A One-Step RPA-CRISPR Assay Using crRNA Based on Suboptimal Protospacer Adjacent Motif for Vibrio vulnificus Detection

Abstract

Vibrio vulnificus is a hazardous foodborne pathogen responsible for approximately 95% of seafood-related deaths. This highlights the urgent requirement for specialized detection tools to be developed and used by food enterprises and food safety authorities. The DETECTR (DNA endonuclease targeted CRISPR trans reporter) system that combines CRISPR/Cas and recombinase polymerase amplification (RPA) has been utilized to develop a molecular detection assay for V. vulnificus. However, because the incompatibility between RPA and Cas12a cleavage has not been addressed, it is a two-step assay that lacks convenience and presents contamination risk. Here, we developed a one-step RPA-CRISPR assay for V. vulnificus using a special crRNA targeting a sequence with a suboptimal protospacer adjacent motif (PAM). The entire assay, conducted at 37°C, takes only 40–60 min, yields results visualized under blue light, and exhibits exceptional specificity and sensitivity (detecting 4 pathogen genome copies per reaction). This study offers a valuable tool for detecting V. vulnificus, aiding in foodborne infection prevention, and exemplifies one-step RPA-CRISPR assays managing Cas-cleavage activity through PAM adjustments.

Introduction

Vibrio vulnificus, responsible for approximately 95% of seafood-related deaths, is an important foodborne pathogen. Seafood contaminated by V. vulnificus can cause wound infections and life-threatening septicemia and acute gastroenteritis (Baker-Austin and Oliver, 2018; Elmahdi et al., 2016; Oliver, 2013). With the globalization of food supply chains nowadays, seafood consumption is growing high, expanding the risk of infection by this dangerous pathogen. This highlights the urgent requirement for specialized detection tools on V. vulnificus to be developed and used by food enterprises and food safety authorities for precise and efficient prevention.

For this purpose, molecular technologies have been introduced for the detection of V. vulnificus. These include polymerase chain reaction (PCR)-based methods that require sophisticated thermal cycling instruments (Bonny et al., 2022; Kim et al., 2008) and isothermal amplification-based methods with easier operations for on-site detection (Han and Ge, 2010; Yang et al., 2020). The use of isothermal technologies, loop-mediated isothermal amplification (LAMP) and recombinase polymerase amplification (RPA), has significantly improved the operational convenience, while the reliability has to be enhanced due to nonspecific amplifications (Han and Ge, 2010; Yang et al., 2021).

Nucleases with sequence-recognition capacity have been combined with isothermal amplifications to enhance the reliability of detection assays (Chen et al., 2018; Feng et al., 2021; Wang et al., 2020). Particularly, Cas12a from the CRISPR/Cas system has had a significant impact on the field of molecular detection (Mao et al., 2022; Yin et al., 2021). Cas12a plays a key role in target recognition by specific binding to the target DNA with the assistance of CRISPR-RNA (crRNA) and inducing cleavage at the target site (Swarts et al., 2017; Zetsche et al., 2015). In addition, Cas12a exhibits nonspecific trans-cleavage activity, enabling it to cleave any single-stranded DNA (ssDNA) present in the reaction mixture (Chen et al., 2018). In the context of detection, the trans-cleavage activity is harnessed to generate a signal when a specially modified ssDNA reporter is introduced to the reaction (Chen et al., 2018; Liang et al., 2019; Wang et al., 2023a). The combination of Cas12a and RPA, known as DETECTR (DNA endonuclease targeted CRISPR trans reporter) (Chen et al., 2018), has been extensively used for molecular detection of various targets, including cancer biomarkers, bacterial pathogens, and viruses (Ding et al., 2020; Huang et al., 2020; Jirawannaporn et al., 2022; Zhong et al., 2022).

There is an inherent limitation in the DETECTR system, the incompatibility between the nucleic acid amplification through RPA and the nuclease cleavage by Cas12a (Chen et al., 2022; Hu et al., 2022; Lin et al., 2022). When RPA and Cas12a are combined in a single reaction, the nuclease activity of Cas12a, stimulated by the target and the amplicons, can potentially degrade the newly synthesized amplicons and primers, thereby restricting the amplification process. This compromises the overall sensitivity of the detection. To retain sensitivity, researchers have often adopted a “two-step” DETECTR strategy in which RPA and Cas12a are separated (Huang et al., 2022; Li et al., 2022; Xiong et al., 2020). However, this approach may sacrifice operational convenience, and there is a risk of cross-contamination during liquid transfer. Numerous efforts have been made to develop “one-step” DETECTR assays. These include integration of the amplification–cleavage “two-step” procedure into one pot (Wang et al., 2019; Zhang et al., 2023), optimization of the reaction components to achieve a balance between amplification and cleavage (Feng et al., 2021; Shao et al., 2023; Wang et al., 2023c; Wang et al., 2023d), use of chemically modified crRNA for controlled activation (Hu et al., 2022), application of multiphase aqueous system for “semiseparation” of the reactions (Lin et al., 2022; Yin et al., 2020), adoption of microfluidic devices (Chen et al., 2020), and adjustment of the cleavage potency by protospacer adjacent motif (PAM) manipulations (Ding et al., 2020; Lin et al., 2023; Lu et al., 2022; Wang et al., 2023b). PAM manipulation has an advantage over the other “one-step” approaches, in that it can tolerate some disruption of the reaction, and thus has stronger adaptability to the on-site detection environment. The other approaches, on the contrary, have to maintain the delicate positioning, concentrations, activator, or aqueous phases during the detection. In addition, microfluidic devices have the cost disadvantage.

