Human Norovirus Detection: How Much Are We Prepared?

Abstract

Norovirus (NoV) is known to be the second nonbacterial enteric pathogen after rotavirus that causes acute gastroenteritis. They can be spread from person to person through fecal–oral routes. Infection can lead to severe diarrhea, causing stomach pain, vomiting, and nausea. Rapid detection of NoV can control huge economic and productive losses. Genotyping various emerging NoV strains is important to compare the severity among different strains. Conventional immunological and molecular methods have evolved and contributed to developing detection techniques. Immunological (enzyme-linked immunosorbent assay) and molecular detection (reverse transcriptase polymerase chain reaction [RT-PCR], RT-quantitative PCR, loop-mediated isothermal amplification, nucleic acid sequence–based alignment, recombinase polymerase amplification) methods have been mainly used. The development of biosensors using aptasensor, affinity peptides, nanoparticles, microfluidics, and so on, are currently the most researched topics. The availability of next-generation sequencing technologies has greatly influenced the diagnosis of NoV. The complementation of advanced technologies is helpful in identification of new variants. In this study, techniques that are useful in detecting NoV are discussed. This review has investigated the availability of recent methods used in the detection, present status, and futuristic plan of action in case of outbreak and pandemic.

Introduction

Norovirus (NoV) was named after a viral outbreak in Norwalk City, Ohio in 1968. It is also known as the Winter vomiting bug and is responsible for acute gastroenteritis. The infection spreads through fecal-oral pathways, contaminated water and food, and direct human-to-human contact (Adler and Zickl, 1969; Hemming et al., 2013). Symptoms of this infection usually occur in 24–48 h (Hallowell et al., 2019). According to the National outbreak reporting system, Centers for Disease Control and Prevention, there have been many reports of NoV outbreaks (Karst, 2010; https://www.cdc.gov/nors/). Factors that enhance the transmissibility of NoV include (1) the small inoculum required for infection, (2) prolonged viral shedding in feces, (3) its extraordinary survival ability in the environment, and (4) asymptomatic individuals that unknowingly transmit the infection to healthy individuals. A robust detection and genotyping system is essential for preventing the spread of viruses. Understanding the genetic makeup of viruses is essential to develop reliable methods of disease diagnosis.

NoV is a nonenveloped virus with a positive sense ssRNA genome of 7.5 kb with high genetic diversity. The viral genome resembles an mRNA structure. 5′ end of the genome is covalently linked to viral protein (VP) and the 3′ end is polyadenylated. The viral genome comprises three open reading frames (ORFs), designated ORF-1, ORF-2, and ORF-3. A total of eight proteins are encoded with these ORFs. ORF-1 encodes for nonstructural proteins including RNA-dependent RNA polymerase (RdRp) gene and ORF-2 for a major structural protein VP1 and ORF-3 for VP2 structural protein. NoV is generally classified based on the sequence diversity of viral capsid VP1. The amino acid sequence diversity classifies NoV into 10 genogroups (GI-GX) and 48 confirmed genotypes (Wang et al., 2021; Wang et al., 2012). A new genotype is assigned when VP1 amino acid sequence differs by >20% compared with the other genotypes. Rapid sequencing and accumulation of data in recent years led to an increase in the number of genotypes. Furthermore, a new system of classification was required for NoV classification.

The proposal for NoV classification recently came from an international group of experts analogous to the influenza virus classification. The foundation of the dual classification system was established by the work of Bull et al. (2007). They found that recombination is common in NoV at OFR1 and ORF2 junctions. A dual typing system was proposed based on complete capsid VP1 (∼555 amino acids) and partial RdRp sequence (∼1300 nt) (Chhabra et al., 2019; Kroneman et al., 2013). The virus with partial OFR1 (pORF1) in an established VP1 genotype is denoted with the capital letter “P” for the polymerase. For example, if a virus belongs to GII of the VP1 genotype with a pOFR1 sequence it will be referred to as “GII.P.”

The amino acid diversity of VP1 gene (termed genotype) and the nucleic acid diversity of nonstructural RdRp (termed P-type) are the basis of NoV classification (Fig. 1). VP typing has 10 genogroups (GI–GX), which are further classified into ∼50 genotypes. Among the genogroups GI, GII, GIV, GVIII, and GX can infect humans and are referred to as human NoV (HuNoV). In contrast, RdRp has 10 genogroups (GI.P–GX.P) (Chhabra et al., 2019). VP1 is often chosen as a target site for HuNoV detection because it comprises a conserved shell (S) that forms an icosahedral scaffold and a variable protruding (P) domain. The P domain is divided into P1 and P2 subdomains. P2 subdomain exposed on P domain is the primary immune epitope associated with immune response.

FIG. 1.

NoV classification based on Chhabra et al. (2019). The number of VP1 (genogroup and genotype) is based on amino acid diversity. The number of RdRp (P-groups and P-types) is based on nucleic acid diversity. NoV, Norovirus; RdRp, RNA-dependent RNA polymerase; VP1, viral protein 1.

Histo-blood group antigens expressed on RBC and gastroduodenal epithelium are the cellular receptor for P2 subdomain of HuNoV. The mutation in the amino acid sequence of P2 subdomain creates new variants. The analysis of VP1 sequence variation is essential for virus typing and surveillance (Chu et al., 2021; Zhou et al., 2023). VP2 is located inside the capsid that cannot be used as a target site (Lee et al., 2019; Prasad et al., 1999). The mutation rate of DNA virus and unicellular organisms are less than RNA virus as per Drake's rule (Drake et al., 1998). The high mutation rate can be further correlated with enhanced virulence (Duffy, 2018), false-negative results in diagnosis, and the unavailability of antiviral drugs for the treatment of HuNoV infection (Philip and Patton, 2022; Santos-Ferreira et al., 2021), collectively making the HuNoV a potentially dangerous pathogen in coming future.

In addition, the threat of NoV persists even after symptoms have resolved because of the continuous discharge of virus progeny from stool for a month or two, making an individual a “Virus Factory.” Globalization and trade across the continents have a significant impact on the availability and diversity of food. NoV particles are highly stable in the environment making food items an important source of contamination. The target organisms are humans, food animals, and other mammalian species. The first pandemic of NoV was reported in 1995–1996. European countries like Sweden, Finland, and England are the most affected, causing ∼3–22 outbreaks/million population (Hashemi et al., 2023; Lopman et al., 2003). The GII.4 genotype has been endemic and appears worldwide. However, GII.4 was replaced by GII.17 in 2014–2015.

Meanwhile, GII.4 Sydney was prevalent in Australia, Asia, and the United States (Zhang et al., 2022). According to Canada's public health agency, 339 HuNoV-related cases were reported in March 2022. In January 2023, 19 school students tested positive for HuNoV in Kerala, India (National Institute of Virology, Pune, India). The high mutation rate and lack of proper culture methods for HuNoV restrict the development of vaccines and antiviral against it. The overall preparedness to face the future pandemic caused by HuNoV needs appropriate strategies and R&D interventions. However, rapid detection and surveillance will decrease the impact of HuNoV illness.

Although viral diseases are controlled through immunization and other prevention methods, early diagnosis and treatment are crucial. Several immunological methods are available for the diagnosis of HuNoV samples. These immunological tests are easy to use, low cost, and produced in large quantities quickly. Immunoassays are based on polyclonal/monoclonal antibodies (mAbs) specific to recognize the target virus. The few drawbacks of the immunological assays are the stability of the product and less sensitivity compared with nucleic acid–based detection. Several immunoassays are discussed in the review.

Compared with immunological methods nucleic acid–based detection is sensitive and specific toward viral pathogens. However, it often requires trained personnel, is costly and there is associated carry-over contamination. Recently the SARS-CoV-2 diagnosis was mainly based on reverse transcriptase polymerase chain reaction (RT-PCR) test owing to its high specificity and sensitivity. The RT-PCR test has disadvantages as it takes several hours to complete because of the lengthy procedure and transportation of the samples to laboratory settings.

Onsite and real-time monitoring of pathogens is critical to check the spread of the disease. Recent progress in diagnostic technology based on clustered regulatory interspaced short palindromic repeats (CRISPR) has opened an innovative way to detect viral pathogens efficiently (Prasad et al., 2022). With the advantage of miniaturization, high durability, and scalability of manufacturing, CRISPR/CRISPR-associated protein (Cas) system will be a perfect choice for researchers. Cas is a crucial effector molecule that recognizes specific nucleic acids and simultaneously cleaves them at the trans site. The variants of Cas that are useful in diagnostics are mainly Cas12a and Cas13a because of their trans-collateral cleavage of nonspecific nucleic acid. The separation of specifically designed reporter nucleic acids creates readout signals leading to target RNA recognition.

NoV is highly contagious. A highly contagious disease has a high transmission rate, meaning it can infect a large number of people quickly and easily. When dealing with a highly contagious disease, early and accurate detection becomes crucial for controlling its spread and implementing appropriate public health measures. The spread of the virus can be stopped by frequent hand washing, use of disinfectant, and using hot water for laundry. In addition, guidelines focusing on infection prevention and control to reduce the NoV burden in hospitals, schools, residential apartments, food distribution settings, and childcare centers are useful (Chadwick et al., 2023). However, detection of NoV will significantly reduce the risk of contamination.

