Microbiological Quality and Safety of Brazilian Mozzarella Cheese During Production Stages

Abstract

This study assessed the microbiological quality and safety of mozzarella during various production stages in northern Tocantins, Brazil, by identifying critical biological points in the industrial environment within a tropical climatic region. Batches of mozzarella were evaluated, from raw milk to primary packaging, with a shelf life of 120 d at 4°C. Indicator microorganisms were quantified, and through microbiological and biomolecular approaches, Salmonella spp. and Listeria monocytogenes were identified. In addition, the toxigenic potential of coagulase-positive staphylococci (CPS) was characterized. Results indicated that the raw milk used for mozzarella production had low microbiological quality; pasteurization of raw milk effectively eliminated all identified pathogens and reduced microbiological counts (p > 0.05). An increase in bacterial counts (>2 log colony-forming unit [CFU]/g) and recontamination with Salmonella spp. and CPS, which potentially produce staphylococcal enterotoxin B, were observed during milk coagulation and curd draining. Stretching of the fermented curd reduced the enterobacteria, total coliforms, and Escherichia coli median values by 2.56, 2.64, and 2.3 log CFU/mL, respectively. Similarly, brining the pieces by immersion reduced the quantity of enterobacteria and total coliforms by 2.3 and 1.6 log CFU/mL, respectively. Of interest, in the freshly finished product, Salmonella spp. was present but L. monocytogenes was absent; however, after the shelf-life period, L. monocytogenes was present but Salmonella spp. was absent. Considering the environmental conditions that can promote the multiplication and preservation of pathogens and spoilage of dairy products in tropical climates, it is necessary to review operational hygiene procedures, particularly in milk coagulation vats and fermentation tables. This will ensure the production of high-quality mozzarella cheese with a reduced consumption risk.

Introduction

The mandatory high-temperature, short-term pasteurization of raw milk for Brazilian mozzarella cheese production is crucial for eliminating microbiological pathogens (Brazil, 2017; Brazil, 1997). However, the quality and safety of the product can be compromised during various stages of industrial processing, predisposing it to postpasteurization recontamination (Ribeiro Júnior et al., 2018; Lembi et al., 2020; Perry, 2004) by microbes and their thermostable secondary metabolites.

The technologies involved in producing Brazilian mozzarella cheese include raw milk pasteurization, biological and enzymatic coagulation, curd fermentation to a pH of <5.4, stretching, forming, brining, and primary packaging (Brazil, 1997; Marinheiro et al., 2015). Each of these steps can potentially lead to postpasteurization recontamination if there are deviations from or noncompliance with the critical limits set by dairy self-control programs (Perry, 2004).

The humid and tropical climate of the northern region of the state of Tocantins, Brazil, can predispose the industrial environment to contamination, facilitating the rapid multiplication and maintenance of pathogens and spoilage microorganisms (Bonilla-Luque et al., 2023). It can also lead to increased contamination and lactic acid fermentation changes, such as a reduction in the time required for the pH to decrease (Fox and Guinee, 2013).

Given the intricacy of the production stages, there is a pressing need for additional investigation into potential contamination points within the industrial flow or areas where technological failures could jeopardize the quality and/or safety of the cheese (Fusco et al., 2022). Previous studies have demonstrated that the safety of cheeses produced in the northern region of Tocantins may be compromised by various pathogens (Oliveira et al., 2021; Ribeiro Júnior et al., 2024). Therefore, investigations need to be extended to tropical climate regions to determine contaminants and autochthonous microbiota of cheese (Ribeiro Júnior et al., 2019).

This study aimed to assess the microbiological quality and safety of mozzarella cheese at various stages of production in a dairy facility located in Tocantins and to identify potential critical points at which environmental contaminants could be introduced during processing. These findings will subsequently aid in revising self-monitoring programs for dairy products in tropical regions.

Materials and Methods

This study was conducted from August to December 2022 at a dairy processing facility situated in Augustinópolis in the northern region of Tocantins, Brazil. The facility is registered with the Federal Inspection Service affiliated with the Brazilian Ministry of Agriculture, Livestock, and Food Supply. It has an installed reception capacity of 12,000 L/d and produces mozzarella and coalho cheese, butter, and industrial milk cream.

Seven samples were collected across five batches on different days from various stages: refrigerated raw milk, pasteurized milk, initial cheese curd during fermentation, fermented cheese curd, stretched curd (cooker-stretcher machine), and packaged cheese (two samples). To ensure consistency between samples in each batch, repetition was closely monitored throughout the production process, which spanned 52 h.

A cheese sample from each batch was retained in its original packaging and refrigerated at ∼4°C for a period of 120 d to evaluate the product's shelf life in accordance with the dairy factory specifications for the original cheese label. The factory had already validated this period using predictive microbiology, and this had been authorized by the local inspection service.

