez-Escalona et al., 2005), and its incidence in China has increased significantly (Yu et al., 2015; Huang et al., 2016).

In past decades, quinolones remain the first choice for treatment of severe infections caused by V. parahaemolyticus although other antibiotics such as tetracycline and third-generation cephalosporins are also effective (Dalhoff, 2012). Nalidixic acid was the first of the synthetic quinolones and the new fluoroquinolones, including ciprofloxacin and norfloxacin, are frequently used in clinics because of their broad antimicrobial spectrum and high antibacterial activities. Quinolones have also been approved for use in some countries for aquaculture systems (Rico et al., 2012; Letchumanan et al., 2016).

Importantly, resistance to quinolone in V. parahaemolyticus is increasing in some countries, including China (Jiang et al., 2014; Elmahdi et al., 2016). Uncovering the mechanisms of quinolone resistance in V. parahaemolyticus is now essential for successful management of these infections (Elmahdi et al., 2016).

Quinolones are synthetic broad-spectrum antimicrobials that inhibit DNA synthesis in bacteria by targeting DNA gyrase (GyrA and GyrB subunits) and topoisomerase IV (ParC and ParE subunits) (Hooper, 1999). Resistance to quinolones in bacteria arises due to acquisition of spontaneous mutations in the quinolone resistance determining region (QRDR) of these target enzymes (Okuda et al., 1999; Vinué et al., 2015).

Previous studies indicated that these mutations usually emerged in gyrA and parC genes, and the most commonly occurring resistance to quinolones was due to an Ser83Ile mutation in GyrA in Vibrio sp., including V. cholerae and V. parahaemolyticus (Roig et al., 2009; Lei et al., 2020). Resistance can also occur through the overexpression of efflux systems (Lupien et al., 2013). To date, there are two efflux systems in V. parahaemolyticus that confer fluoroquinolone resistance. The NorM protein is a member of the multidrug and toxic compound extrusion (MATE) family of efflux transporters. This system can export norfloxacin and ciprofloxacin as well as structurally unrelated compounds such as tetracycline, erythromycin, streptomycin, chloramphenicol, as well as ethidium bromide (Morita et al., 2000; Ficici et al., 2018).

The second efflux system was revealed, whereas 12 putative efflux transporters of the resistance nodulation cell division (RND) family in V. parahaemolyticus were characterized (Matsuo et al., 2013). A strain lacking two RND efflux transporters (VmeAB and VmeCD) exhibited elevated susceptibility to several antimicrobials, including fluoroquinolones. The transporters VmeAB and VmeCD in association with the outer membrane protein VpoC constitute the core of these transporters. In general, RND efflux transporters play prominent roles in drug resistance in Gram-negative bacteria (Nishino et al., 2006).

Other than QRDR mutations and efflux systems, Zhou et al. reported that joint variations in 10 genes and increased expression of those genes may be involved in development of resistance to ciprofloxacin in V. parahaemolyticus (Zhou et al., 2019).

The present study sought to further understand the molecular mechanism of fluoroquinolone resistance in V. parahaemolyticus. We exposed V. parahaemolyticus to increasing concentrations of ciprofloxacin for stepwise induction to obtain resistant mutants. We then genetically screened the genomes of the mutants for single nucleotide polymorphisms (SNPs) and insertions or deletions (InDels) using whole genome sequencing (WGS) and polymerase chain reaction (PCR). The expression levels of genes implicated in fluoroquinolone resistance were also examined using reverse transcription PCR (RT-PCR). The identified mutations were then introduced back into the parental strain to assess the impact of the mutant on fluoroquinolone resistance.

Materials and Methods

Bacterial strains and culture conditions

V. parahaemolyticus strain F7 was originally isolated from shrimp. Strain F7 was susceptible to ciprofloxacin with minimal inhibitory concentration (MIC) at 0.016 μg/mL. V. parahaemolyticus strains were grown in Luria-Bertani (LB) broth (Difco Laboratories, Detroit, MI) or in Mueller-Hinton (MH) broth (Hope Biotechnology, Qingdao, China) or on solidified agar at 37°C.