For V. vulnificus, a “two-step” DETECTR assay has been developed (Xiao et al., 2021), which needs further improvement to transit to a one-step assay for better convenience and less cross-contamination risk. Here, a one-step RPA-CRISPR assay has been developed utilizing a special crRNA targeting sequence with a suboptimal PAM. The RPA and Cas12a reagents are combined allowing for a one-step assay that is conducted at 37°C for 60 min. The detection results can be observed in real time using a fluorescence detector or at the endpoint using blue light (Fig. 1A). In the one-step reaction, Cas12a exhibits two different cleavage activities upon activation. The cis-cleavage digests the DNA target and the newly synthesized amplicons, while the trans-cleavage cuts the primers and the fluorescence reporter, which is an ssDNA modified with FAM at one end and a quencher at the other (Fig. 1B). However, a highly activated Cas12a may negatively impact the one-step detection assay by causing excessive cleavage, resulting in digestion of target fragments/amplicons and a low fluorescence signal. This issue was encountered when a canonical PAM was selected to design the crRNA. In contrast, when a crRNA designed based on a suboptimal PAM (referred to as scrRNA in this study) was utilized, the Cas12a activation was moderate, leading to less cleavage, more amplicons, and a high fluorescence signal (Fig. 1C). After extensive screening and optimization, a one-step RPA-CRISPR assay using scrRNA was successfully established. This assay demonstrates good specificity and exceptional sensitivity, with the ability to detect 4 copies of the genome per reaction. The entire assay can be completed within 40–60 min at 37°C, with the results visualized under blue light. The one-step reaction achieves a well-balanced amplification by RPA and digestion by Cas12a, serving as a valuable example for the development of one-step RPA-CRISPR assays. In addition, this study provides a useful tool for molecular detection of V. vulnificus, contributing to the prevention of serious foodborne infections.

FIG. 1.

Illustration of the one-step RPA–CRISPR assay. (A) The one-step procedure involves reading the signal either in real time using a fluorescence detector or at the endpoint using blue light. (B) Cas12a exhibits cis- and trans-cleavage activities when activated by the target and the crRNA. (C) The one-step assay yields different outcomes when utilizing two types of crRNA targeting sequences with canonical PAM or suboptimal PAM, respectively. RPA, recombinase polymerase amplification; PAM, protospacer adjacent motif.

Materials and Methods

Bacteria

Bacterial strains used in this study include V. vulnificus, V. cholerae, V. parahaemolyticus, V. mimicus, V. alginolyticus, V. shilonii, V. ichthyoenteri, V. splendidus, Yersinia enterocolitica, and Staphylococcus aureus (identification numbers: ATCC 27562, ATCC 14100, ATCC 17802, MCCC 1A02602, ATCC 17749, ATCC BAA-91, MCCC 1A00057, MCCC 1A04096, CMCC 52204, and ATCC 6538, respectively). These strains were subjected to 16S rRNA sequencing. DNA extraction was performed with a Tiangen DNA Kit, Beijing, China. Quantification of DNA was done with a NanoDrop, Thermo Fisher, Wilmington, USA. The target copy number (cps) was calculated using the genome size (Yang et al., 2020).

Preparation of Cas12a

The Cas12a protein, encoded by the LbCpf1 gene (GenBank no. OK557998.1), was synthesized within the context of pET-28b(+) to create an expression plasmid with an N-terminal His-Tag (Fig. S1A). The accuracy of the plasmid was verified by DNA sequencing, General Biology, Anhui, China. Cas12a was induced using 0.5 mM (final) of IPTG in E. coli BL21-pLysS at 23°C for 8 h. The overexpressed Cas12a was purified by the Sangon Biotech Ni-affinity resin, Shanghai, China, on a AKTA Prime Plus, GE Healthcare Life Sciences, and stored at −20°C in 500 mM NaCl, 1 mM TCEP, 25 mM Tris-HCl, pH 7.5, and 50% glycerol. The expression and purification of Cas12a were analyzed using SDS-PAGE (Fig. S1B). To confirm the purified Cas12a was free of nonspecific nuclease activity, 50 nM (final) of the purified Cas12a was incubated with 150 ng of pUC18 plasmid in 20 μL of 1× NEB buffer 2.1 at 37°C for 1 h and analyzed by agarose gel electrophoresis (Fig. S1C).