Representative aliquots of 25 mL/g from each sample were homogenized in 225 mL of buffered peptone water (Acumedia, Baltimore, MD). An additional aliquot of the same volume/weight was homogenized in Half-Fraser broth (Acumedia) for the pre-enrichment of Salmonella spp. and Listeria monocytogenes. Subsequent procedures for investigating these two pathogens adhered to the methods outlined by the International Organization for Standardization (ISO) ISO 6579:2002/Amd 1:2007 and 11290-1:1996/Amd 1:2004, respectively. Both methods were modified to include confirmation of the sex and/or species of suggestive isolates on plates in the polymerase chain reactions (PCRs), as given in Table 1.

Table 1.

Primers and References Used for Identification and Molecular Characterization of Isolates Suggestive of Pathogens Isolated from Mozzarella Cheese at Different Manufacturing Stages

Microorganism	Gene	Primers (5′–3′)	References
Salmonella spp.	invA	GTGAAATTATCGCCACGTTCG	Shanmugasamy et al. (2011)
Salmonella spp.	invA	TCATCGCACCGTCAAAGGAACC	Shanmugasamy et al. (2011)
Coagulase-positive Staphylococcus	mecA	ACTGCTATCCACCCTCAAAC
	mecA	CTGGTGAAGTTGTAAT
	sea	ACCCCTGTTCCCTTATCATC	Mehrotra et al. (2000)
	sea	TTTTCAGTATTTGTAACGCC
	seb	GCAGGTGTTGATTTAGCATT
	seb	AGATGTCCCTATTTTTGCTG
	sec	ACAAGCAAAAGAATACAGCG
	sec	GTTTTTGGCTGCTTCTCTTG
	sed	ACCCCTGTTCCCTTATCATC
	sed	TTTTCAGTATTTGTAACGCC
	see	GCAGGTGTTGATTTAGCATT
	see	AGATGTCCCTATTTTTGCTG
Listeria monocytogenes	lmo0733	CGCAAGAAGAAATTGCCATC	Chen and Kanabel (2007)
Listeria monocytogenes	lmo0733	TCCGCGTTAGAAAAATTCCA	Chen and Kanabel (2007)

The 10⁻¹ dilution mentioned earlier was used to perform decimal and serial dilutions in the peptone saline solution. These were then inoculated onto plates for the quantification of mesophilic aerobics and psychrotrophs using the pour-plate (Morton, 2001) and spread-plate (Frank and Yousef, 2004) methods, respectively. Total coliforms (at 30°C) and Escherichia coli were quantified using Compact Dry^® EC, whereas enterobacteria were quantified using Compact Dry ETB (Nissui Pharmaceutical Co., Tokyo, Japan) according to the manufacturer's guidelines. Total staphylococci were quantified using the ISO 6888-1:1999/Amd 1:2003 method. Coagulase-positive staphylococci (CPS) were differentiated from the total count using the coagulase test as described by Silva et al. (2005).

CPS isolates were subjected to DNA extraction (Ribeiro Júnior et al., 2016) and PCR to detect the genes encoding staphylococcal toxins A–E. Multiplex reactions were performed using the protocol described by Mehrotra et al. (2000), and all PCRs were performed according to the protocol described by Ribeiro Júnior et al. (2016).

Absolute counts values <1 colony-forming unit (CFU)/mL were considered as 1 for logarithmic transformation (0 log). The CFU count data, even after logarithmic transformation, indicated homogeneity of variances, but did not present normality of residuals, and thus did not meet the necessary assumptions for parametric analyses. Therefore, the paired Wilcoxon test was carried out using the SAS Studio^® software (SAS Institute, Inc., Cary, NC), (SAS, 2023) adopting a 0.05 significance level.

Results and Discussion

Table 2 presents the median results of microorganism counts from different batches at each manufacturing stage. The refrigerated raw milk evaluated in this study, sourced from the dairy facility's bulk tanks, exhibited low microbiological quality. Total counts exceeded 8 log CFU/mL, surpassing the Brazilian legal limit of 5.95 log CFU/mL for raw milk in a storage pool (Brazil, 2018). Other countries, such as the United States, apply even stricter microbiological standards for the quality of raw milk (5 log CFU/mL). Consequently, all five batches of refrigerated raw milk assessed in this study failed to meet the Brazilian and international standards. The microbiological quality of raw milk directly impacts the shelf life and technological potential of pasteurized milk (Ribeiro Júnior et al., 2019).

Table 2.