Stepwise selection of quinolone-resistant mutants in vitro

In our previous study, strain F7 was used as the parental stain for in vitro selection of ciprofloxacin mutants and a series of mutants were obtained (Ma et al., 2018). Derivative mutants H32 and H128 have been characterized, displaying increasing ciprofloxacin MICs. As indicated, stepwise selection was performed by transferring and passaging parental strain F7 colonies to MH broth containing gradually increased concentrations of ciprofloxacin. After 2 to 3 days of incubation, the cells in each culture were collected and subjected to MIC determinations. In the present study, H128 was induced by the method described earlier and mutants H256 and H512 were selected using the same criteria. The mutant strain H512 with the highest MIC to ciprofloxacin was used for WGS.

Susceptibility testing

The MICs were measured using the microbroth dilution method as recommended by the Clinical and Laboratory Standards Institute guidelines (CLSI, 2016). The compounds tested were ciprofloxacin, norfloxacin, nalidixic acid, tetracycline, ampicillin, amoxicillin, and cefazolin, which were common types of antibiotics used in aquatic or clinical treatment for the infection of V. parahaemolyticus. Compounds tested were prepared according to the manufacturer's instructions. Escherichia coli ATCC 25922 was used as the quality control strain. All MIC measurements were done at least in triplicate.

Whole-genome sequencing

Genomic DNA was extracted from mid-log-phase cultures of V. parahaemolyticus by using a MiniBEST Bacteria Genomic DNA Extraction Kit Ver.3.0 (Takara, Beijing, China) according to the manufacturer's instructions. Genomes of parental strain F7 and mutant strain H512 were sequenced using the PacBio RS II system, and genome sequencing, assemblies, and annotations were performed commercially (Meiji Sequencing, Shanghai, China). Sequence comparisons between F7 and H512 were performed, and some important mutations deduced from massively parallel sequencing were confirmed by PCR amplification and conventional DNA sequencing described next.

PCR assay for mutation determination

To confirm the mutations in gyrA and parE as well as in vmeD, vmeI, and vp0040 genes, PCR were performed using genomic DNA from all mutants and parental F7 as template with specific primers (Table 1). Agarose gel electrophoresis was used to verify DNA segment sizes, and the remaining PCR mixture was purified using a commercial PCR purification kit (Qiagen, Hilden, Germany) and sequenced at Meiji sequencing cooperation. Mutation detection was carried out using BioEdit (Ibis Biosciences, Carlsbad, CA) with strain F7 as reference.

Table 1.

Polymerase Chain Reaction Primers and Real-Time Polymerase Chain Reaction Primers Used in This Study

Gene primers		Sequence 5′–3′	Tm (°C)	Amplification length (bp)	Reference
gyrA	F	CGATTGGAACAAACCATATAAA	55	200	Okuda et al. (1999)
gyrA	R	CGGTGTAACGCATTGCCGCA	55	200	Okuda et al. (1999)
parE	F	GCAGAGCAGTTAGCCGAAGT	58	416	This study
parE	R	CAGAGCAAGGTCGCAATGT	58	416	This study
vmeD-1	F	AAGCAGTAGCACAAGCCGACAACA	58	850	This study
vmeD-1	R	TTACCGCACGGAACGAGCCT	58	850	This study
vmeD-2	F	CGGTAATGGCTAATCGTC	55	1471	This study
vmeD-2	R	TCAACAAAAACTGGCAGTGGT	55	1471	This study
vmeI	F	TTACCGCTATTTCTCTAACGC	55	293	This study
vmeI	R	GGAAGGTACAGATATTCGTGC	55	293	This study
vp0040	F	CCCTGCTGTAGATAAACGCGA	60	512	This study
vp0040	R	TCCCAAAGCATGTTTTCTCGC	60	512	This study
vp0040-AR	F	±CCGCTCGAGCCCTGCTGTAGATAAACGCGA	58	540	This study
vp0040-AR	R	≠CGCGGGCCCTCCCAAAGCATGTTTTCTCGC	58	540	This study
16SrDNA	RT-F	ACGTTAGCGACAGAAGAAGC	53	211	This study
16SrDNA	RT-R	ACCGCTACACCTGAAATTCT	53	211	This study
vmeB	RT-F	CCGTGCTATGGGTTACTTCTC	59	124	This study
vmeB	RT-R	AAGGCTCAGGGAGTCTTGTAG	59	124	This study
vmeD	RT-F	TTCGTGAATACCCTGAAATG	57	104	This study
vmeD	RT-R	CTCCAAAGGCTGAGTAATAA	57	104	This study
vpoC	RT-F	TAGCAAAGCAAAATGATCCACA	57	86	This study
vpoC	RT-R	AGCACTACGGCTAGAGGTGA	57	86	This study
norM	RT-F	AAAGCCAAAATGAGAATCGC	56	288	This study
norM	RT-R	ATGGGTTTTGTCGATACCGTA	56	288	This study