crRNA preparation

The empV gene (GenBank no. U50548.1, gene product extracellular metalloproteinase), which had been established as a valid target for molecular detection of V. vulnificus (Yang et al., 2020), was used in this study as the detection target. A previously established DNA fragment on this gene was used as the basis for designing crRNAs, as shown in Table 1 and Figure S2 (Wang et al., 2021; Yang et al., 2021). A BLAST search of this particular fragment returned only the V. vulnificus sequences, further confirming the species specificity of this fragment. The crRNAs were prepared by an in vitro transcription. DNA substrates containing T7 promoter and crRNA sequences were generated by annealing two reverse-complement single-stranded oligonucleotides (10 μM each, sequences provided in Table S1) at room temperature following a denaturation step at 95°C for 5 min. After quantification using NanoDrop (Thermo Fisher), 1 μg of the DNA template was transcribed at 37°C for 16 h using T7 transcription (Vazyme Biotech, Nanjing, China). Transcription products were treated by DNase I, purified, quantified using Qubit 4 (Thermo Fisher), and stored at −80°C.

FIG. 2.

Canonical PAM could facilitate two-step RPA–CRISPR. (A) Sensitivity of the two-step assay. Fluorescence curves corresponding to different target amounts are displayed in different colors. The visualized endpoint signals are shown above the curves. (B) RPA efficiency of the two-step assay. The RPA amplicons with different target amounts were analyzed by agarose gel electrophoresis. (C) Sensitivity of the directly mixed one-pot reaction. Both the fluorescence curves and the endpoint image are shown. The final concentrations of Cas12a, crRNA, and ssDNA-FQ in the reactions were 50 nM, 50 nM, and 500 nM, respectively. ‘NTC’ represents the no-template control. ‘cps’ denotes copies of the target. The fluorescence intensities of the curves are presented in RFUs. RPA, recombinase polymerase amplification; PAM, protospacer adjacent motif; ssDNA, single-stranded DNA; RFUs, relevant fluorescence units.

Table 1.

Oligonucleotide Sequences

Reaction	Name	Sequence (5′–3′)	Length (nt)	Amplicon Size (bp)
RPA	empV-F	GAGATGGATTCTTTGTATAACATTGCGT	28	214
	empV-R	ACGATGACGTTGGTTGTGTTTCATTATC	28
CRISPR-Cas12a	crRNA3	UAAUUUCUACUAAGUGUAGAU UGAACCAUGGUUGUUGAGCUC	42	/
	scrRNA1	UAAUUUCUACUAAGUGUAGAU UACAGGGCGUAAAAACAUUUU	42
	scrRNA2	UAAUUUCUACUAAGUGUAGAU GCUGGUGGUUAUUUUCUGAAC	42
	scrRNA3	UAAUUUCUACUAAGUGUAGAU UUGAGCUCGCAGUGUCUCGCU	42
	scrRNA4	UAAUUUCUACUAAGUGUAGAU AAAAUUACAACAUCAACAGGA	42
	ssDNA-FQ	FAM-TTATT-BHQ1	5
qPCR	gyrB-F	GTCCGCAGTGGAATCCTTCA	20	286
	gyrB-R	TGGTTCTTACGGTTACGGCC	20

Underlined sequences are complementary to the target fragment. RPA, recombinase polymerase amplification; qPCR, quantitative PCR.

RPA reaction

A lyophilized enzyme pellet of the RAA Basic Reagent, Hangzhou ZC Bio-Sci & Tech, Zhejiang, China, was reconstituted by 25 μL of buffer A, 19.25 μL of ultrapure water, and 1.5 μL each of the primers (20 μM). This RPA mixture (15.75 μL) was combined with 1.25 μL of buffer B and 3 μL of template DNA, and incubated at 37°C for 30 min. The RPA products were analyzed using agarose gel electrophoresis.

CRISPR reaction

The CRISPR reaction of 20 μL comprised 50 nM of crRNA, 50 nM of Cas12a, 500 nM of ssDNA-FQ, and 2 μL of the RPA amplicon in 1× NEB buffer 2.1. The reaction was conducted for 60 min under 37°C on a Roche Light Cycler 480 II qPCR system with FAM detection (465–510 nm). The endpoint signal was observed with a blue light of the Novogene transilluminator, Tianjin, China. The endpoint images were taken by a smartphone camera. Quantification of the fluorescence signal from the images was done with the ImageJ intensity analysis software (National Institutes of Health, MD, USA).