Median (Lower Quartile–Upper Quartile) Microorganism Counts Indicating the Quality of Five Mozzarella Cheese Batches Produced in Northern Tocantins: A Comparison Across Each Stage of Industrial Processing and After 120 D of Shelf Life

Sample	Mesophilic aerobes	Psychrotrophic	Enterobacteria	Total coliforms	Escherichia coli	Total Staphylococcus	Coagulase-positive Staphylococcus
Raw milk	8.45 (8.3–8.54)^*	7.01 (6.35–7.26)^*	7.45 (7.2–7.68)^*	7.37 (7.35–7.66)^*	6.28 (6.24–6.39)^*	7.04 (6.37–7.32)^*	6.49 (5.99–6.72)^*
Pasteurized milk	5.59 (5.48–6.35)^*	0 (0–0)^*	<0.1 (0–0.62)^*	<0.1 (0–0.24)^*	0 (0–0)^*	2.78 (1.71–3.56)^*	0 (0–0)^*
Prefermentation curd	7.36 (7.32–7.56)^*	0 (0–0)^*	4 (3.62–5.97)^*	3.52 (2.59–4.02)^*	2.78 (0–4.32)^*	3.74 (3.44–4.92)^*	<0.1 (0–2.5)^*
Fermented curd	9.65 (7.5–11.17)^*	<0.1 (0–1.8)^*	5.05 (4.12–8)^*	4.34 (3.5–6.78)^*	3.3 (0–6.57)^*	4 (1.85–4.9)^*	<0.1 (0–4.35)^*
Streating curd	8.09 (7.67–8.61)^*	<0.1 (0–3.06)^*	2.49 (0–4)^*	1.7 (0–3.72)^*	1 (0–3.75)^*	2.95 (2.4–4.61)^*	0 (0–0)^*
Mozzarella brining	7.99 (7.58–8.21)^*	<0.1 (0–1.09)^*	0 (0–0)^*	<0.1 (0–0.5)^*	<0.1 (0–0.89)^*	4 (3.17–4.77)^*	<0.1 (0–1.29)^*
Shelf life	7.71 (6.96–9.59)^*	<0.1 (0–1.48)^*	<0.1 (0–0.95)^*	<0.1 (0–2.48)^*	0 (0–0)^*	3.76 (3.35–5.22)^*	2.68 (0–3.09)^*

Median values, when accompanied by different letters within the same column, indicate significant differences as per paired Wilcoxon test at a 5% probability level.

Values are expressed as log CFU/g/mL.

CFU, colony-forming unit.

The pasteurization of raw milk reduced psychrotrophic counts to ∼7 log CFU/mL (p > 0.05). However, it is anticipated that technological issues stemming from proteolysis and lipolysis, such as bitterness and hydrolytic rancidity, may degrade the quality of mozzarella cheese. This is because of the heat-resistant nature of these microbial enzymes (Gasparini et al., 2020; Santana et al., 2020), as the same for microbial toxins.

The high counts of Enterobacteriaceae family, including their subgroups (total coliforms and E. coli), were also substantially reduced by pasteurization, reaching virtually undetectable levels in pasteurized milk. It is expected that pasteurized milk will exhibit undetectable counts immediately upon exiting the pasteurizer (Brazil, 2018). The minimal counts of Gram-negatives found in pasteurized milk could be attributed to environmental contamination during sampling. This is because pasteurization, a biological critical control point (CCP), is continuously monitored by instruments (thermoregulator, valve bypass, and thermorecorder) and the enzymatic profile (alkaline phosphatase and peroxidase), with no deviations from the critical limit recorded during sampling.

High counts of microorganisms were observed when batches of pasteurized milk were placed in coagulation vats and lactic ferment and enzymatic rennet were added. These microorganisms were primarily indicators of environmental (enterobacteria and total coliforms) and fecal contamination (E. coli). The median count of enterobacteria increased from <0.1 in pasteurized milk to 4 log CFU/mL in the prefermentation curd (Table 2). Similarly, total coliforms and E. coli increased to ∼3 log CFU/mL. Given that the dairy curd had not yet undergone fermentation and that enterobacteria constituted majority of the total microbiological counts, it is crucial to identify and control sources of environmental and fecal contamination at this stage. This is to minimize the potential presence of enteropathogens, particularly since the contamination originates from the industrial environment and the biological CCP (pasteurization) has already been surpassed in the production flowchart.

The fermentation of dairy curd using microbiological cultures of lactic acid bacteria is crucial for reducing the pH to levels <5.4. The cultures used in this study were composed of a thermophilic lyophilized culture of mixed strains of Streptococcus salivarius subsp. thermophilus, Lactobacillus delbrueckii subsp. bulgaricus, and Lactobacillus helveticus (Elian Comércio de Insumos, Vila Velha, Brazil). These starter cultures are known to produce bacteriocins, peroxides, and acids, which can inhibit the growth of other microorganisms (Panebianco et al., 2021). However, in this study, it was observed that despite the total bacterial count increasing from 7.36 to 9.65 log CFU/g (Table 2), there was also an increase in indicators of environmental contamination. This was primarily seen in the total coliforms, which increased from 3.52 in prefermentation curd to 4.34 log CFU/g after the pH lowering process. This observation underscores the incorporation of environmental contamination after pasteurization and before fermentation.