±SalI and ≠BamHI in bold letters.

Allelic replacement

The DNA fragments containing the wild-type and variant vp0040 genes from strains F7 and H512 were PCR-amplified using primer set vp0040-AR that incorporated SalI and BamHI restriction sites (Table 1). PCR amplicons were digested with restriction enzymes, which were inserted into plasmid vector pRE112 and transformed into E. coli strain SM10λpir. This strain was then used for plasmid conjugation to V. parahaemolyticus cells by mating.

V. parahaemolyticus conjugants were selected on thiosulfate-citrate-bile-sucrose agar (Hope Biotechnology) containing 200 μg/mL chloramphenicol. Recombination in the V. parahaemolyticus genome was accomplished by counter-selection on LB agar plates containing 10% sucrose. Gene transfer was monitored using PCR and sequence analysis.

Relative expression levels of genes encoding efflux pumps.

Measurements of steady-state mRNA levels of the vmeB, vmeD, vpoC, and norM genes were performed using total RNA isolated from mid-log-phase cultures with a Qiagen RNeasy mini kit (Qiagen) and with a TURBO DNase kit (Thermo Fisher Scientific, Waltham, MA) to eliminate carryover DNA contamination. RNA purity and concentration were determined by UV spectroscopy using a NanoDrop 2000 instrument (Thermo Fisher Scientific).

First-strand cDNA synthesis was carried out using PrimeScript RT Master Mix (Takara) and random hexamers according to the manufacturer's instructions. Real-time PCR assays were conducted using a CFX96 Real-Time instrument (Biorad, Hercules, CA) and appropriate primers (Table 1). All RT-PCR data were normalized according to the amplification signals of the 16S rDNA. At least three different assays with three independent cultures and RNA extractions were performed for each gene tested.

Results

Quinolone resistance and multidrug resistance phenotypes

Several derivative mutants have previously been selected from the quinolone-susceptible food isolate F7, and mutants H32 and H128 were already characterized (Ma et al., 2018). In the current study, we continued to induce H128 in vitro and obtained two derivative mutants H256 and H512. Susceptibility to several common antimicrobials was determined according to the microbroth method recommended by CLSI.

Interestingly, these mutants possessed reduced susceptibilities to quinolones and altered susceptibilities to several structurally unrelated antimicrobials. For instance, mutant H512 displayed a 2000-fold increase in its MIC to ciprofloxacin compared with parental strain F7 and the MIC for nalidixic acid increased 128-fold. Mutant H32 showed increased MIC for ampicillin and cefazolin whereas the MICs for mutants H128, H256, and H512 all decreased. In addition, the MIC for tetracycline increased 256-fold for mutant H512 compared with parental strain F7 (Table 2).

Table 2.

Susceptibility Testing of Vibrio parahaemolyticus Strains

Strain	MIC (μg/mL)
Strain	Ciprofloxacin	Norfloxacin	Nalidixic acid	Ampicillin	Amoxicillin	Cefazolin	Tetracycline
F7-WT	0.016	0.016	0.5	32	16	4	0.25
H32	4	4	8	1024	512	64	32
H128	16	16	32	512	512	32	16
H256	16	16	64	512	512	32	32
H512	32	16	64	512	512	16	64
F7-AR	0.5	nd	4	nd	nd	nd	nd
H512-AR	8	nd	32	nd	nd	nd	nd

H32–H512, mutant strains progressively induced from strain F7-WT by stepwise induction in the presence of ciprofloxacin; F7-AR, F7 derivative with allelic replacement of vp0040 from H512 mutant; H512-AR, H512 derivative with allelic replacement of vp0040 from F7-WT; MIC, minimal inhibitory concentration; nd, not detected; WT, wild type.