In this study, we discuss some of the developed techniques used in the detection of HuNoV. The detection techniques described in this review will help plan for the timely prevention of NoV infections. The article will be helpful to health workers and scientists in low-income countries. It could help study NoV prevalence, its genotyping, detection, and prevention of disease in resource-limited settings (Mans, 2019). Moreover, awareness of handling samples, their storage at <4°C, and cleaning the contaminated site using 0.1% hypochlorite solution could prevent transmission of infection.

Detection by Immunological Methods

Early immunological detections were based on serological diagnosis. Following the viral infection, the virus-specific antibodies (IgM) appear in body fluid after a few days of incubation. The presence of specific IgM demonstrates the viral infection. IgM are host proteins that serve as a first response against an antigen. They have been used to detect various disease-causing pathogens through antibody–antigen reactions. Most antigens are highly complex and have different epitopes recognized by different lymphocytes for which the antibody response is called polyclonal, whereas some antigens have a single epitope for which B-lymphocytes produce mAbs (Lipman et al., 2005).

Methods like immune adherence hemagglutination assay were used to detect the antibody of NoV in serum, whereas radioimmunoassay uses radioisotope-labeled antibodies (anti-NoV IgG) for detection of NoV. But labeled antibodies have a shorter life span in comparison with biotin–avidin immunoassay and enzyme immunoassay (EIA) (Wang et al., 2021). These hemagglutination-based assays have the advantage that they are relatively simple, inexpensive, and performed in a few hours. The reliability of the assay depends on factors like concentration of antigen and antibodies, incubation time, and correct titer estimation.

The NoV genome was cloned in 1992. Expression of VP1 protein in the host and self-assembling property of the VP1 can form virus-like particles. These virus-like particles have been used as an excellent platform for producing antibodies against HuNoV. The antibodies thus generated showed high specificity toward enzyme-linked immunosorbent assay (ELISA), radioimmunoassay, and EIA-based methods. Okame et al. (2007) reported using monoclonal and polyclonal antibodies to develop a sandwich ELISA method. This approach proved successful in detecting NoV GI and GII in stool samples. Immunochromatographic (ICG) strip tests are antibodies-based assays that are based on antibody–antigen complex migration through a filter membrane.

Takanashi et al. (2008) used polyclonal antibodies to develop ICG strip-based detection method to detect GI and GII NoV in stool samples. They stated that the developed methods were able to detect 1/100 to 1/1000 viral loads in clinical stool samples. To identify GI and GII NoV, Xu et al. (2021) developed a colloidal gold ICG test by producing three types of mAbs against S-domain of VP1 protein. The ICG was able to detect a range of genotypes of HuNoV. Limit of detection (LOD) for the S-domain of VP1 was 1.4 ng/mL, whereas LOD for viral genomic copies (gc) of GI and GII was 1.2 × 10⁶ gc/g and 4.4 × 10⁵ gc/g.

Compared with EIA-based kits, ICG-based kits offer a lower detection time (Khamrin et al., 2008; Kirby et al., 2010; Okitsu-Negishi et al., 2006). Burton-Macleod et al. (2004) had shown ELISA kits SRSV(II)-AD (Denka Seiken Co. Ltd, Tokyo, Japan) and IDEIA NLV (Dako Cytomation Ltd, Ely, United Kingdom) may replace RT-PCR for routine HuNoV diagnosis. They experimented on 103 stool samples, of which 39 were of other enteric viruses and the rest contained HuNoV. The Denka kit was able to show higher sensitivity (>70% for 10 of the 14 subgroups) than the Dako kit, which has lower sensitivity (<30% for six GII subgroups). In contrast, the specificity of the Dako kit was higher than the Denka kit, which was 100% and 69%. With this experiment, they concluded that both kits could replace RT-PCR for HuNoV detection. An experiment performed by de Bruin et al. (2006) demonstrates the same experiment but with a different assay, that is, The IDEIA Norwalk-like virus (Dakocytomation Ltd, Ely, United Kingdom) and the Ridascreen Norwalk-like virus enzyme immunoassay (R-Biopharm AG, Darmstadt, Germany).

A total of 158 fecal samples was collected from 23 outbreaks in which the Dako kit showed a sensitivity of 38% and specificity of 96%, whereas the Ridascreen kit showed a sensitivity of 36% and specificity of 88%. Results obtained from these kits are only helpful for preliminary screening and need further testing to confirm using RT-PCR.

Another way to prevent the spread of HuNoV is to screen food items before consumption. The water samples, seafood, and salads require screening for better surveillance of HuNoV. Advanced real-time detection is gaining advantage over conventional methods. For example, combined confocal and Raman spectroscopy and flow cytometry are the few emerging tools to analyze cells or/and viral components (Rowan, 2023). Immunological methods may not be as sensitive as molecular methods, especially during the early stages of infection when antibody levels may be low. Molecular methods detect and amplify specific nucleic acids (DNA or RNA) of the pathogen. They rely on the use of specific primers or probes to target and amplify the genetic material of the pathogen.

Molecular Detection Method

Molecular methods for virus detection have revolutionized the field of virology and have become indispensable tools in infectious disease management. These methods are very sensitive and specific to NoV detection. The minimum infective dose for HuNoV is as low as 18 virus particles (Rico et al., 2020; Yao et al., 2020). Developing a highly sensitive molecular method for detecting HuNoV is critical (Li et al., 2023). Conserved genome segments of HuNoV were primarily used in molecular detection methods (Katayama et al., 2002). Many types of primers and probes were designed to target flanking region of ORF1 and ORF2 for efficient amplification (Kageyama et al., 2003; Loisy et al., 2005; Rolfe et al., 2007). The primers and probes used in PCR-based assay are listed in Table 1. A rapid method like RNA-FISH (fluorescence in situ hybridization) was used to detect SARS-CoV-2 virus with high accuracy within 20 min. RNA-FISH method does not require nucleic acid amplification and LOD was in a compatible range with RT-PCR (LOD ∼10² RNA copies) (Hepp et al., 2021).

Table 1.

Detection and Genogrouping of Norovirus Isolate Through Primers and Probes

Primer/probe	Sequence (5′ to 3′)	Genogroup	Position	Type	Reference
COG1F	CGYTGGATGCGNTTYCATGA	I	5291–5310	Primer	Kageyama et al. (2003)
COG1R	CTTAGACGCCATCATCATTYAC	I	5351–5375	Primer
RING1(a)-TP	FAM-AGATYGCGATCYCCTGTCCA-TAMRA	I	5321–5340	Probe
RING1(b)-TP	FAM-AGATCGCGGTCTCCTGTCCA-TAMRA	I	5321–5340	Probe
COG2F	CARGARBCNATGTTYAGRTGGATGAG	II	5003	Primer
COG2R	TCGACGCCATCTTCATTCACA	II	5100–5080	Primer
RING2-TP	FAM-TGGGAGGGCGATCGCAATCT-TAMRA	II	5048–5067	Probe
NV65a	TGGACAGGRGATCGCRATCT	I	5321–5240	Primer	Höhneand Schreier (2004)
NV120	AYATCACCGGGGGTATTRTT	I	5593–5574	Primer
TM6 probe	FAM-GCGTCCTTAGACGCCATCATCATTTAC-TAMRA	I	5354–5380	Probe
NV107a	AGCCAATGTTCAGATGGATG	II	5007–5026	Primer
NV117a	TCGACGCCATCTTCATTCAC	II	5100–5081	Primer
TM3 probe	FAM-TGGGAGGGCGATCGCAATCTGGC-TAMRA	II	5048–5070	Probe
LZIF	GGAGATCGCRATCTCCTGCCCGA	I	5323–5344	Primer	Luo et al. (2020)
LZIR-A	CTCYGGTACCAGCTGGCC	I	5407–5426	Primer
LZIR-B	CCTCYGGHACCAGCTGACC	I	5407–5427	Primer
LZIP	HEX–CGTCCTTAGACGCCATCATCATTTAC–MGB	I	5349–5374	Probe
LZIIF-A	GTGGGATGGACTTTTACGTGCCAAG	II	4971–4995	Primer
LZIIF-B	GGTGGMATGGATTTTTACGTGCCCAG	II	4970–4995	Primer
LZIIR	CGTCAYTCGACGCCATCTTCATTCAC	II	5075–5100	Primer
LZIIP	FAM–AGCCAGATTGCGATCGCC–MGB	II	5048–5065	Probe
QNIF4	CGCTGGATGCGNTTCCAT	I	—	Primer	Da Silva et al. (2007)
NV1LCR	CCTTAGACGCCATCATCATTTAC	I	—	Primer
NV1LCpr	FAM-TGGACAGGAGAYCGCRATCT-TAMRA	I	—	Probe
QNIF2d	ATGTTCAGRTGGATGAGRTTCTCWGA	II	5012–5037	Primer
QNIFS	FAM-AGCACGTGGGAGGGCGATCG-TAMRA	II	5042–5061	Probe
JJV1F	GCCATGTTCCGITGGATG	I	5282–5299	Primer	Jothikumar et al. (2005)
JJV1R	TCCTTAGACGCCATCATCAT	I	5377–5358	Primer
JJV1P	FAM-TGTGGACAGGAGATCGCAATCTC-BHQ	I	5319–5341	Probe
JJV2F	CAAGAGTCAATGTTTAGGTGGATGAG	II	5003–5028	Primer

Isothermal amplification can detect HuNoV with its advantages over thermal cycling approaches. Reverse transcription–loop-mediated isothermal amplification (RT-LAMP) and nucleic acid sequence–based alignment (NASBA) are the most often used isothermal amplification technologies. Reverse transcription PCR, quantitative real-time polymerase chain reaction (qRT-PCR), and reverse transcription digital PCR are examples of thermal cycling procedures (Wang et al., 2021). A list of molecular detection by isothermal and thermal cycling methods is given in Table 2.

