Development of Two Loop-Mediated Isothermal Amplification Assays for Rapid Detection of ermB and mefA Genes in Streptococcus suis

Abstract

Streptococcus suis is an important zoonotic pathogen that poses a serious threat to the pig industry and human health. The massive use of macrolides has led to the emergence of resistance in S. suis, and S. suis is suspected to be a reservoir of antimicrobial resistance genes. The mechanism to macrolide resistance in S. suis is mainly due to ermB and mefA. In this study, loop-mediated isothermal amplification (LAMP) methods were developed to detect ermB and mefA genes in S. suis through turbidimetry detection. The sensitivity and specificity of the LAMP reactions were determined. All results of LAMP and polymerase chain reaction (PCR) assay were compared to determine whether LAMP method was accurate and reliable. The results showed that all 100 nonstreptococcus clinical isolates tested negative, indicating the high specificity of LAMP assays. The detection limit of LAMP assay was 1 fg per reaction, and 10²–10⁴-fold lower than those of conventional PCR methods. Evaluation of the performance of the LAMP assay in S. suis clinical strains revealed a good consistency between LAMP and PCR assays. In conclusion, LAMP assays are specific, sensitive, and rapid methods to detect ermB and mefA in S. suis.

Introduction

S treptococcus suis is not only a major problem in the swine industry, but it has also been recognized as an emerging zoonotic pathogen that may cause severe infections in humans (Feng et al, 2014; Gottschalk et al, 2007). Effective measures to control S. suis do not exist, so prophylaxis and treatment of S. suis infection mainly depend on antibiotics. The antimicrobial classes used for prophylaxis and treatment of S. suis in pigs and humans are similar (Yongkiettrakul et al, 2019), so occurrence of high levels of resistance of S. suis may represent a human health concern.

Macrolides have been used as a growth promoter for prophylaxis of streptococcal disease in swine (Wisselink et al, 2006), and this may have led to the drug resistance of macrolides in some countries. The first report of macrolide resistance in S. suis was a retrospective study of historic pig isolates during a 15-year span in Denmark, which indicated macrolide resistance had begun in the early 1980s (Aarestrup et al, 1998). Since then, resistance to erythromycin in pigs has been reported worldwide, for example, the resistance rate was 87% in Spain (Vela et al, 2005), 66% in Belgium (Callens et al, 2013), and 46% in England (Hernandez-Garcia et al, 2017).

In China, the resistance rates of S. suis to erythromycin increased rapidly from 34.78% to 67.29% between 2014 and 2020, respectively (Huang et al, 2015; Tan et al, 2021). In humans, resistance of clinical S. suis isolates to macrolides has also been acknowledged, with higher prevalence in Thailand (92.4%) (Bamphensin et al, 2021) than previous studies in Hong Kong and southern Vietnam (∼20%) (Hoa et al, 2011; Ma et al, 2008).

Resistance to macrolide is mainly attributed to ribosomal methylase encoded by erm genes or macrolide efflux protein encoded by mef genes. Among the numerous erm genes, ermB gene was the most common gene in macrolide resistance S. suis and associated with macrolide–lincosamide–streptogramin B (MLS_B) resistance phenotype (Holden et al, 2009; Martel et al, 2001). Whereas the mefA gene was associated with the resistance to 14- and 15-membered macrolides (known as M resistance phenotype) (Leclercq, 2002).

So far, only polymerase chain reaction (PCR) methods have been used to detect ermB and mefA genes in S. suis (Martel et al, 2001; Zhang et al, 2015), but PCR assays need expensive PCR instruments and gel imaging systems, and these instruments are not available in many places. To overcome the limitations of current PCR, loop-mediated isothermal amplification (LAMP) is more rapid and simple to perform (Notomi et al, 2000).

To date, few studies have been conducted to detect S. suis (Arai et al, 2015; Huy et al, 2012), serotype 2 (Zhang et al, 2013), and three virulence genes (mrp, epf, and sly) (Li et al, 2021) by the LAMP. In this study, simple, rapid, specific, and sensitive LAMP assays for detection of ermB and mefA genes were developed, and applied to investigate the frequency of these two genes among the clinical isolates in China.