Genome sequencing and analysis of parental strain and mutants

To determine the mutations underlying the resistance phenotypes, the parental strain F7 and mutant H512 were sequenced and scanned for mutations. As shown in Table 3, the genome coverage for both pre and post-selection strains was good. F7 and H512 generated aggregated genome sizes of 5,197,733 bp and 5,195,926 bp, respectively. The single nucleotide polymerases (SNPs) and InDels were obtained by comparing the whole genome sequences of mutant H512 with parental strain F7.

Table 3.

Alignment Statistics for Genome Sequencing Products

Strain	Sequencing average depth	Total no. reads	Gene number	Total sequence length
F7-WT	11.8	83,136	4854	5197733
H512	12.1	83,502	4851	5195926
V. Parahaemolyticus RIMD 2210633^a	/	/	4761	5165770

V. Parahaemolyticus RIMD 2210633 is a reference strain (NCBI reference sequence nos. NC_004603.1 and NC_004605.1).

WT, wild type; /, no information in NCBI database.

Thirty-one SNPs were found, including 20 that occurred in open reading frames (ORFs) and 5 in regions immediately upstream and downstream of ORFs. We also found 168 InDels that included 101 in ORFs (60.1%) and 8 and 10 in upstream and downstream of ORFs, respectively. Among them, the mutations were observed in five antimicrobial resistance-related genes encoding GyrA. ParE, VmeD, VmeI, and VP0040, respectively. The corresponding primers were designed (Table 1), and PCR assay was performed to verify the mutations that occurred in each step mutants (Table 4).

Table 4.

Mutations Acquired in the Quinolone Target Genes and Resistance Nodulation Cell Division Transporter/Regulatory Genes

Strain	Ciprofloxacin	QRDR mutations		RND transporter/regulator mutations			vmeD expression
Strain	MIC (μg/mL)	GyrA	ParE	vmeI	VmeD	vp0040	vmeD expression
F7-WT	0.016	WT	WT	WT	WT	WT	1
H32	4	Ser83Ile	WT	WT	Ala274Ser; Gly979Ser	WT	2.07
H128	16	Ser83Ile	Val461Glu	WT	Ala274Ser; Gly979Ser	Ins (15nt) A₁₁₃	8.21
H256	16	Ser83Ile	Val461Glu	Del A₁₆₈₇	Ala274Ser; Gly979Ser	Ins (15nt) A₁₁₃	5.75
H512	32	Ser83Ile	Val461Glu	Del A₁₆₈₇	Ala274Ser; Gly979Ser	Ins (15nt) A₁₁₃	11.05

MIC, minimal inhibitory concentration; QRDR, quinolone resistance determining region; RND, resistance nodulation cell division; WT, wild type.

Mutants H32, H128, H256, and H512 acquired T249A mutations in gyrA after selection, leading to a single amino acid substitution (Ser83Ile). Strain H128 showed a Val461Glu mutation in ParE, which might lead to an increase in the MIC to ciprofloxacin. We did not find any variations in gyrB and parC genes between strain F7 and mutants.

The mutations G820T and G2935A within vmeD arose from strain H32, resulting in Ala274Ser and Gly979Ser amino acid substitutions, respectively. In V. parahaemolyticus, the vmeD and vmeC genes are located in an operon (Matsuo et al., 2013). In mutants H256 and H512, we also identified a deletion (Del A₁₆₈₇) that led to a frame-shift in vmeI gene that encodes another RND efflux pump (Table 4).