One-step RPA-CRISPR

For the RPA premix, the lyophilized enzyme pellet of the RAA basic reagent was reconstituted with 25 μL of buffer A and 1.5 μL of each primer (20 μM). For the CRISPR premix, 250 nM of crRNA, 125 nM of Cas12a, and 1.25 μM of the ssDNA-FQ were mixed in 2.5× NEB buffer 2.1. A total of8 μL of CRISPR premix, 7.75 μL of RPA premix, 3 μL of template DNA, and 1.25 μL of buffer B constituted the one-pot reaction. The one-step assay was performed for 60 min at 37°C using a Roche Light Cycler 480 II qPCR system with FAM detection (465–510 nm). The endpoint signal was visualized under blue light (Novogene transilluminator). The camera images were analyzed with the ImageJ software.

Preparation of the spiked samples

Fresh oysters were bought from a local seafood market in Lianyungang, China, and verified to be free of V. vulnificus using quantitative PCR (qPCR) (D’Souza et al., 2019). The oyster tissue was homogenized using a handheld grinder. Negative samples were created by combining 1 g of homogenate with 10 mL of alkaline peptone. For positively spiked samples, 1 g of homogenate was mixed with 10 mL of V. vulnificus alkaline peptone culture with the desired bacterial density. For the validation with randomly spiked samples, a total of six positively spiked samples and four negative samples were prepared and randomly numbered for testing. DNA was extracted from 300 μL of the sample with a Tiangen DNA Kit. The randomly spiked samples had a loading amount of 10¹–10³ colony forming units (CFUs) per reaction. One CFU was considered to have 1 copy of the target because there was one copy of the empV gene per genome.

qPCR

The qPCR procedure followed the methodology described in a previous study (D’Souza et al., 2019). Positive results were determined based on cycle threshold (Ct) values below 32.

Results and Discussion

Canonical PAM could facilitate two-step RPA-CRISPR

By utilizing the RPA primers and the crRNA sequence (crRNA3) from a previously reported assay (Table 1) (Zhang et al., 2023), we achieved a high sensitivity of 4 copies of the target gene per reaction using the “amplification–cleavage” two-step procedure (Fig. 2A). This indicated that the canonical PAM could facilitate two-step RPA-CRISPR. The RPA was efficient when separated from the CRISPR reaction. Although not as distinguishable as the fluorescence signal, the amplification product was detectable through gel analysis with as few as 4 copies of the target (Fig. 2B). However, when we directly mixed these RPA and CRISPR components for a one-step reaction, the sensitivity was significantly compromised(Fig. 2C). The sensitivity dropped sharply to only 4 × 10⁴ copies/reaction compared with the two-step procedure, despite using the same materials. This clearly indicated an incompatibility between the RPA and the CRISPR cleavage in this V. vulnificus detection system, where the excessively activated Cas12a digested the target fragments and the new amplicons, as we had speculated in Figure 1.

Establishing a one-step RPA-CRISPR assay using scrRNA

We used the PAM manipulation approach to establish the one-step RPA-CRISPR assay for V. vulnificus detection, which involved screening of four suboptimal PAMs in the RPA amplicon sequence that complied with the pattern of VTTV or TCTV (‘V’ refers to A, C, or G) (Fig. S2) (Lu et al., 2022; Yamano et al., 2017). Based on these suboptimal PAMs, four corresponding scrRNAs (scrRNA1-4) were designed (Table 1). Through a two-step procedure, all four scrRNAs were confirmed to possess the fundamental functionality of activating Cas12a (Fig. 3A). Subsequently, these scrRNAs were evaluated in a one-step assay. The endpoint signals and fluorescence curves demonstrated their effectiveness in the one-step assay, with scrRNA2 exhibiting the highest signal intensity (Fig. 3B). As anticipated, crRNA3 only functioned in the two-step procedure but not in the one-step assay. The suboptimal scrRNA2 was selected for the one-step RPA-CRISPR assay, and its concentration was determined to be at least 100 nM (Fig. 3C).

FIG. 3.

Establishing a one-step RPA–CRISPR assay using scrRNA. (A) Confirmation on scrRNAs’ function of activating Cas12a with the two-step procedure. Both the fluorescence curves and the endpoint image are shown. The respective crRNA (50 nM) used in each reaction is indicated; 4 × 10⁷ copies of the target were used in each reaction. ‘NTC’ refers to the control without crRNA. (B) Screening the scrRNAs in the one-step assay. Fluorescence curves of reactions with 50 nM of the respective crRNA (+) or without crRNA (−) are represented by solid or dotted lines. The visualized endpoint signals are shown above the curves; 4 × 10³ copies of the target were used in each reaction. (C) Optimization of the scrRNA2 concentration. Fluorescence curves of reactions with 4 × 10³ copies of the target (+) or without the target (−) are shown by solid or dotted lines, respectively. The visualized endpoint signals are shown above the curves. The final concentrations of Cas12a and ssDNA-FQ in the reactions were 50 nM and 500 nM, respectively. The fluorescence intensities of the curves are presented in RFU. RPA, recombinase polymerase amplification; PAM, protospacer adjacent motif; ssDNA, single-stranded DNA; RFU, relevant fluorescence unit.