Materials and Methods

Bacterial strains and genomic DNA extraction

Two S. suis strains (S41, ermB positive; S78, mefA positive) used for the optimization of LAMP assay were isolated from pig farms in Guangdong Province, China. In total, 160 known bacterial strains, including 100 nonstreptococcus strains (20 Staphylococcus aureus strains, 20 Enterococcus faecalis strains, 20 Escherichia coli strains, 20 Klebsiella pneumonia strains, and 20 Salmonella enteritidis strains) and 60 S. suis strains, were cultured and used in this study. In total, 100 nonstreptococcus strains were used to evaluate the specificity of LAMP assays (exclusivity test); the other 60 S. suis strains were included to apply the established LAMP assays for detection (inclusivity test).

All of the S. suis strains were cultured on Todd–Hewitt agar with 5% sheep blood. The other nonstreptococcus strains were cultured on Luria–Bertani agar. The susceptibility of 60 S. suis strains to erythromycin was determined by the agar dilution method according to the Clinical and Laboratory Standards Institute (CLSI, 2020). S. aureus ATCC 29213 was used as the quality control strain.

The genomic DNA extraction was performed according to the manual of Bacteria Genome Extraction Kit (Tiangen Biotech Co., Ltd). The concentration of the genomic DNA was measured by Nanodrop 2000 (Bio-Rad).

LAMP primer design and LAMP reaction

LAMP primers were designed using the PrimerExplorer V5 software based on the NCBI database sequences of ermB (738 bp, GenBank ID: NC_012926.1) and mefA (1218 bp, GenBank ID: KX077898.1). A cluster of primers were generated for ermB and mefA, respectively, including outer primers (F3 and B3) and inner primers (FIP and BIP). If we need to accelerate the reaction, loop primers (LF and LB) could be designed and added. The detailed information of primers is presented in Table 1.

Table 1.

Primers Used in This Study

Assay	Gene	Primer	Sequence (5′ to 3′)	Amplicon size (bp)
LAMP	ermB	2L-F3	TCTATCTGATTGTTGAAGAAGGA
		2L-B3	GCTTCCAATATTTATCTGGAACAT
		2L-FIP	AGCTTAAGCAATTGCTGAATCGAGTACCTTGGATATTCACCGAA
		2L-BIP	GCCAGCGGAATGCTTTCATCCTGTGGTATGGCGGGTAA
	mefA	2L-F3	TTCGGTGCTTACTATTGTTG
		2L-B3	ATAGACTGCAAAGACTGACT
		2L-FIP	GTGAAAAGCTGTTCCAATGCTACGCATTCTATATGGAGCTACCTGT
		2L-BIP	CCGGCTCTCAATGCGGTTACAGCCTGCACATTTCGTAAG
		2L-LB	GCCACTTTTAGTACCAGAAGAACA
PCR	ermB	F	GAAAAGGTACTCAACCAAATA	639
	ermB	R	AGTAACGGTACTTAAATTGTTTAC
	mefA	F	AGTATCATTAATCACTAGTGC	346
	mefA	R	TTCTTCTGGTACTAAAAGTGG

LAMP, loop-mediated isothermal amplification; PCR, polymerase chain reaction.

The LAMP assays were carried out in a reaction mixture with a total volume of 25 μL containing 40 pmol (each) of the primers FIP and BIP, 5 pmol (each) of the primers F3 and B3, 20 pmol of the loop primer, 12.5 μL of 2 × reaction mixture, 1.0 μL (8 U) of Bst DNA polymerase, and 2.0 μL of target genomic DNA by using the Loopamp DNA Amplification kit (Eiken Chemical Co., Ltd., Shanghai, China).

PCR assay to detect the resistance genes ermB and mefA

As a comparative method for gene detection, PCR was performed using a TaKaRa PCR Amplification Kit (Takara Bio, Inc., Shiga, Japan) in a total volume of 25 μL containing 10 μL of 2 × Taq PCR buffer, 1 μL forward primer (10 μM), 1 μL reverse primer (10 μM), 2 μL of sample DNA, and 11 μL of distilled water (DW). Primer sequences of ermB and mefA for PCR assays are given in Table 1, and PCR cycling conditions were detailed in a previous study (Sutcliffe et al, 1996). All PCR products were analyzed through a 1.2% agarose gel by electrophoresis.

LAMP assay

To monitor the turbidity of reaction tube in real time, a real-time turbidimeter (Loopamp LA-320C; Eiken Chemical Co., Ltd) was used to read the optical density at 650 nm (OD₆₅₀) at 6 s intervals. For ermB gene, each mixture was incubated at 63°C for 60 min and then heated at 80°C for 5 min to terminate the reaction. For mefA gene, the reaction temperature was 62°C.