Our genome comparisons and PCR assays also revealed the acquisition of a insertion in the vp0040 gene for mutants H128, H256, and H512. The vp0040 gene is located upstream of the vmeCD operon and encodes a putative TetR family transcriptional regulator. It was found that insertion of 15 nucleotide acids (GCTTTCTATGCAAAA) between A₁₁₃ and G₁₁₄ emerged in vp0040 ORF, and this mutation was located in the DNA-binding domain with a helix-turn-helix structure.

Efflux pump expression levels

The steady-state mRNA levels of efflux genes were examined in our mutant collection compared with the parental strain F7. The genes studied were vmeB, vmeD, and vpoC of RND efflux pump genes, as well as norM of MATE family efflux pump genes. The vmeD encodes a membrane fusion protein of RND efflux pumps and its expression in strain H512 was 11.05-fold greater than for F7. The vpoC gene, which encodes outer membrane protein, is an ortholog of tolC in E. coli, and its expression levels were 4.9- and 3.8-fold in strains H256 and H512, respectively, greater than for F7. However, the vmeB and norM gene mRNA levels were only slightly elevated in some of the mutants (less than twofold) (Table 5).

Table 5.

Expression Levels of the Efflux Pump Genes

Strain	Gene expression values^a
Strain	vmeB	vmeD	vpoC	norM
F7-WT	1	1	1	1
H32	1.28 ± 0.16	2.07 ± 0.15	1.56 ± 0.36	1.89 ± 0.45
H128	1.70 ± 0.25	8.21 ± 0.06	0.53 ± 0.16	0.67 ± 0.12
H256	1.47 ± 0.10	5.75 ± 0.13	4.9 ± 0.15	1.71 ± 0.28
H512	0.76 ± 0.28	11.05 ± 3.21	3.8 ± 0.53	0.78 ± 0.29

Mean ± SD of mRNA measured using reverse transcription-polymerase chain reaction.

WT, wild type.

Mutation in vp0040 related with ciprofloxacin resistance

The vp0040 mutations were examined for their involvement in ciprofloxacin resistance by replacement of wild-type alleles with the mutated versions. The introduction of the vp0040 mutated allele from H512 into strain F7 conferred the quinolone phenotype of an MIC increase for nalidixic acid from 0.5 to 4 μg/mL and for ciprofloxacin from 0.016 to 0.5 μg/mL. In contrast, introduction of the vp0040 wild-type allele into resistant mutant H512 restored the resistance levels for nalidixic acid from 64 to 32 μg/mL and for ciprofloxacin from 32 to 8 μg/mL (Table 2). This indicated that the insertions into vp0040 were responsible for the quinolone resistance in V. parahaemolyticus.

Discussion

In this study, we utilized increasing levels of ciprofloxacin to select quinolone-resistant mutants in vitro. Ciprofloxacin is the drug of choice for treating human V. parahaemolyticus infections and is commonly used in the aquaculture industry for disease prevention and therapeutics (Rico et al., 2012). Ciprofloxacin has been used to successfully induce and select for Salmonella Typhimurium mutants resistant to ciprofloxacin, ampicillin, tetracycline, and chloramphenicol (Ricci and Piddock, 2009; Kim et al., 2016).

This was also the case for V. parahaemolyticus where multidrug and cross resistance was induced, and mutants showed reduced susceptibilities to quinolones and altered susceptibilities to other antimicrobials. The cross-resistance phenotypes of these strains indicate the existence of non-specific antibiotic resistance mechanisms such as activating efflux pumps or reducing antibiotic inflow (Lupien et al., 2013). The predominant mutation profile was Ser83Ile in GyrA in combination with Ser85Leu in ParC in high-level fluoroquinolone resistance (Kitiyodom et al., 2010; Zhou et al., 2013). In our study, the Ser83Ile substitution in GyrA emerged, whereas no mutations in ParC were detected even in the highly resistant mutant H512. The result differed from previous reports that ciprofloxacin usually selects for parC mutations before gyrA in Gram-positive bacteria (Fukuda and Hiramatsu, 1999; Fisher et al., 2003).