Table 2.

Types of Molecular Detection Methods Used for Detection of Norovirus

S.no	Detection	Samples	Types/genogroup	LOD	References
1	Droplet digital RT-qPCR	Oyster samples	Murine NoV	1 × 10⁶ PFU/0.2 g	Plante et al. (2021)
2	Real-time RT-qPCR	Water samples	GII.4 and Murine NoV 1	2.0 × 10¹ copies/reaction	Park et al. (2021)
3	RT-PCR	Stool samples	GI and GII	5–50 copies/reaction	Chhabra et al. (2019)
4	RT-RAA	Stool samples	GII.4	3.425 log₁₀ genomic copies/reaction	Qin et al. (2021)
5	RT-qPCR	Water samples	GI and GII	3.2 log₁₀ genomic copies/L	Jahne et al. (2020)
6	RT-nested PCR	Oyster samples	GI and GII	3.36 × 10¹ RNA copies/g, 1.29 × 10³ RNA copies/g	Tunyakittaveeward et al. (2019)
7	RT-PCR kits: assay A (Norovirus Real-Time RT-PCR kit), assay B (LightCycler RNA Master Hybprobe), and assay C (RealTime ready RNA Virus Master)	Fecal samples	GI and GII	GI: (1 × 10³ copies/mL for assay A and B, 1 × 10⁵ copies/mL for assay C), GII: (1 × 10³ copies/mL for assay A, B and C)	Rupprom et al. (2017)
8	RT-RPA	Stool samples	GII.4	3.40 ± 0.20 log₁₀ genomic copies/reaction	Moore et al. (2004)
9	RT-PCR and RT-qPCR	Spiked lettuce and bottled water	GI and GII	500 genome copies/reaction mixture	Coudray-Meunier et al. (2015)
10	RT-LAMP	Stool samples	GI and GII	4.7 × 10¹ genomic copies/μL	Jeon et al. (2017)
11	Multiplex RT-NASBA	Fecal samples	GII	100 copies/reaction	Mo et al. (2015)
12	RT-LAMP	Stool samples	GII	10³ copies/tube	Luo et al. (2014)
13	RT-qPCR	Stool samples	GII	50 copies/reaction	Gregory et al. (2011)

LAMP, loop-mediated isothermal amplification; LOD, limit of detection; NASBA, nucleic acid sequence–based alignment; PCR, polymerase chain reaction; PFU, plaque-forming unit; RT-LAMP, reverse transcription LAMP; RT-NASBA, reverse transcription NASBA; RT-PCR, reverse transcription-PCR; RT-qPCR, reverse transcription–quantitative PCR; RT-RAA, reverse transcriptase–recombinase-aided amplification; RT-RPA, reverse transcriptase–recombinase polymerase amplification.

Thermal cycling

Thermal cycling is a fundamental process in PCR, which is widely used in various applications, such as genetic testing, DNA sequencing, and diagnostics. The process precisely controls the temperature at different stages to achieve specific reactions. In conventional PCR the results are analyzed after the reaction using gel electrophoresis or other post-PCR methods, providing qualitative information about the presence or absence of the target sequence. On the contrary, qRT-PCR includes fluorescent probes or DNA-binding dyes that allow real-time monitoring of the amplification process, providing continuous data collection during the reaction, enabling precise quantification of the initial amount of the target DNA or RNA, making it particularly valuable for viral load quantification and diagnostic applications.

The qRT-PCR monitors the progression of the DNA amplification by measuring signals generated by chromophores activated during the amplification process simultaneously. At the same time, it allows multiplexing the reaction to detect multiple variants of pathogens in one tube. Designing primers is a critical step in establishing an efficient assay for multiplex quantitative PCR (qPCR) (Xu et al., 2022). qRT-PCR is the most widely used technology for detecting viral pathogens worldwide owing to advantages such as the one-tube method, from sample collection to final results, almost no carry-over contamination, and not relying on any downstream analysis such as densitometry or electrophoresis (Artika et al., 2022) ultimately minimizing the threat of infection. However, qRT-PCR has drawbacks such as poor scalability and high false-negative results requiring multiple specimens to detect the virus. There are an array of variants of this technique.

A real-time quantitative TaqMan assay exploits 5′→3′ exonuclease activity to cleave the probe while amplifying specific target DNA (Arya et al., 2005; Zhang et al., 2022). These ssDNA probes are labeled with fluorophore and quencher at the ends. The close proximity of the fluorophore and quencher in an intact probe quenches the fluorescence owing to fluorescence resonance energy transfer (FRET) while the progression of amplification and, subsequently, cleavage of the probe fluorescence signal is emitted. As the amplification proceeds, the fluorescence gets accumulated proportionally in real-time.

Molecular bacon act like switches that remain in the normally closed position. The switched-off arrangement is achieved by taking advantage of the complementarity binding of nucleic acid strands. The single-stranded probes are designed with a palindromic sequence making it a hairpin structure. The edges are functionalized with a fluorophore and a quencher. The molecular beacon probe in a switched-off condition prevents the fluorophore from emitting a signal because of FRET. Once the probe finds a complementary sequence the fluorophore and quencher get separated generating a fluorescent signal (Prajapati et al., 2023; Tan et al., 2004). The molecular beacon probes can be designed and synthesized easily and recognize DNA and RNA. Besides being used in qRT-PCR the molecular beacon can also directly integrate with point-of-care (POC) devices or in in vivo studies (Saisuk et al., 2022). Similar to TaqMan probes, molecular beacons can also be multiplexed (Anderson et al., 2023).

Other variants of qRT-PCR are based on dual hybridization probes (Aliyu et al., 2004) and Scorpion probes (Singh et al., 2009) used for virus quantification and detection. Batule et al. (2018) used HRPzyme-integrated PCR to detect NoV shellfish samples. This approach detected up to 1 copy/mL of GI and GII genome.

In addition, spiked oyster samples were used, demonstrating that this method is very sensitive and selective for detecting HuNoVs in actual samples. In another study, 156 samples were obtained from a wastewater treatment plant at three different stages of a water treatment plant. At the same time, next-generation sequencing (NGS) was used to explore the diversity of GII genogroup. qRT-PCR found NoV in 38.5% and 96.1% of raw sewage samples, 40.4% and 96.1% of primary effluent samples, and 1.9% and 5.8% of final effluent samples, respectively (Fumian et al., 2019).

qRT-PCR–based commercial kits used to detect NoV are rapid and user-friendly. Rupprom et al. (2017) studied three types of PCR assays in which two showed higher sensitivity for NoV GI, whereas all three had the same sensitivity for NoV GII (10³ DNA copies/mL). Chhabra et al. (2019) assessed the performance of three commercial kits for the detection of GI and GII groups of HuNoVs in fecal samples: Luminex xTAG^® Gastrointestinal Pathogen Panel (GPP), Biofire's Gastrointestinal Panel (FilmArray, BioFire Diagnostics, Salt Lake City, UT), and the TaqMan Array Card. Zhuo et al. (2018) reported that Luminex xTag GPP kit was able to detect the GII.2 and GII.3 genogroups of HuNoVs and found that it is not very sensitive for these genogroups.

Isothermal amplification

Both thermal cycling and isothermal amplification techniques are valuable tools for nucleic acid amplification, with each having its strengths and weaknesses. Thermal cycling involves a series of repeated temperature changes to perform the amplification process. In contrast, isothermal amplification operates at a constant temperature throughout the amplification process. Isothermal amplification methods are gaining prominence because of their simplicity, rapidity, and potential for POC diagnostics, particularly in resource-limited settings. Loop-mediated isothermal amplification (LAMP) is a benchmark tool in isothermal amplification and has successfully overcome the drawback associated with PCR-based assays (Srivastava and Prasad, 2023). However, isothermal technologies also have limitations in terms of optimization, cost of primers, primer incompatibility issues, and cross-contamination of target nucleic acid with reagents. Different genotypes of HuNoV were detected using LAMP.