Sensitivity of LAMP assay

The concentrations of genomic DNA from two isolates (S41 and S78) were adjusted to 10 ng/μL with DW. To determine the sensitivity of each LAMP assay, purified genomic DNA templates were detected through 10-fold serial dilution. In addition, PCR assays were performed using the same DNA templates. These experiments were done in duplicate.

Ethical statement

No animal-related tests were involved in this study, and the samples were provided by the farm owners who volunteered to participate in the study. All procedures were approved by the Animal Care and Use Committee of Shandong Academy of Agricultural Sciences (IASVM-2021-015).

Results

The sensitivity of LAMP and PCR assays

To compare the sensitivity of the LAMP and PCR assays, a series of 10-fold dilutions of template DNA was used, ranging from 1 ng per reaction to 0.1 fg per reaction. For sensitivity, the limit of detection is the lowest concentration that can be detected using the LAMP method. The results showed that the detection limit for the LAMP assay was 1 fg per reaction for both ermB and mefA (Fig. 1A, B). In comparison, the detection limits of PCR assays were 10 pg per reaction for ermB and 100 fg per reaction for mefA (Fig. 1C, D).

FIG. 1.

Sensitivity of LAMP and PCR assays. (A, B) Sensitivity of LAMP assays: (A) ermB and (B) mefA. Turbidity was monitored at 650 nm. (C, D) Sensitivity of PCR assays: (C) ermB and (D) mefA. M: DL 2000 DNA Marker; 1–8: 1 ng, 100 pg, 10 pg, 1 pg, 100 fg, 10 fg, 1 fg, and 0.1 fg per reaction, respectively; 9: negative control. LAMP, loop-mediated isothermal amplification; PCR, polymerase chain reaction.

Therefore, the sensitivities of the LAMP assays for ermB and mefA were 10²–10⁴ times lower than those of the PCR. In addition, the reaction time was 38 min for 1 ng per reaction and 54 min for 1 fg per reaction in the case of ermB, whereas the respective times were 23 and 54 min for mefA (Fig. 1A, B).

The specificity of LAMP assays in clinical isolates

In this study, 100 nonstreptococcus clinical isolates (including 5 bacterial species) were used to evaluate the specificity of LAMP assays. By detecting the turbidity of the reaction tube, ermB and mefA genes only could be detected in the known positive S. suis clinical strains (S41 and S78), no false positive amplification could be detected in other strains.

Application of LAMP assays in clinical S. suis isolates

According to the results of antimicrobial susceptibility testing, 55 strains were resistant to erythromycin. Minimum inhibitory concentrations of erythromycin are presented in Table 2. When LAMP assays were used to detect the resistance genes, 36 strains (60%) were positive for ermB, 11 strains (18.33%) positive for mefA, and 7 strains (11.67%) possessed both the ermB and mefA genes. These results were consistent with those of PCR assays (Table 2).

Table 2.