This might be because DNA gyrase is usually the primary target of fluoroquinolone, whereas topoisomerase IV is the secondary target in Gram-negative bacteria (Huseby et al., 2017). Rather than ParC mutation, the H512 mutant possessed a Val461Glu mutation in ParE that might lead to higher resistance levels in the presence of altered GyrA. To our knowledge, no mutations in the parE gene have ever been reported in V. parahaemolyticus. Two mutations (D420N and P439S) in parE genes of V. cholerae were found to be involved in fluoroquinolone resistance (Zhou et al., 2013). The V. parahaemolyticus genome possesses 12 RND-type efflux transporter operons, and VmeAB and VmeCD play primary roles in its intrinsic resistance to many antimicrobials (Matsuo et al., 2013). The RND efflux pumps VmeAB-VpoC and VmeCD-VpoC can export fluoroquinolones, chloramphenicol, imipenem, and other antibiotics, resulting in a multiple drug resistance phenotype. In this study, mutants acquired two nonsynonymous mutations in the coding region of vmeD gene, and no mutations in the vmeCD promoter region were observed.

The Ala274Ser substitution in VmeD was located in the first cytoplasmic loop between transmembrane helices 1 and 2. The other Gly979Ser substitution was predicted to occur in the eleventh transmembrane helix. Both mutations involved changes from non-polar amino acids to polar amino acids. Further studies are necessary to reveal whether or not these mutations impact the conformation of the pump protein and its role involved in ciprofloxacin resistance. The expression levels of efflux pump genes before and after induction were also measured. Our results showed that vpoC and vmeD expression was directly correlated with the level of the concentration of ciprofloxacin used for induction. This linked the increased resistance of H256 and H512 to overexpression of vmeD and vpoC. These results indicated that VmeCD-VpoC is a primary efflux system involved in acquired resistance to quinolones. Ceftriaxone and doxycycline have also been used to select for multidrug resistance (MDR) strains of Burkholderia thailandensis and Neisseria gonorrhoeae due to increased efflux pump expression (Biot et al., 2013; Gong et al., 2016).

Regulators of efflux transporters have been identified in Vibrio sp. For example, the V. cholerae BreR protein is a TetR-like regulator that inhibits the vexCD operon that encodes an RND-type efflux transporter by promoter binding in trans (Bina et al., 2018; Stephen et al., 2022). The presence of inducer molecules results in BreR dissociation from the vexCD promoter, thus freeing the operon from repression (Cerda-Maira et al., 2013).

The vp0040 gene encodes a regulator belonging to the TetR family in V. parahaemolyticus, and it is a candidate for a similar type of regulatory mechanism involved in vmeCD regulation (Matsuo et al., 2013). In support of this, we found insertions in the DNA-binding domain of vp0040 gene in mutant strains H128, H256, and H512 and the resistance phenotypes could be transferred to the parental strain F7 that increased the ciprofloxacin MIC by 31.25-fold. The TetR family proteins bind as homodimers to binding sites located in promoters of transporter genes as well as the positive regulators of efflux pump expression such as ramA in Salmonella Typhimurium (Fàbrega et al., 2016; Marshall et al., 2020). The vp0040 insertions most likely impaired the ability of this TetR-like protein to exert its repressive activity, leading to an increased level of vmeCD expression in our mutants. This can be tested through additional experimentation in future studies.

Conclusions

The present study compared the genomes of V. parahaemolyticus strains before and after induction via exposure to increasing concentrations of ciprofloxacin. We identified novel mutations in the QRDR, efflux pump, and regulatory genes, and it is shown that these mutations and the increase of efflux pump genes expression were linked to increased ciprofloxacin resistance as well as MDR. These findings may help deepen our understanding of ciprofloxacin resistance mechanisms used by V. parahaemolyticus. The role of these mutations in drug resistance needs to be further verified in clinical or foodborne isolates.

Footnotes

Disclosure Statement

No competing financial interests exist.

Funding Information

This study was supported by the National Key R&D Program of China (Grant No. 2017YFC1600100) and the National Natural Science Foundation of China (Grant No. 31471660).

References

Bina

, Howard

, Taylor-Mulneix

, et al. The Vibrio cholerae RND efflux systems impact virulence factor production and adaptive responses via periplasmic sensor proteins. PLoS Pathog, 2018; 14:e1006804.