In an experiment, the LOD of RT-LAMP was found to be 10³ genomic copies per reaction tube. Hydroxy-naphthol blue is added to visually analyze the results (Luo et al., 2014). Jeon et al. (2017) developed a technique using RT-LAMP for detecting HuNoV genogroups GI and GII in oysters. The developed method detected 10¹ copies of HuNoV genome per microliter and was more sensitive than other RT-PCR and RT-LAMP methods.

NASBA has been used to identify NoV because of its excellent specificity, and ease of use. Greene et al. (2003) reported that the stool samples contained LOD of 10⁴ copies/mL of NoV using NASBA. Lamhoujeb et al. (2009) reported the detection of GII HuNoVs through a real-time molecular beacon NASBA in clinical samples, which was 88.5% compatible with the RT-qPCR results.

Isothermal amplification techniques NASBA and reverse transcriptase–recombinase polymerase amplification (RT-RPA) were coupled with a paper-based cell-free transcription-translation system. Synbodies prepended virus to produce a colorimetric assay for detecting NoV with an LOD of 270 aM. It produces a colorimetric assay for detecting NoV with an LOD of 270 aM (Ma et al., 2018). The NoV in stool samples was enriched using synbodies and magnetic beads to increase the sensitivity to multiple folds. This device detected GII.4 NoV from clinical samples in visually visible reactions. Qin et al. (2021) developed a reverse transcriptase–recombinase-aided amplification–based method for detecting NoV. This isothermal method detected GII.4 NoV at 39°C in 30 min with a detection sensitivity of 3.435 log₁₀ genomic copies per reaction.

When complemented by the latest NGS technologies, molecular and immunological techniques may dominate the diagnostic industry. The cheaper NGS technologies and desktop sequencing platform availability makes the process even more robust. NGS will also reduce detection time and is helpful in discovering new variants of viral pathogens. The NGS will help access viral routes and spread pattern across the population. The genomic sequence allows researchers to obtain the complete genetic information of the new variant. By comparing the sequence of the new variant with previously known sequences, researchers can identify regions of the genome that are conserved across variants and regions that have undergone mutations or genetic changes specific to the new variant. Based on this information, new primers and probes can be designed to specifically target the regions that are unique to the new variant. Recently metagenomics NGS (mNGS) has been utilized for pathogen monitoring and detection.

However, the clinical utility of mNGS needs thorough evaluation (Xu et al., 2023). Some challenges in implementing mNGS in clinical settings include data analysis and interpretation and the need for specialized bioinformatics expertise. Nonetheless, ongoing advancements in sequencing technologies and bioinformatics tools are making NGS-based approaches increasingly feasible for routine clinical NoV detection and surveillance.

CRISPR/Cas-Based Diagnosis

PCR could detect DNA with excellent specificity. However, detecting RNA requires an additional step for conversion of RNA to cDNA leading to a high cost and lengthy process. Besides its role in gene editing, CRISPR/Cas system has newly evolved in disease diagnosis (Schermer et al., 2020). CRISPR-based amplification-free digital RNA detection in short, SATORI, is one of the several platforms that use CRISPR/Cas system that detects ssRNA as the target molecule (Shinoda et al., 2021). The SATORI is an amplification-free method used to detect viruses possessing RNA genomes like hepatitis, influenza, SARS-COVID, poliomyelitis, and even HuNoV. This system relies on the Cas13a nuclease, which cleaves the ssRNA fluorescence reporter through trans-collateral cleavage activity (Gootenberg et al., 2017). The entire detection time is <5 min compared with other PCR or CRISPR/Cas-based methods. The LOD is up to 5 fM.

For the detection of ssDNA and dsDNA viruses, other variants of CRISPR/Cas system are available. DNA Endonuclease-Targeted CRISPR Trans Reporter (DETECTR) is one such platform that uses Cas12a effector protein. Cas12a can nonspecifically cleave ssDNA targets through its transcollateral activity binding to specific dsDNA bearing viruses. Specific high-sensitivity enzymatic reporter unlocking (SHERLOCK) is another platform that relies on Cas13 effector endonuclease that cleaves ssRNA through collateral cleavage activity (East-Seletsky et al., 2016). The advanced version of SHERLOCK is also reported to target DNA viruses (Kaminski et al., 2021; Kellner et al., 2019). SATORI is an amplification-free method, efficiently deployed in resource-limited places. However, SHERLOCK and DETECTR need preamplification and processing of nucleic acid to increase their sensitivity up to aM level (Qian et al., 2021).

CRISPR/Cas12a system has been successfully coupled with RT-RPA for detecting GII.4 HuNoV. Based on RdRp gene, three primers were designed and used for amplification, which was further detected by CRISPR/Cas12a coupled with fluorescence or lateral flow. This process for detection is carried out within 40 min and LOD was found to be 9.65 × 10² copies/mL (Qian et al., 2021).

The CRISPR/Cas system offers several advantages for detecting NoV, making it a promising tool in molecular diagnostics. CRISPR/Cas systems can be programmed to target specific sequences of the NoV genome with high specificity and sensitivity. This ensures that only the desired NoV strains are detected, reducing the likelihood of false-positive results even at low concentrations of NoV in a sample. CRISPR/Cas-based detection methods can be adapted for use in POC devices. This allows for on-site testing in resource-limited settings. Owing to the high mutation rate of NoV, several new strains could emerge. The CRISPR/Cas system can be programmed to target multiple regions of the NoV genome simultaneously. This multiplexing capability enables the detection of different NoV strains or other pathogens in a single assay. Nucleic acid amplification may be avoided before virus detection, which substantially reduces the cost of detection.

Detection by Nanomaterials and Biosensors

The development of biosensors for virus detection is a multidisciplinary effort that involves collaboration between virologists, material scientists, engineers, and clinicians. Advances in nanotechnology, biotechnology, and sensor technology continue to drive the development of innovative biosensors with improved performance, portability, and accessibility for virus detection in various settings. Biosensors have been developed in many ways over the past few years. Properties like less time taking, easy to use, low cost, stability, and their ability to be integrated with a miniaturized device have served as a helping hand for the development of POC testing devices. A list of biosensors used to detect NoV is given in Table 3.

Table 3.

Types of Biosensors Used for the Detection of Different Groups of Norovirus

S. no.	Type	Detection limit	Time	Target	Reference
1.	G-quadruplex and graphene oxide–coated microbeads-based colorimetric biosensor	10¹ PFU	30 min	NoV RNA	Cui et al. (2022)
2.	Phosphorene-gold nanocomposites–based electrochemical biosensor	0.28 ng/mL	35 min	Spiked NoV	Jiang et al. (2022)
3.	Sandwich-type electrochemical biosensor	0.84 copy/mL	1.5–2 h	Aptamer and peptide of GII virus group	Zhao et al. (2022)
4.	Antigen–antibody bioassay–based biosensor using carbon dot fluorescence and polydopamine-functionalized magnetic silver nanocubes	80 copies/mL	Around 10 min	Norovirus (whole virus)	Achadu et al. (2021)
5.	Biosensor-based on graphene-mediated surface-enhanced Raman scattering with plasmonic/magnetic molybdenum trioxide nanocubes	10²–10⁶ RNA copies/mL	—	NoV-specific antigen−antibody interactions sandwich immune complex	Achadu et al. (2020)
6.	Norovirus-specific binding peptide on the WS2NF/gold nanoparticles-based electrochemical biosensor	2.37 copies/mL	60 min	NoV type GI and GII affinity peptide	Baek et al. (2020)
7.	Photoelectrochemical biosensor coupled with mAb	46 copies/μL	30 min	Recombinant NoV capsid protein VP1	Guo et al. (2020)
8.	Guanine chemiluminescence detection-based DNA aptasensor	80 ng/mL	30 min	NoV GII capsid	Kim et al. (2018)
9.	Graphene-gold nano-composite aptasensor	100 pM	35 min	NoV with redox-tagged aptamer	Chand and Neethirajan (2017)
10.	Free peptides immobilized on gold surface for detection	7.8 copies/mL human samples	2 h	rP2 protein	Hwang et al. (2017)
11.	Gold/magnetic nanoparticle-decorated graphenes (GRPs) NoV-like particle biosensor	1.16 pg/mL	1 h	NoV antibody	Lee et al. (2017)
12.	Aptamer-based fluorometric, paper microfluidic device	13 ng/mL to 13 μg/mL NoV	10 min	NoV group II (recombinant virus-like particle)	Weng et al. (2017)
13.	F0F1-ATPase Molecular motor biosensor chromatophore	0.005 ng/mL	1 h	NoV RNA	Zhao et al. (2016)
14.	Bilayer interferometry	10⁵ dilution	10–20 min	Virus specific antibodies from human serum	Auer et al. (2015)
15.	Electrochemical biosensor with nanostructured gold electrode	35 copies/mL	1 h	Selective capturing of virus by concanavalin	Hong et al. (2015)
16.	SPR biosensor	104 TCID50 FCV/mL	15 min	Secondary antibody binding	Yakes et al. (2013)

FCV, feline calicivirus; GRPs, gold/magnetic nanoparticle-decorated graphenes; mAb, monoclonal antibody; NoV, Norovirus; PFU, plaque-forming unit; SPR, surface plasmon resonance; VP1, viral protein 1.