Clinical Streptococcus suis Isolates Evaluated

Strain no.	Origin of isolate		Erythromycin		Genotype	Assays of ermB		Assays of mefA
Strain no.	Location	Source	MIC (μg/mL)		Genotype	PCR	LAMP	PCR	LAMP
SS1	Foshan	Tonsil	256	R	ermB	(+)	(+)	(–)	(–)
SS2	Foshan	Liver	16	R	mefA	(–)	(–)	(+)	(+)
SS3	Shunde	Lung	256	R	Unknown^a	(–)	(–)	(–)	(–)
SS4	Foshan	Tonsil	32	R	ermB, mefA	(+)	(+)	(+)	(+)
SS5	Huadu	Spleen	256	R	ermB	(+)	(+)	(–)	(–)
SS6	Jiangxi	Spleen	0.25	S	Unknown	(–)	(–)	(–)	(–)
SS7	Foshan	Liver	8	R	Unknown	(–)	(–)	(–)	(–)
SS8	Foshan	Liver	64	R	Unknown	(–)	(–)	(–)	(–)
SS9	Foshan	Spleen	64	R	ermB	(+)	(+)	(–)	(–)
SS10	Foshan	Lymph	64	R	ermB	(+)	(+)	(–)	(–)
SS11	Shantou	Brain	256	R	ermB	(+)	(+)	(–)	(–)
SS12	Yunfu	heart	256	R	ermB	(+)	(+)	(–)	(–)
SS13	Yunfu	heart	256	R	ermB	(+)	(+)	(–)	(–)
SS14	Shenzhen	Liver	256	R	Unknown	(–)	(–)	(–)	(–)
SS15	Conghua	Tonsil	32	R	ermB	(+)	(+)	(–)	(–)
SS16	Conghua	Tonsil	256	R	ermB	(+)	(+)	(–)	(–)
SS17	Zengcheng	Lung	256	R	ermB, mefA	(+)	(+)	(+)	(+)
SS18	Zengcheng	Kidney	256	R	ermB, mefA	(+)	(+)	(+)	(+)
SS19	Dongguan	Spleen	256	R	ermB	(+)	(+)	(–)	(–)
SS20	Dongguan	Tonsil	256	R	ermB	(+)	(+)	(–)	(–)
SS21	Shunde	Lung	64	R	Unknown	(–)	(–)	(–)	(–)
SS22	Foshan	Spleen	128	R	mefA	(–)	(–)	(+)	(+)
SS23	Foshan	Liver	16	R	Unknown	(–)	(–)	(–)	(–)
SS24	Foshan	Liver	32	R	ermB	(+)	(+)	(–)	(–)
SS25	Foshan	Tonsil	128	R	ermB	(+)	(+)	(–)	(–)
SS26	Shaoshan	Lung	256	R	Unknown	(–)	(–)	(–)	(–)
SS27	Huadu	Lymph	256	R	ermB, mefA	(+)	(+)	(+)	(+)
SS28	Jiangxi	Heart	128	R	mefA	(–)	(–)	(+)	(+)
SS29	Shaoguan	Tonsil	256	R	ermB	(+)	(+)	(–)	(–)
SS30	Heyuan	Tonsil	512	R	ermB	(+)	(+)	(–)	(–)
SS31	Foshan	Tonsil	256	R	ermB	(+)	(+)	(–)	(–)
SS32	Jiangxi	Joint fluid	256	R	ermB, mefA	(+)	(+)	(+)	(+)
SS33	Zhaoqing	Heart	64	R	Unknown	(–)	(–)	(–)	(–)
SS34	Foshan	Tonsil	256	R	ermB	(+)	(+)	(–)	(–)
SS35	Jiangxi	pericardial fluid	256	R	mefA	(–)	(–)	(+)	(+)
SS36	Foshan	Liver	16	R	Unknown	(–)	(–)	(–)	(–)
SS37	Shaoguan	Lung	256	R	ermB	(+)	(+)	(–)	(–)
SS38	Foshan	Liver	256	R	Unknown	(–)	(–)	(–)	(–)
SS39	Shanguan	Liver	256	R	Unknown	(–)	(–)	(–)	(–)
SS40	Jiangxi	Liver	256	R	ermB	(+)	(+)	(–)	(–)
SS41	Shaoguan	Tonsil	256	R	ermB	(+)	(+)	(–)	(–)
SS42	Shaoguan	Heart	0.25	S	Unknown	(–)	(–)	(–)	(–)
SS43	Foshan	Liver	32	R	Unknown	(–)	(–)	(–)	(–)
SS44	Foshan	Lymph	256	R	ermB, mefA	(+)	(+)	(+)	(+)
SS45	Foshan	Tonsil	8	R	Unknown	(–)	(–)	(–)	(–)
SS46	Zhaoqing	Tonsil	64	R	ermB	(+)	(+)	(–)	(–)
SS47	Foshan	Tonsil	256	R	ermB, mefA	(+)	(+)	(+)	(+)
SS48	Foshan	Spleen	64	R	ermB	(+)	(+)	(–)	(–)
SS49	Foshan	Spleen	256	R	ermB	(+)	(+)	(–)	(–)
SS50	Foshan	Liver	0.25	S	Unknown	(–)	(–)	(–)	(–)
SS51	Foshan	Lymph	512	R	ermB	(+)	(+)	(–)	(–)
SS52	Pushan	Tonsil	0.25	S	Unknown	(–)	(–)	(–)	(–)
SS53	Panyu	Tonsil	512	R	ermB	(+)	(+)	(–)	(–)
SS54	Zhaoqing	Tonsil	256	R	ermB	(+)	(+)	(–)	(–)
SS55	Zengcheng	Tonsil	512	R	ermB	(+)	(+)	(–)	(–)
SS56	Shenzhen	Spleen	512	R	Unknown	(–)	(–)	(–)	(–)
SS57	Zhaoqing	Tonsil	16	R	Unknown	(–)	(–)	(–)	(–)
SS58	Shunde	Tonsil	128	R	ermB	(+)	(+)	(–)	(–)
SS59	Sihui	pericardial fluid	0.25	S	Unknown	(–)	(–)	(–)	(–)
SS60	Sihui	Tonsil	128	R	ermB	(+)	(+)	(–)	(–)

Unknown means that the strain carries neither the ermB nor the mefA gene.