Biot

, Lopez

, Poyot

, et al. Interplay between three RND efflux pumps in doxycycline-selected strains of Burkholderia thailandensis . PLoS One, 2013; 8:e84068.

Cerda-Maira

, Kovacikova

, Jude

, et al. Characterization of BreR interaction with the bile response promoters breAB and breR in Vibrio cholerae . J Bacteriol, 2013; 195:307–317.

CLSI (Clinical and Laboratory Standards Institute). Performance standards for antimicrobial susceptibility testing: Twenty-sixth informational supplement. M100-S26. Wayne, PA: Clinical and Laboratory Standards Institute, 2016.

Dalhoff

. Global fluoroquinolone resistance epidemiology and implictions for clinical use. Interdiscip Perspect Infect Dis, 2012; 976273.

DePaola

, Kaysner

, Bowers

, et al. Environmental investigations of Vibrio parahaemolyticus in oysters following outbreaks in Washington, Texas, and New York (1997 and 1998). Appl Environ Microbiol, 2000; 66:4649–4654.

Elmahdi

, Dasilva

, Parveen

. Antibiotic resistance of Vibrio parahaemolyticus and Vibrio vulnificus in various countries: A review. Food Microbiol, 2016; 57:128–134.

Fàbrega

, Ballesté-Delpierre

, Vila

. Differential impact of ramRA mutations on both ramA transcription and decreased antimicrobial susceptibility in Salmonella Typhimurium. J Antimicrob Chemother, 2016; 71:617–624.

Ficici

, Zhou

, Castellano

, et al. Broadly conserved Na+-binding site in the N-lobe of prokaryotic multidrug MATE transporters. Proc Natl Acad Sci USA, 2018; 115:E6172–E6181.

10.

Fisher

, Gould

, Pan

, et al. Analysis of dual active fluoroquinolones in Streptococcus pneumoniae . J Antimicrob Chemother, 2003; 52:312–313; author reply 313–314.

11.

Fukuda

, Hiramatsu

. Primary targets of fluoroquinolones in Streptococcus pneumoniae . Antimicrob Agents Chemother, 1999; 43:410–412.

12.

Gong

, Lai

, Liu

, et al. Novel genes related to ceftriaxone resistance found among ceftriaxone-resistant Neisseria gonorrhoeae strains selected in vitro. Antimicrob Agents Chemother, 2016; 60:2043–2051.

13.

Gonzalez-Escalona

, Cachicas

, Acevedo

, et al. Vibrio parahaemolyticus diarrhea, Chile, 1998 and 2004. Emerging Infect Dis, 2005; 11:129–131.

14.

Hooper

. Mechanisms of fluoroquinolone resistance. Drug Resist Updates, 1999; 2:38–55.

15.

Huang

, Henao

, Griffin

, et al. Infection with pathogens transmitted commonly through food and the effect of increasing use of culture-independent diagnostic tests on surveillance—Foodborne diseases active surveillance network, 10U.S. Sites, 2012–2015. MMWR Morb Mortal Wkly Rep, 2016; 65:368–371.

16.

Huseby

, Pietsch

, Brandis

, et al. Mutation supply and relative fitness shape the genotypes of ciprofloxacin-resistant Escherichia coli . Mol Biol Evol, 2017; 34:1029–1039.

17.

Jiang

, Yao

, Li

, et al. Characterization of antimicrobial resistance of Vibrio parahaemolyticus from cultured sea cucumbers (Apostichopus japonicas). Lett Appl Microbiol, 2014; 59:147–154.

18.

Kim

, Jo

, Ding

, et al. Assessment of altered binding specificity of bacteriophage for ciprofloxacin-induced antibiotic-resistant Salmonella Typhimurium. Arch Microbiol, 2016; 198:521–529.

19.

Kitiyodom

, Khemtong

, Wongtavatchai

, et al. Characterization of antibiotic resistance in Vibrio spp. Isolated from farmed marine shrimps (Penaeus monodon). FEMS Microbiol Ecol, 2010; 72:219–227.

20.