Aptamers are short, single-stranded DNA or RNA molecules that have a unique three-dimensional structure allowing them to bind to specific target molecules with high affinity and selectivity. They are often referred to as “chemical antibodies” because of their ability to mimic the binding properties of antibodies. Giamberardino et al. (2013) used SELEX (Systematic Evolution of Ligands by Exponential Enrichment) to design an efficient aptamer, AG3, with a high affinity for murine NoV (MNV). AG3 could bind with MNV with a lower detection level (picomolar range) than fluorescence anisotropy. They also used a gold nanoparticle-modified screen-printed carbon electrode (SPCE) to integrate AG3 with an electrochemical sensor. With an LOD of 180 virus particles, the developed aptasensor could detect MNV.

Khoris et al. (2019) developed a colorimetric bioassay using Au/Ag NPs to detect NoV. They used anti-NoV genogroup II antibodies mounted on the surface of a 96-well microtiter plate to trap the virus, resulting in a sandwich of antibodies, NoV, and nanoparticles. NoV-like particles were detected with a 10.8 pg/mL LOD higher than gold immunoassay and horseradish peroxidase–based ELISA concluding that it helps detect the low concentration of NoV at an early stage.

Hwang et al. (2017) created affinity peptide-based biosensors to detect noroviral capsid protein. It was achieved by immobilizing chemically generated amino acid substitution and cysteine-integrated recognition peptides. The thiol group was functionalized on a gold sensor surface to detect noroviral capsid protein. Quartz crystal microbalance, coefficient of variation, and EIS were used to evaluate detection performance, with electrochemical impedance spectroscopy (EIS) revealing an LOD of 99.8 nM for rP2 and 7.8 copies/mL for HuNoV. Heo et al. (2019) developed another affinity peptide-based plasmonic biosensor by immobilizing NoV-binding peptides on a localized surface plasmon sensor. LOD using this biosensor was found to be 0.1 ng/mL for HuNoV capsid proteins.

Microfluidics involves the precise manipulation of small volumes of fluids, typically in the microliter or nanoliter range, within microchannels or microstructures. When combined with biosensing elements, microfluidics biosensors offer several advantages, such as high sensitivity, rapid analysis, low sample consumption, and the potential for POC applications. Chand and Neethiranjan (2017) reported an enhanced microfluidic aptasensor with an LOD of 100 pM for NoV. Chung et al. (2019) used a smartphone-based fluorescence microscope in conjunction with a paper microfluidic system to identify 1 gc/μL of normal water and 10 gc/μL of wastewater. Later, they used the same technology with immune-agglutinated antibodies attached to a paper-based microfluidic chip to detect NoV from water samples (Chung et al., 2021).

A novel fluorescence-based nucleic acid assay was developed by our group for the detection of a fungal pathogen Candida albicans (Sudarsan et al., 2023). The fluorescent signal was enhanced by DNA compaction using CTAB and PEG 8000. The paper-based device could detect up to 0.4 μg/mL of LAMP-amplified genomic DNA. A similar approach may be utilized for the development of devices for detecting viral pathogens.

An electrochemical biosensor is a device that uses biochemical reactions to generate a quantifiable electrical response. It combines the principles of both biology and electrochemistry to detect and measure the presence of specific biological analytes, such as enzymes, proteins, antibodies, and nucleic acids. Baek et al. (2019) created an electrochemical biosensor by implementing eight new peptides on a gold electrode and evaluating their detection efficiency for HuNoV. NoroBP peptide had a strong binding affinity for HuNoV, with an LOD of 1.7 copies/mL, three times lower than previously published approaches. Guo et al. (2020) constructed a photoelectrochemical biosensor that was combined with a custom-made mAb. In 30 min, this biosensor was able to detect VP1 (recombinant NoV capsid protein) at concentrations as low as 4.9 pM.

The use of nanomaterials and electrodes based on gold in various types of biosensors leads to the efficient detection of specific pathogens. NoV, being a capsid virus, has been successfully detected by various gold-based biosensors. Impedimetric biosensor based on Au-PAni milli-electrode successfully detected NoV-like particles with a 60 ag/mL detection limit. This method uses an antibody–antigen interaction for the detection of NoV and NoV-LPs. Au-PAni is a base for antibody conjugation through streptavidin biotinylated antibody combination (Nasrin et al., 2022). Jiang et al. (2022) constructed a 3D electrochemical aptasensor consisting of a counter electrode and a reference electrode printed on a cotton fabric using carbon ink and Ag/AgCl ink. This aptasensor was able to detect NoV with an LOD of 0.28 ng/mL.

SPCE are a type of electrochemical sensor that combines the benefits of 3D structures with the convenience of screen-printing technology. SPCE are commonly used as transducers in biosensing applications. They can be functionalized with biomolecules to selectively detect specific biological targets. 3D SPCE was able to detect GI and GII NoV with an LOD of 0.37 ng/mL. This carbon electrode uses AuNPs and protein-A applied on the SPCE surface and MAbs against the S-domain of VP1 protein were further immobilized. These MAbs can specifically bind HuNoVs resulting in the reduction of conductivity and can detect up to 0.37 and 0.22 ng/mL of GI.1 and GII.4 NoV (Wang et al., 2022). MAbs are also used with photoelectrochemical biosensors for highly sensitive and specific detection of NoV with a detection limit of 4.9 pM (Guo et al., 2020). G-quadruplexes and hemin can bind together to form peroxidase-like DNAzymes, which are widely used in the development of various biosensors.

A dual-modality sensor, also known as a multimodal or multi-sensing sensor, is a sensing device that combines two or more distinct sensing modalities or measurement principles to obtain complementary information about the targets. By integrating multiple sensing capabilities into a single device, dual-modality sensors offer enhanced functionality and improved accuracy compared with traditional single-modality sensors. Ganganboina et al. (2020) developed a dual-modality sensor for the detection of NoV. This sensor was developed using a V₂O₅ nanoparticle-encapsulated liposome-based signal amplification strategy that was able to detect 0.34 pg/mL of NoV-like particles. This sensor relies on the electrochemical redox property and intrinsic peroxidase activity of V₂O₅ nanoparticles.

Some of the techniques do not require nucleic acid extraction and amplification steps resulting in the elimination of longer detection time and low sensitivity. Zhang et al. (2021) developed a G-quadruplex/hemin DNAzyme-based biosensors for the detection of NoV. Peroxidase mimic activity of these biosensors catalyzes the 2,2′-azino-bis (3-ethylbenzothialzoline-6-sulfonic acid) diammonium salt, which is helpful in detecting 10 nM of target DNA. This technique uses a nonamplification and nonlabeling technique, which will be helpful in designing high sensitivity biosensors.

An electrochemical biosensor based on magnetic covalent organic framework (COF)/pillararene hetero-supramolecular nanocomposites (MB@Apt@WP5A@ Au@COF@Fe3O4) signal probes was developed by Zhao et al. (2022). Magnetic COF/pillararene heterosupramolecular nanocomposites are hybrid materials that combine the unique properties of COF and pillararenes with magnetic functionality. COFs are a class of porous, crystalline materials made up of organic building blocks connected by covalent bonds. Pillararenes are a family of macrocyclic molecules with a pillar-like structure, consisting of aromatic rings bridged by methylene groups. These molecules have a well-defined cavity that can host various guest molecules through noncovalent interactions, such as π-π stacking and hydrophobic interactions. The high surface area and porosity of COFs, along with the host–guest interactions of pillararenes, can be utilized for selective and sensitive detection of specific analytes in sensor applications. This hybrid material can detect up to 0.84 copies/mL of HuNoV. The developed probe can bind with the specific capsid protein of HuNoV resulting in a conductivity increase.

Conclusion

NoV spreads easily and quickly, causing vomiting and diarrhea. Several outbreaks occur across the world especially in the United States and Europe. The low-income countries are ignorant about such viral infections. There is an utmost need to make people aware of NoV infections. The genome sequence of the virus is helpful in the classification of virus, tracking of pathogens, and epidemiological studies. At present, many techniques have been developed for detecting different groups of NoV from other hosts, including humans. Commercial kits based on ELISA and RT-PCR have been used to detect NoV rapidly.

Isothermal amplification-based methods have been useful in developing POC diagnostic kits. Isothermal amplification methods can be rapid, cost-effective, and suitable for NoV detection. However, LAMP assay is not available commercially for NoV detection. Molecular detection techniques coupled with different biosensors help develop a miniature device that would be easier to carry and for rapid detection. The CRISPR/Cas diagnosis is in its infancy and needs to be commercialized soon. Paper-based devices, aptasensor, and affinity-based peptides biosensors will help develop a miniaturized disposable device. Furthermore, this review will help researchers with a brief introduction to the virus, its classification and methodology for effective management of virus outbreaks in the future.

Footnotes

Authors' Contributions

P.S.: data curation, writing—original draft preparation, formal analysis, validation. D.P.: conceptualization, writing—reviewing and editing, funding acquisition. The article was written with contributions of all authors. All authors have given approval for the final version of the article.

Disclosure Statement

No competing financial interests exist.