Evaluation of the one-step assay

The sensitivity was evaluated by using different amounts of V. vulnificus genomic DNA, ranging from 4 × 10° copies to 4 × 10⁵ copies. Both the fluorescence curve and the endpoint signal results demonstrated a sensitivity of 4 copies per reaction, which was comparable with the two-step assay (Fig. 4A–C) (Xiao et al., 2021). When compared with other molecular assays reported in the literature, such as RPA (2 copies/reaction) LAMP (1–10 copies/reaction), and qPCR (∼15 copies/reaction), this sensitivity was not inferior (D’Souza et al., 2019; Han and Ge, 2010; Yang et al., 2021). The fluorescence curves also indicated that 40 min was sufficient to generate a clear signal.

FIG. 4.

Sensitivity and specificity of the one-step RPA–CRISPR assay. (A) Sensitivity of the one-step assay. Fluorescence curves corresponding to different target amounts are displayed in different colors. The visualized endpoint signals are shown above the curves. (B) Bar chart showing the quantification of the fluorescence signals (values at time point 60 min of the fluorescence curves). (C) Bar chart showing the quantification of the gray values (in arbitrary units) representing the intensities of the tubes in the blue-light images. (D) Specificity of the one-step assay. Both the fluorescence curves and the endpoint image are shown. The species names of different pathogen templates (20 ng of genomic DNA for each pathogen) are indicated. The fluorescence intensities of the curves are presented in RFU. ‘NTC’ represents the no-template control. ‘cps’ denotes copies of the target. The error bars represent the standard error of three parallel repeats. **** P < 0.001. RPA, recombinase polymerase amplification; PAM, protospacer adjacent motif; ssDNA, single-stranded DNA; RFU, relevant fluorescence unit.

The specificity was assessed using various Vibrio species and two other foodborne pathogens, namely V. mimicus, V. cholerae, V. alginolyticus, V. shilonii, V. ichthyoenteri, V. splendidus, V. parahaemolyticus, S. aureus, and Y. enterocolitica. The results demonstrated the excellent specificity of the assay, with only V. vulnificus generating a detectable signal (Fig. 4D). The target gene (empV) had already been established in previous studies (Wang et al., 2021), showing reliable specificity and evolutionary conservation. The target fragment used in this study was species-specific, and an alignment of the target fragment sequences from 13 V. vulnificus GenBank inputs (all returned from a BLAST search of the RPA amplicon sequence) suggested high conservation of the scrRNA2 corresponding area (Fig. S3). The selection of this target fragment in gene empV and the design of scrRNA2 ensured the specificity of the assay.

Validation with spiked samples

The validation of the one-step RPA-CRISPR assay involved a sensitivity test of the assay using the quantitatively spiked samples, and detection of V. vulnificus in 10 randomly spiked samples (S1–S10). The results of the sensitivity test showed that the assay could detect as low as 4 CFUs of V. vulnificus in the spiked samples (Fig. 5A), which was equivalent to the 4 target copies as above. For the detection of randomly spiked samples, the outcomes were compared with those obtained from the two-step RPA-CRISPR assay and qPCR (Fig. 5B, S4 and Table S2). Consistent with the preparation of the randomly spiked samples, the test detected six positive samples and four negative samples. Moreover, the results of the one-step assay were completely consistent with those of the two-step assay and qPCR.

FIG. 5.

Validation of the one-step RPA–CRISPR assay with spiked samples. (A) Sensitivity of the assay tested with quantitatively spiked samples. Both the fluorescence curves and the endpoint image are shown. ‘NTC’ represents the no-template control. (B) Detection of V. vulnificus in randomly spiked samples by the one-step RPA–CRISPR assay. The fluorescence curves for the 10 samples (S1–S10) are displayed in various colors, with the endpoint image shown above the curves. The fluorescence intensities of the curves are presented in RFU. RPA, recombinase polymerase amplification; V. vulnificus, Vibrio vulnificus; RFU, relevant fluorescence unit.

Technological contributions

The PAM is a significant factor in CRISPR/Cas12a-mediated nucleic acid cleavages. From the molecular detection perspective, the requirement of PAM limits the flexibility of assay development on target sequence selection, and meanwhile provides a tool to manage the cleavage activity of Cas12a for certain applications. With the urgent demand for sensitive and reliable detection tools for SARS-CoV-2 in the past few years, Cas12a-based assays that utilized PAM manipulations have been developed, including the use of suboptimal PAM (Lu et al., 2022) and selecting sequences without the PAM (Ding et al., 2020; Lin et al., 2023). Another pathogen detection report for acute hepatopancreatic necrosis disease has applied suboptimal PAM to facilitate one-step RPA-CRISPR (Wang et al., 2023b). These assays have detection sensitivities ranging from several copies to hundreds of copies according to the detection requirements, suggesting that the PAM manipulation can keep the assay sensitivity if optimized appropriately. To date, there are only limited numbers of literatures dealing with the PAM to solve the incompatibility of Cas12a. Developing the one-pot system using PAM manipulation has certain advantages. The approaches using compartmentation of reaction reagents in one pot have a higher requirement on the operate procedure because accidental mixing of the reagents with wrong timing can disrupt the reactions. The approaches controlling the concentrations of reaction components in one pot have more pressure on the reagent manufacture and transportation because small inaccuracies of the component concentrations can affect the detection results. Therefore, a one-pot system using appropriate PAM manipulation is more robust, and exploring the general rules for PAM manipulation has a good value for the utilization of CRISPR/Cas. This study offers another example that helps establish the general principle of managing Cas-cleavage activity through PAM adjustments.