Lei

, Jiang

, He

, et al. Prevalence, virulence, antimicrobial resistance, and molecular characterization of fluoroquinolone resistance of Vibrio parahaemolyticus from different types of food samples in China. Int J Food Microbiol, 2020; 317:108461.

21.

Letchumanan

, Chan

, Pusparajah

, et al. Insights into bacteriophage application in controlling Vibrio species. Front Microbiol, 2016; 7:1114.

22.

Lozano-Leon

, Torres

, Osorio

, et al. Identification of tdh positive Vibrio parahaemolyticus from an outbreak associated with raw oyster consumption in Spain. FEMS Microbiol Lett, 2003; 226:281–284.

23.

Lupien

, Billal

, Fani

, et al. Genomic characterization of ciprofloxacin resistance in a laboratory-derived mutant and a clinical isolate of Streptococcus pneumoniae . Antimicrob Agents Chemother, 2013; 57:4911–4919.

24.

, Wu

, Li

, et al. Characterization of ciprofloxacin resistance in laboratory-derived mutants of Vibrio parahaemolyticus with qnr gene. Foodborne Pathog Dis, 2018; 15:711–717.

25.

Marshall

, Lloyd

, Lawler

, et al. New multidrug efflux inhibitors for gram-negative bacteria. mBio, 2020; 11:e01340-20.

26.

Matsuo

, Nakamura

, Kodama

, et al. Characterization of all RND-type multidrug efflux transporters in Vibrio parahaemolyticus . Microbiologyopen, 2013; 2:725–742.

27.

Morita

, Kataoka

, Shiota

, et al. NorM of vibrio parahaemolyticus is an Na(+)-driven multidrug efflux pump. J Bacteriol, 2000; 182:6694–6697.

28.

Nishino

, Latifi

, Groisman

. Virulence and drug resistance roles of multidrug efflux systems of Salmonella enterica serovar Typhimurium. Mol Microbiol, 2006; 59:126–141.

29.

Okuda

, Hayakawa

, Nishibuchi

, et al. Sequence analysis of the gyrA and parC homologues of a wild-type strain of Vibrio parahaemolyticus and its fluoroquinolone-resistant mutants. Antimicrob Agents Chemother, 1999; 43:1156–1162.

30.

Ricci

, Piddock

LJV

. Ciprofloxacin selects for multidrug resistance in Salmonella enterica serovar Typhimurium mediated by at least two different pathways. J Antimicrob Chemother, 2009; 63:909–916.

31.

Rico

, Satapornvanit

, Haque

, et al. Use of chemicals and biological products in Asian aquaculture and their potential environmental risks: A critical review. Rev Fish Sci, 2012; 4:75–93.

32.

Roig

, Llorens

, Fouz

, et al. Spontaneous quinolone resistance in the zoonotic serovar of Vibrio vulnificus . Appl Environ Microbiol, 2009; 75:2577–2580.

33.

Stephen

, Lekshmi

, Ammini

, et al. Membrane efflux pumps of pathogenic Vibrio species: Role in antimicrobial resistance and virulence. Microorganisms, 2022; 10:382.

34.

Vinué

, Corcoran

, Hooper

, et al. Mutations that enhance the ciprofloxacin resistance of Escherichia coli with qnrA1 . Antimicrob Agents Chemother, 2015; 60:1537–1545.

35.

, Wen

, Ma

, et al. Epidemiology of foodborne disease outbreaks caused by Vibrio parahaemolyticus, China, 2003–2008. Food Control, 2014; 46:197–202.

36.

, Niu

, Yu

, et al. Prevalence and antimicrobial susceptibility of Vibrio parahaemolyticus isolated from retail shellfish in Shanghai. Food Control, 2015; 60:263–268.

37.

Zhou

, Yu

, Li

, et al. Accumulation of mutations in DNA gyrase and topoisomerase IV genes contributes to fluoroquinolone resistance in Vibrio cholera O139 strains. Int J Antimicrob Agents, 2013; 42:72–75.

38.

Zhou

, Liang

, Gao

, et al. Identification and expression analyses of new genes associated with ciprofloxacin resistance in Vibrio parahaemolyticus . Food Res Int, 2019; 125:108629.