Funding Information

P.S. is grateful to the Department of Bioengineering and Biotechnology, Birla Institute of Technology, Mesra, Ranchi for providing the Institute Research Fellowship (GO/IRF/2019-20/4349). D.P. is thankful to Birla Institute of Technology, Mesra, Ranchi for the seed money grant (GO/Estb/SMS/2019-20/2122) provided for this research.

References

Achadu

, Abe

, Hossain

, et al. Sulfur-doped carbon dots polydopamine-functionalized magnetic silver nanocubes for dual-modality detection of norovirus. Biosens Bioelectron, 2021; 193:113540; doi:10.1016/j.bios.2021.113540

Achadu

, Abe

, Suzuki

, et al. Molybdenum trioxide nanocubes aligned on a graphene oxide substrate for the detection of norovirus by surface-enhanced raman scattering. ACS Appl Mater Interfaces, 2020; 12(39):43522–43534; doi: 10.1021/acsami.0c14729

Adler

, Zickl

. Winter vomiting disease. J Infect Dis, 1969; 119(6):668–673.

Aliyu

, Aliyu

, Salihu

, et al. Rapid detection and quantitation of hepatitis B virus DNA by real-time PCR using a new fluorescent (FRET) detection system. J Clin Virol, 2004; 30(2):191–195; doi: 10.1016/j.jcv.2003.11.005

Anderson

, Gleason

. A molecular beacon real-time polymerase chain reaction assay for the identification of M. chitwoodi, M. fallax, and M. minor . Front Plant Sci, 2023; 14; doi: 10.3389/fpls.2023.1096239

Artika

, Dewi

, Nainggolan

, et al. Real-time polymerase chain reaction: Current techniques, applications, and role in COVID-19 diagnosis. Genes, 2022; 13(12):2387; doi: 10.3390/genes13122387

Arya

, Shergill

, Williamson

, et al. Basic principles of real-time quantitative PCR. Expert Rev Mol Diagn, 2005; 5(2):209–219; doi: 10.1586/14737159.5.2.209

Auer

, Koho

, Uusi-Kerttula

, et al. Rapid and sensitive detection of norovirus antibodies in human serum with a biolayer interferometry biosensor. Sens Actuators B Chem, 2015; 221:507–514; doi: 10.1016/j.snb.2015.06.088

Baek

, Kim

, Park

, et al. Development of a rapid and sensitive electrochemical biosensor for detection of human norovirus via novel specific binding peptides. Biosens Bioelectron, 2019; 123:223–229; doi: 10.1016/j.bios.2018.08.064

10.

Baek

, Park

, Nguyen

, et al. Novel peptides functionalized gold nanoparticles decorated tungsten disulfide nanoflowers as the electrochemical sensing platforms for the norovirus in an oyster. Food Control, 2020; 114:107225; doi: 10.1016/j.foodcont.2020.107225

11.

Batule

, Kim

, Mun

, et al. Colorimetric detection of norovirus in oyster samples through DNAzyme as a signalling probe. J Agric Food Chem, 2018; 66(11):3003–3008; doi: 10.1021/acs.jafc.7b05289

12.

Bull

, Tanaka

, White

. Norovirus recombination. J Gen Virol, 2007; 88(12):3347–3359; doi: 10.1099/vir.0.83321-0

13.

Burton-MacLeod

, Kane

, Beard

, et al. Evaluation and comparison of two commercial enzyme-linked immunosorbent assay kits for detection of antigenically diverse human noroviruses in stool samples. J Clin Microbiol, 2004; 42(6):2587–2595; doi: 10.1128/jcm.42.6.2587-2595.2004

14.

Chadwick

, Trainor

, Marsden

, et al. Guidelines for the management of norovirus outbreaks in acute and community health and social care settings. J Hosp Infect, 2023; doi: 10.1016/j.jhin.2023.01.017

15.

Chand

, Neethirajan

Microfluidic platform integrated with graphene-gold nano-composite aptasensor for one-step detection of norovirus Biosens Bioelectron. 2017; 98:47–53; doi: 10.1016/j.bios.2017.06.026

16.

Chhabra

, de Graaf

, Parra

, et al. Updated classification of norovirus genogroups and genotypes. J Gen Virol, 2019; 100(10);1393; doi: 10.1099/jgv.0.001318

17.

Chu

, Huang

, Boonchan

, et al. Mass spectrometry-based system for identifying and typing norovirus major capsid protein VP1. Viruses, 2021; 13(11):2332; doi: 10.3390/v13112332

18.

Chung

, Breshears

, Gonzales

, et al. Norovirus detection in water samples at the level of single virus copies per microliter using a smartphone-based fluorescence microscope. Nat Protoc, 2021; 16(3):1452–1475; doi: 10.1038/s41596-020-00460-7

19.

Chung

, Breshears

, Perea

, et al. Smartphone-based paper microfluidic particulometry of norovirus from environmental water samples at the single copy level. ACS Omega, 2019; 4(6):11180–11188; doi: 10.1021/acsomega.9b00772

20.

Coudray-Meunier

, Fraisse

, Martin-Latil

, et al. A comparative study of digital RT-PCR and RT-qPCR for quantification of Hepatitis A virus and Norovirus in lettuce and water samples. Int J Food Microbiol, 2015; 201:17–26; doi: 10.1016/j.ijfoodmicro.2015.02.006

21.

Cui

, Yoo

, Li

, et al. Facile and foldable point-of-care biochip for nucleic acid based-colorimetric detection of murine norovirus in fecal samples using G-quadruplex and graphene oxide coated microbeads. Biosens Bioelectron, 2022; 199:113878; doi: 10.1016/j.bios.2021.113878

22.

Da Silva

, Saux

JCL

, Parnaudeau

, et al. Evaluation of removal of noroviruses during wastewater treatment, using real time reverse transcription PCR: Different Behaviors of Genogroups I and II. Appl Environ Microbiol, 2007; 73(24):7891–7897; doi: 10.1128/AEM.01428-07

23.

de Bruin

, Duizer

, Vennema

, et al. Diagnosis of Norovirus outbreaks by commercial ELISA or RT-PCR. J Virol Methods, 2006; 137(2):259–264; doi: 10.1016/j.jviromet.2006.06.024

24.

Drake

, Charlesworth

, et al. Rates of spontaneous mutation. Genetics, 1998; 148(4):1667–1686; doi: 10.1093/genetics/148.4.1667

25.

Duffy

Why are RNA virus mutation rates so damn high?. PLoS Biol, 2018; 16(8):e3000003; doi: 10.1371/journal.pbio.3000003

26.

East-Seletsky

, O'Connell

, Knight

, et al. Two distinct Rnase activities of CRISPR-C2c2 enable guide-RNA processing and RNA detection. Nature, 2016; 538(7624):270–273; doi: 10.1038/nature19802

27.

Fumian

, Fioretti

, Lun

, et al. Detection of norovirus epidemic genotypes in raw sewage using next generation sequencing. Environ Int, 2019; 123:282–291; doi: 10.1016/j.envint.2018.11.0541

28.

Ganganboina

, Chowdhury

, Khoris

, et al. Dual modality sensor using liposome-based signal amplification technique for ultrasensitive norovirus detection. Biosens Bioelectron, 2020; 157:112169; doi: 10.1016/j.bios.2020.112169

29.

Giamberardino

, Labib

, Hassan

, et al. Ultrasensitive norovirus detection using DNA aptasensor technology. PLoS One, 2013; 8(11):e79087; doi: 10.1371/journal.pone.0079087

30.

Gootenberg

, Abudayyeh

, Lee

, et al. Nucleic acid detection with CRISPR-Cas13a/C2c2. Science, 2017; 356(6336):438–442; doi: 10.1126/science.aam9321

31.

Greene

, Moe

, Jaykus

, et al. Evaluation of the NucliSens^® basic kit assay for detection of Norwalk virus RNA in stool specimens. J Virol Met, 2003; 108(1):123–131; doi: 10.1016/S0166-0934(02)00286-0

32.

Gregory

, Webster

, Griffith

, et al. Improved detection and quantitation of norovirus from water. J Virol Methods, 2011; 172(1–2):38–45.; doi: 10.1016/j.jviromet.2010.12.011

33.

Guo

, Liu

, Yang

et al. A photoelectrochemical biosensor for rapid and ultrasensitive norovirus detection. Bioelectrochemistry, 2020; 136:107591; doi: 10.1016/j.bioelechem.2020.107591

34.

Hallowell

, Parashar

, Curns

, et al. Trends in the laboratory detection of rotavirus before and after implementation of routine rotavirus vaccination—United States, 2000–2018. MMWR Morb Mortal Wkly Rep, 2019; 68(24):539; doi: 10.1558/5/mmwr.mm6824a2

35.

Hashemi

, Salayani

, Afshari

, et al. The global burden of viral food-borne diseases: A systematic review. Curr Pharm Biotechnol, 2023; doi: 10.2174/1389201024666230221110313

36.