Evaluations of the one-step RPA-CRISPR assay for V. vulnificus detection show that it maintains the same level of accuracy and reliability as the two-step assay, while offering improved convenience in operation and better control over carryover contaminations. The assay can be completed within 40–60 min under isothermal conditions, and the results can be visually interpreted. The excitation wavelength for FAM is 494 nm, which is within the wavelength range of the blue light (Wang et al., 2023d). Thus, visualization of the detection results does not require a UV source. A blue light is good enough to visualize the results for the photograph taken and software analysis. The assay can be easily used for on-site detection of V. vulnificus.

Conclusions

This research presents a one-step RPA-CRISPR method for detecting V. vulnificus, enabling simultaneous amplification of nucleic acids and Cas12a cleavage. The issue of incompatibility between RPA and CRISPR cleavage has been resolved by using a specific crRNA targeting a sequence with a suboptimal PAM. This one-step assay demonstrates excellent specificity and high sensitivity, capable of detecting as few as 4 genomic DNA copies. The entire process is carried out at 37°C within 40–60 min with a visualized outcome reading under blue light. This study serves as a commendable model for developing one-step RPA-CRISPR assays and offers a valuable tool for molecular detection of V. vulnificus, contributing to the prevention of severe foodborne infections. Establishment of an integrated device that includes sample preparation, signal visualization, and result interpretation can be one of the future directions.

Footnotes

Authorship Contribution Statement

X.Z.: Conceptualization, data curation, formal analysis, investigation, methodology, validation, visualization, writing—original draft, and writing—review and editing. Y.W.: Conceptualization, data curation, methodology, investigation, validation, writing—original draft, and writing—review and editing. Y.T.: Methodology, investigation, and validation. L.Y.: Conceptualization, methodology, and investigation. C.Z.: Methodology and investigation. G.Y.: Conceptualization, data curation, formal analysis, project administration, visualization, supervision, writing—original draft, and writing—review and editing. P.W.: Conceptualization, data curation, formal analysis, investigation, project administration, visualization, supervision, writing—original draft, writing—review and editing, and funding acquisition. S.G.: Conceptualization, data curation, formal analysis, project administration, supervision, resources, writing—original draft, writing—review and editing, and funding acquisition.

Disclosure Statement

No competing financial interests exist.

Funding Information

This work was supported by grants from the China Postdoctoral Science Foundation (2022M721665), the Jiangsu Funding Program for Excellent Postdoctoral Talent of China (2022ZB358), and the Priority Academic Program Development of Jiangsu Higher Education Institutions of China.

Supplementary Material

Supplementary Figure S1

Supplementary Figure S2

Supplementary Figure S3

Supplementary Figure S4

Supplementary Table S1

Supplementary Table S2

References

Baker-Austin

, Oliver

. Vibrio vulnificus: New insights into a deadly opportunistic pathogen. Environ Microbiol, 2018; 20(2):423–430; doi: 10.1111/1462-2920.13955

Bonny

, Hossain

MAM

, Uddin

SMK

, et al. Current trends in polymerase chain reaction based detection of three major human pathogenic vibrios . Crit Rev Food Sci Nutr, 2022; 62(5):1317–1335; doi: 10.1080/10408398.2020.1841728

Chen

, Ma

, Harrington

, et al. CRISPR-Cas12a target binding unleashes indiscriminate single-stranded DNase activity. Science, 2018; 360(6387):436–439; doi: 10.1126/science.aar6245

Chen

, Mei

, Zhao

, et al. Reagents-Loaded, Automated assay that integrates recombinase-aided amplification and Cas12a nucleic acid detection for a point-of-care test. Anal Chem, 2020; 92(21):14846–14852.doi: 10.1021/acs.analchem.0c03883

Chen

, Xu

, Wang

, et al. Photoactivatable CRISPR/Cas12a strategy for one-pot DETECTR molecular diagnosis. Anal Chem, 2022; 94(27):9724–9731; doi: 10.1021/acs.analchem.2c01193

D’Souza

, Kumar

, Rai

, et al. Application of gyrB targeted SYBR green based qPCR assay for the specific and rapid detection of Vibrio vulnificus in seafood. J Microbiol Methods, 2019; 166:105747; doi: 10.1016/j.mimet.2019.105747