MIC, minimum inhibitory concentration; R, resistant; S, susceptible.

Discussion

S. suis has been found in the upper respiratory tract of healthy pigs, and in recent years, it has been isolated from birds, mammalian species (excluding pigs), and the environment (Gottschalk et al, 2010). The resistance of S. suis can be transferred not only to humans, but also to other human streptococcal pathogens, such as S. pneumonia, S. pyogenes, and S. agalactiae (Palmieri et al, 2011). Macrolide resistance is common among streptococcus strains, and there are significant associations with the resistance to tilmicosin and three common virulence-related genes (mrp, epf, and sly) (Li et al, 2012). So it is imperative to monitor the resistance of macrolides in S. suis.

Thus, to meet the challenge, this study developed LAMP-based methods to detect ermB and mefA genes with high sensibility and specificity based on the actual situation in China. These two genes have been shown to be significantly associated with resistance phenotype. So the LAMP assays can be used not only to predict the phenotype of macrolide resistance, but also to detect the mechanism of macrolide resistance. The data presented in this study suggested that the developed LAMP assays are better than the PCR method, which will benefit clinical laboratories with the earlier detection.

LAMP assays have been applied to detect the macrolide resistance, such as msrA gene in S. aureus (Mu et al, 2016), erm(41) in Mycobacterium abscessus and Mycobacterium massiliense (Liu et al, 2019), and ermB gene in Clostridium difficile (Lin et al, 2015). The sensitivity of LAMP assays we developed in this study was 1 fg/μL, and is more sensitive than the mentioned studies.

When LAMP assays in this study were applied to clinical strains, the prevalence of ermB and mefA genes was 60% and 18.33%, respectively. This prevalence is higher than that of one study in Korea (Gurung et al, 2015), and lower than those of other studies in Japan and China (Huang et al, 2015; Southon et al, 2020; Zhang et al, 2015). In addition, seven strains carried both genes. The coexistence of the two genes was also found in three previous studies (Gurung et al, 2015; Huang et al, 2015; Ichikawa et al, 2020).

Though the detection of ermB and mefA genes by LAMP assay is rapid and accurate, there are some limitations. With regard to LAMP assays for the detection of resistance genes, the ultimate purpose is to apply in clinical samples. The LAMP assays established in this study could not be used for the direct detection from clinical samples. On the premise of culturing bacteria, if there is a rapid method or kit to extract bacterial DNA, this LAMP assay has a significant advantage over the PCR method. More work is required to apply LAMP assays for the gene direct detection in clinical samples.

Conclusions

LAMP is a simple and rapid method for the detection of resistance genes. The LAMP assays we established could successfully detect ermB and mefA with a detection limit 1 fg per reaction within 60 min. We anticipate this LAMP assay could be helpful to control the epidemic and spread of bacteria that contain ermB and/or mefA gene. To our knowledge, this is the first study to report the LAMP detection of ermB and mefA in S. suis.

Footnotes

Authors' Contributions

L.L. contributed to conceptualize the article, review relevant literature, and writing. J.R. and Q.Z. were responsible for getting familiar with the primer design process and designing related primers. Y.L., Y.Z., and J.Q. facilitated the data collection, and sample testing was done by L.L. J.R., X.Z., and M.H. assisted with the data analysis and interpretation of results. L.L. and Y.L. contributed to the construction of the article.

Disclosure Statement

No competing financial interests exist.

Funding Information

This study was supported by the National Key Research and Development Program of China (2019YFA0904002), Major Scientific and Technological Innovation Projects in Shandong Province (2019JZZY010719), and Open subject of State Key Laboratory of Infectious Disease Prevention and Control, China (2019SKLID317).