Hemming

, Räsänen

, Huhti

, et al. Major reduction of rotavirus, but not norovirus, gastroenteritis in children seen in hospital after the introduction of RotaTeq vaccine into the National Immunization Programme in Finland. Eur J Pediatr, 2013; 172(6):739–746; doi: 10.1007/s00431-013-1945-3

37.

Heo

, Oh

, Ryu

, et al. Affinity peptide-guided plasmonic biosensor for detection of noroviral protein and human norovirus. Biotechnol Bioprocess Eng, 2019; 24(2):318–325; doi: 10.1007/s12257-018-0410-6

38.

Hepp

, Shiaelis

, Robb

, et al. Viral detection and identification in 20 min by rapid single-particle fluorescence in-situ hybridization of viral RNA. Sci Rep, 2021; 11(1):19579; doi: 10.1038/s41598-021-98972-z

39.

Höhne

, Schreier

. Detection and characterization of norovirus outbreaks in Germany: Application of a one-tube RT-PCR using a fluorogenic real-time detection system. J Med Virol, 2004; 72(2):312–319; doi: 10.1002/jmv.10573

40.

Hong

, Kwon

, Kim

, et al. A rapid, sensitive and selective electrochemical biosensor with concanavalin A for the pre-emptive detection of norovirus. Biosens Bioelectron, 2015; 64:338–344; doi: 10.1016/j.bios.2014.09.025

41.

Hwang

, Ryu

, Park

, et al. High sensitive and selective electrochemical biosensor: Label-free detection of human norovirus using affinity peptide as molecular binder. Biosens Bioelectron, 2017; 87:164–170; doi: 10.1016/j.bios.2014.09.025

42.

Jahne

, Brinkman

, Keely

, et al. Droplet digital PCR quantification of norovirus and adenovirus in decentralized wastewater and greywater collections: Implications for onsite reuse. Water Res, 2020; 169:115213; doi: 10.1016/j.watres.2019.115213

43.

Jeon

, Seo

, Oh

, et al. Development of one-step reverse transcription loop-mediated isothermal amplification for norovirus detection in oysters. Food Control, 2017; 73:1002–1009; doi: 10.1016/j.foodcont.2016.10.005

44.

Jiang

, Sun

, Zhang

, et al. 3D-architectured aptasensor for ultrasensitive electrochemical detection of norovirus based on phosphorene-gold nanocomposites. Sens Actuators B Chem, 2022; 354:131232; doi: 10.1016/j.snb.2021.131232

45.

Jothikumar

, Lowther

, Henshilwood

, et al. Rapid and sensitive detection of noroviruses using TaqMan based one step reverse transcription PCR assays and application to naturally contaminated shellfish samples. Appl Environ Microbiol, 2005; 71(4):1870–1875; doi: 10.1128/AEM.71.4.1870-1875.2005

46.

Kageyama

, Kojima

, Shinohara

, et al. Broadly reactive and highly sensitive assay for Norwalk-like viruses based on real-time quantitative reverse transcription-PCR. J Clin Microbiol, 2003; 41(4):1548–1557; doi: 10.1128/jcm.41.4.1548-1557.2003

47.

Kaminski

, Abudayyeh

, Gootenberg

, et al. CRISPR-based diagnostics. Nat Biomed Eng, 2021; 5(7):643–656; doi: 10.1038/s41551-021-00760-7

48.

Karst

SM.

Pathogenesis of noroviruses, emerging RNA viruses. Viruses, 2010; 2:748–781; doi: 10.3390/v2030748

49.

Katayama

, Shirato-Horikoshi

, Kojima

, et al. Phylogenetic analysis of the complete genome of 18 Norwalk-like viruses. Virology, 2002; 299(2):225–239.

50.

Kellner

, Koob

, Gootenberg

, et al. SHERLOCK: Nucleic acid detection with CRISPR nucleases. Nat Protoc, 2019; 14(10):2986–3012; doi: 10.1038/s41596-019-0210-2

51.

Khamrin

, Nguyen

, Phan

, et al. Evaluation of immunochromatography and commercial enzyme-linked immunosorbent assay for rapid detection of norovirus antigen in stool samples. J Virol Methods, 2008; 147(2):360–363; doi: 10.1016/j.jviromet.2007.09.007

52.

Khoris

, Takemura

, Lee

, et al. Enhanced colorimetric detection of norovirus using in-situ growth of Ag shell on Au NPs. Biosens Bioelectron, 2019; 126:425–432; doi: 10.1016/j.bios.2018.10.067

53.

Kim

, Chung

, Lee

. Non-stop aptasensor capable of rapidly monitoring norovirus in a sample. J Pharm Biomed Anal, 2018; 152:315–321; doi: 10.1016/j.jpba.2018.02.022

54.

Kirby

, Gurgel

, Dove

, et al. An evaluation of the RIDASCREEN and IDEIA enzyme immunoassays and the RIDAQUICK ICG test for the detection of norovirus in faecal specimens. J Clin Virol, 2010; 49(4):254–257; doi: 10.1016/j.jcv.2010.08.004

55.

Kroneman

, Vega

, Vennema

, et al. Proposal for a unified norovirus nomenclature and genotyping. Arch Virol, 2013; 158:2059–2068; doi: 10.1007/s00705-013-1708-5

56.

Lamhoujeb

, Charest

, Fliss

, et al. Real-time molecular beacon NASBA for rapid and sensitive detection of norovirus GII in clinical samples. Can J Microbiol, 2009; 55(12):1375–1380; doi: 10.1139/W09-105

57.

Lee

, Takemura

, Kato

, et al. Binary nanoparticle graphene hybrid structure-based highly sensitive biosensing platform for norovirus-like particle detection. ACS Appl Mater Interfaces, 2017; 9(32):27298–27304; doi: 10.1021/acsami.7b07012

58.

Lee

, Liu

, Wilen

, et al. A secreted viral nonstructural protein determines intestinal norovirus pathogenesis. Cell Host Microb, 2019; 25(6):845–857; doi: 10.1016/j.chom.2019.04.005

59.

, Guo

, Sun

, et al. Rapid two-stage amplification in a single tube for simultaneous detection of norovirus GII and group A rotavirus. J Clin Lab Anal, 2023:e24858; doi: 10.1002/jcla.24858

60.

Lipman

, Jackson

, Trudel

, et al. Monoclonal versus polyclonal antibodies: Distinguishing characteristics, applications, and information resources. ILAR J, 2005; 46 (3):258–268; doi: 10.1093/ilar.46.3.258

61.

Loisy

, Atmar

, Guillon

, et al. Real-time RT-PCR for norovirus screening in shellfish. J Virol Methods, 2005; 123(1):1–7; doi: 10.1016/j.jviromet.2004.08.023

62.

Lopman

, Reacher

, Van Duijnhoven

, et al. Gastroenteritis outbreaks in Europe, 1995–2000. Emerg Infect Dis, 2003; 9(1):90; doi: 10.3201/eid0901.020184

63.

Luo

, Zhang

, Wu

, et al. Redesigned duplex RT-qPCR for the detection of GI and GII human noroviruses. Engineering, 2020; 6:442–448; doi: 10.1016/j.eng.2019.08.018

64.

Luo

, Xu

, Nie

, et al. Visual detection of norovirus genogroup II by reverse transcription loop-mediated isothermal amplification with hydroxynaphthol blue dye. Food Environ Virol, 2014; 6(3):196–201; doi: 10.1007/s12560-014-9142-8

65.

, Shen

, Wu

, et al. Low-cost detection of norovirus using paper-based cell-free systems and synbody-based viral enrichment. Synth Biol, 2018; 3(1):ysy018; doi: 10.1093/synbio/ysy018

66.

Mans

Norovirus infections and disease in lower-middle-and low-income countries, 1997–2018. Viruses, 2019; 11(4):341; doi: 10.3390/v11040341

67.

, Wang

, Dai

, et al. Rapid and simultaneous detection of three major diarrhea-causing viruses by multiplex real-time nucleic acid sequence-based amplification. Arch Virol, 2015; 160:719–725; doi: 10.1007/s00705-014-2328-4

68.

Moore

, Clark

, Gallimore

, et al. Evaluation of a broadly reactive nucleic acid sequence-based amplification assay for the detection of noroviruses in fecal material. J Clin Virol, 2004; 29:290–296; doi: 10.1016/S1386-6532(03)00170-7

69.

Nasrin

, Khoris

, Chowdhury

, et al. Impedimetric biosensor of Norovirus with low variance using simple bioconjugation on conductive polymer-Au nanocomposite. Sens Actuators B Chem, 2022; 369:132390; doi: 10.1016/j.snb.2022.132390

70.

Okame

, Shiota

, Hansman

, et al. Anti-norovirus polyclonal antibody and its potential for development of an antigen-ELISA. J Med Virol, 2007; 79(8):1180–1186; doi: 10.1002/jmv.20906

71.

Okitsu-Negishi

, Okame

, Shimizu

, et al. Detection of norovirus antigens from recombinant virus-like particles and stool samples by a commercial norovirus enzyme-linked immunosorbent assay kit. J Clinical Microbiol, 2006; 44(10):3784–3786; doi: 10.1128/JCM.01373-06

72.