Ding

, Yin

, Li

, et al. Ultrasensitive and visual detection of SARS-CoV-2 using all-in-one dual CRISPR-Cas12a assay. Nat Commun, 2020; 11(1):4711; doi: 10.1038/s41467-020-18575-6

Elmahdi

, DaSilva

, Parveen

. Antibiotic resistance of Vibrio parahaemolyticus and Vibrio vulnificus in various countries: A review. Food Microbiol, 2016; 57:128–134; doi: 10.1016/j.fm.2016.02.008

Feng

, Peng

, Xu

, et al. Integrating reverse transcription recombinase polymerase amplification with CRISPR technology for the one-tube assay of RNA. Anal Chem, 2021; 93(37):12808–12816; doi: 10.1021/acs.analchem.1c03456

10.

Han

, Ge

. Quantitative detection of Vibrio vulnificus in raw oysters by real-time loop-mediated isothermal amplification. Int J Food Microbiol, 2010; 142(1–2):60–66; doi: 10.1016/j.ijfoodmicro.2010.05.029

11.

, Qiu

, Bi

, et al. Photocontrolled crRNA activation enables robust CRISPR-Cas12a diagnostics. Proc Natl Acad Sci U S A, 2022; 119(26):e2202034119; doi: 10.1073/pnas.2202034119

12.

Huang

, Liu

, Xu

, et al. CRISPR/Cas12a technology combined with RPA for rapid and portable SFTSV detection. Front Microbiol, 2022; 13:754995; doi: 10.3389/fmicb.2022.754995

13.

Huang

, Tian

, Liu

, et al. Ultra-sensitive and high-throughput CRISPR-powered COVID-19 diagnosis. Biosens Bioelectron, 2020; 164:112316; doi: 10.1016/j.bios.2020.112316

14.

Jirawannaporn

, Limothai

, Tachaboon

, et al. Rapid and sensitive point-of-care detection of Leptospira by RPA-CRISPR/Cas12a targeting lipL32. PLoS Negl Trop Dis, 2022; 16(1):e0010112; doi: 10.1371/journal.pntd.0010112

15.

Kim

, Kim

, Neupane

, et al. Comparison of conventional, nested, and real-time PCR assays for rapid and accurate detection of Vibrio vulnificus . J Clin Microbiol, 2008; 46(9):2992–2998; doi: 10.1128/jcm.00027-08

16.

, Xiao

, Yang

, et al. Development of a rapid and efficient RPA-CRISPR/Cas12a assay for Mycoplasma pneumoniae detection. Front Microbiol, 2022; 13:858806; doi: 10.3389/fmicb.2022.858806

17.

Liang

, Li

, Wang

, et al. A CRISPR-Cas12a-derived biosensing platform for the highly sensitive detection of diverse small molecules. Nat Commun, 2019; 10(1):3672; doi: 10.1038/s41467-019-11648-1

18.

Lin

, Guo

, et al. Fast and visual detection of nucleic acids using a one-step RPA-CRISPR detection (ORCD) system unrestricted by the PAM. Anal Chim Acta, 2023; 1248:340938; doi: 10.1016/j.aca.2023.340938

19.

Lin

, Yue

, Tian

, et al. Glycerol additive boosts 100-fold sensitivity enhancement for one-pot RPA-CRISPR/Cas12a assay. Anal Chem, 2022; 94(23):8277–8284; doi: 10.1021/acs.analchem.2c00616

20.

, Tong

, Han

, et al. Fast and sensitive detection of SARS-CoV-2 RNA using suboptimal protospacer adjacent motifs for Cas12a. Nat Biomed Eng, 2022; 6(3):286–297; doi: 10.1038/s41551-022-00861-x

21.

Mao

, Chen

, Wang

, et al. CRISPR/Cas12a-based technology: A powerful tool for biosensing in food safety. Trends Food Sci Technol, 2022; 122:211–222; doi: 10.1016/j.tifs.2022.02.030

22.

Oliver

. Vibrio vulnificus: Death on the half shell. A personal journey with the pathogen and its ecology. Microb Ecol, 2013; 65(4):793–799; doi: 10.1007/s00248-012-0140-9

23.

Shao

, Park

, Zhao

, et al. Elucidating the role of CRISPR/Cas in single-step isothermal nucleic acid amplification testing assays. Anal Chem, 2023; 95(7):3873–3882; doi: 10.1021/acs.analchem.2c05632

24.

Swarts

, van der Oost

, Jinek

. Structural basis for guide RNA processing and seed-dependent DNA targeting by CRISPR-Cas12a. Mol Cell, 2017; 66(2):221–233.e224; doi: 10.1016/j.molcel.2017.03.016

25.