References

Aarestrup

, Rasmussen

, Artursson

, et al. Trends in the resistance to antimicrobial agents of Streptococcus suis isolates from Denmark and Sweden. Vet Microbiol, 1998; 63(1):71–80; doi: 10.1016/s0378-1135(98)00228-4

Arai

, Tohya

, Yamada

, et al. Development of loop-mediated isothermal amplification to detect Streptococcus suis and its application to retail pork meat in Japan. Int J Food Microbiol, 2015; 208:35–42; doi: 10.1016/j.ijfoodmicro.2015.05.008

Bamphensin

, Chopjitt

, Hatrongjit

, et al. Non-penicillin-susceptible Streptococcus suis isolated from humans. Pathogens, 2021; 10(9):1178; doi: 10.3390/pathogens10091178

Callens

, Haesebrouck

, Maes

, et al. Clinical resistance and decreased susceptibility in Streptococcus suis isolates from clinically healthy fattening pigs. Microb Drug Resist, 2013; 19(2):146–151; doi: 10.1089/mdr.2012.0131

CLSI. Performance Standards for Antimicrobial Susceptibility Testing. 30th ed. CLSI Supplement M100. Clinical and Laboratory Standards Institute: Wayne, PA; 2020.

Feng

, Zhang

, Wu

, et al. Streptococcus suis infection: An emerging/reemerging challenge of bacterial infectious diseases?. Virulence, 2014; 5(4):477–497; doi: 10.4161/viru.28595

Gottschalk

, Segura

, Xu

. Streptococcus suis infections in humans: The Chinese experience and the situation in North America. Anim Health Res Rev, 2007; 8(1):29–45; doi: 10.1017/S1466252307001247

Gottschalk

, Xu

, Calzas

, et al. Streptococcus suis: A new emerging or an old neglected zoonotic pathogen?. Future Microbiol, 2010; 5(3):371–391; doi: 10.2217/fmb.10.2

Gurung

, Tamang

, Moon

, et al. Molecular basis of resistance to selected antimicrobial agents in the emerging zoonotic pathogen Streptococcus suis . J Clin Microbiol, 2015; 53(7):2332–2336; doi: 10.1128/JCM.00123-15

10.

Hernandez-Garcia

, Wang

, Restif

, et al. Patterns of antimicrobial resistance in Streptococcus suis isolates from pigs with or without streptococcal disease in England between 2009 and 2014. Vet Microbiol, 2017; 207:117–124; doi: 10.1016/j.vetmic.2017.06.002

11.

Hoa

, Chieu

, Nghia

, et al. The antimicrobial resistance patterns and associated determinants in Streptococcus suis isolated from humans in southern Vietnam, 1997–2008. BMC Infect Dis, 2011; 11:6; doi: 10.1186/1471-2334-11-6

12.

Holden

, Hauser

, Sanders

, et al. Rapid evolution of virulence and drug resistance in the emerging zoonotic pathogen Streptococcus suis . PLoS One, 2009; 4(7):e6072; doi: 10.1371/journal.pone.0006072

13.

Huang

, Shang

, Kashif

, et al. Genetic diversity of Streptococcus suis isolated from three pig farms of China obtained by acquiring antibiotic resistance genes. J Sci Food Agric, 2015; 95(7):1454–1460; doi: 10.1002/jsfa.6841

14.

Huy

, Hang le

, Boamah

, et al. Development of a single-tube loop-mediated isothermal amplification assay for detection of four pathogens of bacterial meningitis. FEMS Microbiol Lett, 2012; 337(1):25–30; doi: 10.1111/1574-6968.12002

15.

Ichikawa

, Oshima

, Yamagishi

, et al. Changes in antimicrobial resistance phenotypes and genotypes in Streptococcus suis strains isolated from pigs in the Tokai area of Japan. J Vet Med Sci, 2020; 82(1):9–13; doi: 10.1292/jvms.19-0449

16.

Leclercq

. Mechanisms of resistance to macrolides and lincosamides: Nature of the resistance elements and their clinical implications. Clin Infect Dis, 2002; 34(4):482–492; doi: 10.1086/324626

17.

, Liao

, Sun

, et al. Antimicrobial resistance, serotypes, and virulence factors of Streptococcus suis isolates from diseased pigs. Foodborne Pathog Dis, 2012; 9(7):583–588; doi: 10.1089/fpd.2011.1106

18.