Park

, Lee

, Cho

, et al. Improved real-time quantitative reverse transcription PCR detection of norovirus following removal of inhibitors, Heliyon, 2021; 7(7):07560; doi: 10.1016/j.heliyon.2021.e07560

73.

Philip

, Patton

. Generation of recombinant rotaviruses expressing human norovirus capsid proteins. J Virol, 2022; 96(22):e01262-22; doi: 10.1128/jvi.01262-22

74.

Plante

, Bran Barrera

, Lord

, et al. Development of an RNA extraction protocol for norovirus from raw oysters and detection by qRT-PCR and droplet-digital RT-PCR. Foods, 2021; 10:1804; doi: 10.3390/foods10081804

75.

Prajapati

, Kumar

, Wany

, et al. Molecular beacon probe (MBP)-based real-time PCR. In: Plant Genotyping: Methods and Protocols Humana. (Shavrukov Y. ed.) Springer US: New York, NY, USA; 2023; 2638; pp. 273–287.

76.

Prasad

, Hardy

, Dokland

, et al. X-ray crystallographic structure of the Norwalk virus capsid. Science, 1999; 286(5438):287–290; doi: 10.1126/science.286.5438.28

77.

Prasad

, Mani

, Pandey

. CRISPR/Cas technology: Opportunities for phytopathogenic viruses detection. J Biotechnol, 2022; 360:211–217; doi: 10.1016/j.jbiotec.2022.11.010

78.

Qian

, Huang

, Wang

, et al. CRISPR-Cas12a combined with reverse transcription recombinase polymerase amplification for sensitive and specific detection of human norovirus genotype GII. 4. Virology, 2021; 564:26–32; doi: 10.1016/j.virol.2021.09.008

79.

Qin

, Xue

, Cai

, et al. Development of a recombinase-aided amplification assay for rapid detection of human norovirus GII. 4. BMC Infect Dis, 2021; 21(1):1–8; doi: 10.1186/s12879-021-05942-x

80.

Rico

, Pérez

, Belver

, et al. Norovirus detection in environmental samples in norovirus outbreaks in closed and semi-closed settings. J Hosp Infect, 2020; 105(1):3–9; doi: 10.1016/j.jhin.2020.02.011

81.

Rolfe

, Parmar

, Mururi

, et al. An internally controlled, one-step, real-time RT-PCR assay for norovirus detection and genogrouping. J Clinical Virol, 2007; 39(4):318–321; doi: 10.1016/j.jcv.2007.05.005

82.

Rowan

NJ.

Current decontamination challenges and potentially complementary solutions to safeguard the vulnerable seafood industry from recalcitrant human norovirus in live shellfish: Quo Vadis?. Sci Total Environ, 2023:162380; doi: 10.1016/j.scitotenv.2023.162380

83.

Rupprom

, Chavalitshewinkoon-Petmitr

, Diraphat

, et al. Evaluation of real-time RT-PCR assays for detection and quantification of norovirus genogroups I and II. Virol Sinica, 2017; 32(2):139–146; doi: 10.1007/s12250-016-3863-9

84.

Saisuk

, Srisawat

, Yoksan

, et al. A molecular beacon biosensor for viral RNA detection based on HyCaSD strategy. Anal Chim Acta, 2022; 1221:340134.

85.

Santos-Ferreira

, Van Dycke

, Neyts

, et al. Current and future antiviral strategies to tackle gastrointestinal viral infections. Microorganisms, 2021; 9(8):1599; doi: 10.3390/microorganisms9081599

86.

Schermer

, Fabretti

, Damagnez

, et al. Rapid SARS-CoV-2 testing in primary material based on a novel multiplex RT-LAMP assay. PLoS One, 2020; 15(11):e0238612; doi: 10.1371/journal.pone.0238612

87.

Shinoda

, Taguchi

, Nakagawa

, et al. Amplification-free RNA detection with CRISPR–Cas13. Commun Biol, 2021; 4(1):1–7; doi: 10.1038/s42003-021-02001-8

88.

Singh

, Batish

, Grover

. A scorpion probe–based real-time PCR assay for detection of E. coli O157: H7 in dairy products. Foodborne Pathog Dis, 2009; 6(3):395–400; doi: 10.1089/fpd.2008.0178

89.

Srivastava

, Prasad

. Isothermal nucleic acid amplification and its uses in modern diagnostic technologies. 3 Biotech, 2023; 13(6):200; doi: 10.1007/s13205-023-03628-6

90.

Sudarsan

, Prabhu

, Prasad

, et al. DNA compaction enhances sensitivity of fluorescence-based nucleic acid assays: Game changer in point of care sensors?. Analyst, 2023; 148(10):2295–2307; doi: 10.1039/D3AN00102D

91.

Takanashi

, Okame

, Shiota

, et al. Development of a rapid immunochromatographic test for noroviruses genogroups I and II. J Virol Methods, 2008; 148(1–2):1–8; doi: 10.1016/j.jviromet.2007.10.010

92.

Tan

, Wang

, Drake

. Molecular beacons. Curr Opin Chem Biol, 2004; 8(5):547–553; doi: 10.1016/j.cbpa.2004.08.010

93.

Tunyakittaveeward

, Rupprom

, Pombubpa

. Norovirus monitoring in oysters using two different extraction methods. Food Environ Virol, 2019; 11:374–382; doi: 10.1007/s12560-019-09396-y

94.

Wang

, Deng

. Detection and forecasting of oyster norovirus outbreaks: Recent advances and future perspectives. Mar Environ Res, 2012; 80:62–69; doi: 10.1016/j.marenvres.2012.06.011

95.

Wang

, Pan

, Guan

, et al. A broad-range disposable electrochemical biosensor based on screen-printed carbon electrodes for detection of human noroviruses. Front Bioeng Biotechnol, 2022; 10:845660; doi: 10.3389/fbioe.2022.845660

96.

Wang

, Pan

, Liu

, et al. Advances and future perspective on detection technology of human norovirus. Pathogens, 2021; 10(11):1383; doi: 10.3390/pathogens10111383

97.

Weng

, Neethirajan

. Aptamer-based fluorometric determination of norovirus using a paper-based microfluidic device. Microchim Acta, 2017; 184(11):4545–4552; doi: 10.1007/s00604-017-2467-x

98.

, Zhou

, Liu

, et al. Utilizing metagenomic next-generation sequencing (mNGS) for rapid pathogen identification and to inform clinical decision-making: Results from a large real-world cohort. Infect Dis Ther, 2023:1–3; doi: 10.1007/s40121-023-00790-5

99.

, Song

, Ming

. Application of multiplex TaqMan real-time PCR assay in survey of five lily viruses infecting lilium spp. Agronomy, 2022; 12(1):47; doi: 10.3390/agronomy12010047

100.

, Lu

, Lyu

, et al. Broad-range and effective detection of human noroviruses by colloidal gold immunochromatographic assay based on the shell domain of the major capsid protein. BMC Microbiol, 2021; 21(1):1–10; doi: 10.1186/s12866-020-02084-z

101.

Yakes

, Papafragkou

, Conrad

, et al. Surface plasmon resonance biosensor for detection of feline calicivirus, a surrogate for norovirus. Int J Food Microbiol, 2013; 162(2):152–158; doi: 10.1016/j.ijfoodmicro.2013.01.011

102.

Yao

, Luo

, Xiong

, et al. Disinfection techniques of human norovirus in municipal wastewater: Challenges and future perspectives. Curr Opin Environ Sci Health, 2020; 17:29–34; doi: 10.1016/j.coesh.2020.08.003

103.

Zhang

, Jiang

, Zhou

, et al. A Taq Man probe-based multiplex real-time PCR for simultaneous detection of porcine epidemic diarrhea virus subtypes G1 and G2, and porcine rotavirus groups A and C. Viruses, 2022; 14(8):1819; doi: 10.3390/v14081819

104.

Zhang

, Ma

, Zhang

, et al. Design of a high-sensitivity dimeric G-quadruplex/hemin DNAzyme biosensor for norovirus detection. Molecules, 2021; 26(23):7352; doi: 10.3390/molecules26237352

105.

Zhao

, Xie

, Zhang

, et al. Electrochemical sensor for human norovirus based on covalent organic framework/pillararene heterosupramolecular nanocomposites. Talanta, 2022; 237:122896; doi: 10.1016/j.talanta.2021.122896

106.

Zhao

, Zhang

, Xu

, et al. A rapidly new-typed detection of norovirus based on F 0 F 1-ATPase molecular motor biosensor. Biotechnol Bioprocess Eng, 2016; 21(1):128–133; doi: 10.1007/s12257-015-0384-6

107.

Zhou

, Huang

, Zhou

, et al. Molecular evolution of RNA-dependent RNA polymerase region in norovirus genogroup I. Viruses, 2023; 15(1):166; doi: 10.3390/v15010166

108.

Zhuo

, Parsons

, Lee

, et al. Identification of enteric viruses in oral swabs from children with acute gastroenteritis. J Mol Diagn, 2018; 20(1):56–62; doi: 10.1016/j.jmoldx.2017.09.003