Wang

, Guo

, Zhang

, et al. One-pot molecular diagnosis of acute hepatopancreatic necrosis disease by recombinase polymerase amplification and CRISPR/Cas12a with specially designed crRNA. J Agric Food Chem, 2023b;71(16):6490–6498; doi: 10.1021/acs.jafc.2c08689

26.

Wang

, Ji

, Fan

, et al. CRISPR/Cas12a technology combined with immunochromatographic strips for portable detection of African swine fever virus. Commun Biol, 2020; 3(1):62; doi: 10.1038/s42003-020-0796-5

27.

Wang

, Liao

, Ma

, et al. Duplex on-site detection of Vibrio cholerae and Vibrio vulnificus by recombinase polymerase amplification and three-segment lateral flow strips. Biosensors (Basel), 2021; 11(5); doi: 10.3390/bios11050151

28.

Wang

, Wang

, et al. Cas12aVDet: A CRISPR/Cas12a-based platform for rapid and visual nucleic acid detection. Anal Chem, 2019; 91(19):12156–12161; doi: 10.1021/acs.analchem.9b01526

29.

Wang

, Wang

, et al. Sensitive and amplification-free detection of telomerase activity by self-extension of telomerase and trans-cleavage of CRISPR/Cas12a. Talanta, 2023a;253:123999; doi: 10.1016/j.talanta.2022.123999

30.

Wang

, Yang

, Guo

, et al. Highly sensitive detection of white spot syndrome virus with an RPA-CRISPR combined one-pot method. Aquaculture, 2023c;567:739296; doi: org/10.1016/j.aquaculture.2023.739296

31.

Wang

, Zhang

, Shen

, et al. A one-pot RPA-CRISPR detection method for point-of-care testing of Enterocytozoon hepatopenaei infection in shrimp. Sensors Actuat B-Chem, 2023d;374:132853; doi: org/10.1016/j.snb.2022.132853

32.

Xiao

, Lin

, Huang

, et al. Rapid and sensitive detection of Vibrio vulnificus using CRISPR/Cas12a combined with a recombinase-aided amplification assay. Front Microbiol, 2021; 12:767315; doi: 10.3389/fmicb.2021.767315

33.

Xiong

, Dai

, Gong

, et al. Rapid detection of SARS-CoV-2 with CRISPR-Cas12a. PLoS Biol, 2020; 18(12):e3000978; doi: 10.1371/journal.pbio.3000978

34.

Yamano

, Zetsche

, Ishitani

, et al. Structural basis for the canonical and non-canonical PAM recognition by CRISPR-Cpf1. Mol Cell, 2017; 67(4):633–645.e633; doi: 10.1016/j.molcel.2017.06.035

35.

Yang

, Zhang

, Wang

, et al. A real-time recombinase polymerase amplification method for rapid detection of Vibrio vulnificus in Seafood. Front Microbiol, 2020; 11:586981; doi: 10.3389/fmicb.2020.586981

36.

Yang

, Zhao

, Dong

, et al. An isothermal recombinase polymerase amplification and lateral flow strip combined method for rapid on-site detection of Vibrio vulnificus in raw seafood. Food Microbiol, 2021; 98:103664; doi: 10.1016/j.fm.2020.103664

37.

Yin

, Ding

, Li

, et al. Dynamic aqueous multiphase reaction system for one-pot CRISPR-Cas12a-based ultrasensitive and quantitative molecular diagnosis. Anal Chem, 2020; 92(12):8561–8568; doi: 10.1021/acs.analchem.0c01459

38.

Yin

, Man

, Ye

, et al. CRISPR-Cas based virus detection: Recent advances and perspectives. Biosens Bioelectron, 2021; 193:113541; doi: 10.1016/j.bios.2021.113541

39.

Zetsche

, Gootenberg

, Abudayyeh

, et al. Cpf1 is a single RNA-guided endonuclease of a class 2 CRISPR-Cas system. Cell, 2015; 163(3):759–771; doi: 10.1016/j.cell.2015.09.038

40.

Zhang

, Guo

, Yang

, et al. CRISPR/Cas12a combined with recombinase polymerase amplification for rapid and sensitive detection of Vibrio vulnificus in one tube. Acta Biochim Biophys Sin (Shanghai), 2023; 55(2):322–326; doi: 10.3724/abbs.2023013

41.

Zhong

, Chen

, Sun

, et al. PCDetection: PolyA-CRISPR/Cas12a-based miRNA detection without PAM restriction. Biosens Bioelectron, 2022; 214:114497; doi: 10.1016/j.bios.2022.114497

Supplementary Material

Please find the following supplemental material available below.

For Open Access articles published under a Creative Commons License, all supplemental material carries the same license as the article it is associated with.

For non-Open Access articles published, all supplemental material carries a non-exclusive license, and permission requests for re-use of supplemental material or any part of supplemental material shall be sent directly to the copyright owner as specified in the copyright notice associated with the article.

0.00 MB

1.10 MB