, Zhang

, Zhao

, et al. Rapid detection of mrp, epf, and sly genes by loop-mediated isothermal amplification in Streptococcus suis . Foodborne Pathog Dis, 2021; 18(4):290–296; doi: 10.1089/fpd.2020.2868

19.

Lin

, Liu

, Wang

, et al. Rapid detection of ermB gene in Clostridium difficile by loop-mediated isothermal amplification. J Med Microbiol, 2015; 64(8):854–861; doi: 10.1099/jmm.0.000109

20.

Liu

, He

, Jiang

, et al. Development of a loop-mediated isothermal amplification coupled lateral flow dipstick targeting erm(41) for detection of Mycobacterium abscessus and Mycobacterium massiliense . AMB Express, 2019; 9(1):11; doi: 10.1186/s13568-019-0734-4

21.

, Chung

, So

, et al. Streptococcus suis infection in Hong Kong: An emerging infectious disease?. Epidemiol Infect, 2008; 136(12):1691–1697; doi: 10.1017/S0950268808000332

22.

Martel

, Baele

, Devriese

, et al. Prevalence and mechanism of resistance against macrolides and lincosamides in Streptococcus suis isolates. Vet Microbiol, 2001; 83(3):287–297; doi: 10.1016/s0378-1135(01)00426-6

23.

, Liu

, Hui

, et al. A rapid loop-mediated isothermal amplification (LAMP) method for detection of the macrolide-streptogramin type B resistance gene msrA in Staphylococcus aureus . J Glob Antimicrob Resist, 2016; 7:53–58; doi: 10.1016/j.jgar.2016.07.006

24.

Notomi

, Okayama

, Masubuchi

, et al. Loop-mediated isothermal amplification of DNA. Nucleic Acids Res, 2000; 28(12):e63; doi: 10.1093/nar/28.12.e63

25.

Palmieri

, Varaldo

, Facinelli

. Streptococcus suis, an emerging drug-resistant animal and human pathogen. Front Microbiol, 2011; 2:235; doi: 10.3389/fmicb.2011.00235

26.

Southon

, Beres

, Kachroo

, et al. Population genomic molecular epidemiological study of macrolide resistant Streptococcus pyogenes in Iceland, 1995–2016: Identification of a large clonal population with a pbp2x mutation conferring reduced in vitro beta-lactam susceptibility. J Clin Microbiol, 2020; 58(9):e00638-20; doi: 10.1128/JCM.00638-20

27.

Sutcliffe

, Grebe

, Tait-Kamradt

, et al. Detection of erythromycin-resistant determinants by PCR. Antimicrob Agents Chemother, 1996; 40(11):2562–2566; doi: 10.1128/AAC.40.11.2562

28.

Tan

, Tan

, Zeng

, et al. Antimicrobial resistance phenotypes and genotypes of Streptococcus suis isolated from clinically healthy pigs from 2017 to 2019 in Jiangxi Province, China. J Appl Microbiol, 2021; 130(3):797–806; doi: 10.1111/jam.14831

29.

Vela

, Moreno

, Cebolla

, et al. Antimicrobial susceptibility of clinical strains of Streptococcus suis isolated from pigs in Spain. Vet Microbiol, 2005; 105(2):143–147; doi: 10.1016/j.vetmic.2004.10.009

30.

Wisselink

, Veldman

, Van den Eede

, et al. Quantitative susceptibility of Streptococcus suis strains isolated from diseased pigs in seven European countries to antimicrobial agents licensed in veterinary medicine. Vet Microbiol, 2006; 113(1–2):73–82; doi: 10.1016/j.vetmic.2005.10.035

31.

Yongkiettrakul

, Maneerat

, Arechanajan

, et al. Antimicrobial susceptibility of Streptococcus suis isolated from diseased pigs, asymptomatic pigs, and human patients in Thailand. BMC Vet Res, 2019; 15(1):5; doi: 10.1186/s12917-018-1732-5

32.

Zhang

, Zhang

, Song

, et al. Antimicrobial resistance profile and genotypic characteristics of Streptococcus suis capsular type 2 isolated from clinical carrier sows and diseased pigs in China. Biomed Res Int, 2015; 2015:284303; doi: 10.1155/2015/284303

33.

Zhang

, Zhu

, Ren

, et al. Rapid visual detection of highly pathogenic Streptococcus suis serotype 2 isolates by use of loop-mediated isothermal amplification. J Clin Microbiol, 2013; 51(10):3250–3256. doi: 10.1128/JCM.01183-13