The study by Fagnani et al. (2013) verified that the surface of milk coagulation tanks in the production of Brazilian mozzarella may present E. coli counts >3.90 log CFU/cm². Corroborating this study, environmental and fecal contamination during the production of mozzarella already begins in the first stages of postpasteurization processing and operational hygiene can be improved to reduce the contamination incorporated during coagulation.

The stretching process by continuous cooking and stretching reduced the microbiological counts of all indicator microorganisms examined in this study, except for psychrotrophs. The reductions observed were more expressive for Gram-negatives (Table 2). Enterobacteria, total coliforms, and E. coli reduced the median values by 2.56, 2.64, and 2.3 log CFU/mL, respectively.

The process of heating the curd to ∼58–60°C through direct contact with water at ∼70–80°C is a mechanical step that significantly enhances the microbiological quality of the product (Fox and Guinee, 2013). This heating stage, therefore, serves as a control point for contaminants following milk postpasteurization, coagulation, and curd fermentation. Despite not possessing the potential to confer microbiological safety (Nobili et al., 2016), this stage has proven to be a crucial tool in improving the quality of the final product.

Immersing mozzarella pieces in a 20% (m/v) sodium chloride brine for 20 h at 8°C, similar to the stretching process, also showed a reduction in contamination across some studied indicators. The reductions were 2.3, 1.6, and 1 log CFU/mL for enterobacteria, total coliforms, and E. coli, respectively (p > 0.05). The Enterobacteriaceae family is known for its low tolerance to high salt concentrations (Spano et al., 2003). Microorganisms from this group were reduced to undetectable levels after brining (Table 2).

Following 120 d of shelf life at 4°C, a rise in microorganism counts was noted, a predictable outcome owing to product storage. However, this increase was not statistically significant compared with the product immediately postproduction (p > 0.05). A predominance of psychrotrophs was expected. However, this was not observed, likely because of the starter culture being predominantly mesophilic.

The legislation governing food microbiological quality in commerce, as stipulated by National Health Surveillance Agency (ANVISA) (Brazil, 2022) mandates that cheeses must not exceed a CPS and E. coli count of 3 log CFU/g. Similarly, MAPA legislation (Brazil, 1997) sets the maximum CPS at 3 log CFU/g and total coliforms at 3.70 log CFU/g. As demonstrated in Table 2, the samples complied with the quantitative standards determined in Brazil.

Both legislations stipulate that mozzarella cheese must be free from Salmonella spp. and L. monocytogenes, as determined qualitatively (Brazil, 2022; Brazil, 1997). However, as indicated in Table 3, Salmonella spp. was confirmed in 37.88% of the 66 suggestive isolates recovered from the product postbrining and immediately after primary packaging. These 25 Salmonella spp. isolates were recovered from two of the five evaluated cheese batches. The presence of this pathogen in mozzarella cheese has been documented in other studies (Cunha-Neto et al., 2020).

Table 3.

Polymerase Chain Reaction Results for the Identification of Salmonella spp., Listeria monocytogenes, and the Molecular Characterization of the Production Potential of Staphylococcal Enterotoxins A to E (sea to see Genes) and Resistance to Methicillin (mecA)

Stage	Salmonella spp.		L. monocytogenes		Coagulase-positive Staphylococcus
	Salmonella spp.		L. monocytogenes				sea	seb	sec	sed	see	mecA
	n	n (%) Positive	n	n (%) Positive	n	n (%) Positive	n (%)	n (%)	n (%)	n (%)	n (%)	n (%)
Raw milk	142	77 (54.23)	75	0	35	10 (28.57)	0	4 (11.43)	2 (5.71)	1 (2.86)	0	3 (8.57)
Pasteurized milk	0	0	40	0	0	0	0	0	0	0	0	0
Prefermentation curd	44	7 (15.91)	60	0	3	1 (33.33)	0	1 (33.3)	0	0	0	0
Fermented curd	54	7 (12.96)	61	4 (6.56)	6	1 (16.66)	0	1 (16.67)	0	0	0	0
Streating curd	39	9 (23.08)	38	3 (7.89)	0	0	0	0	0	0	0	0
Mozzarella brining	66	25 (37.88)	30	0	1	0	0	0	0	0	0	0
Shelf life	60	0	62	8 (12.90)	0	0	0	0	0	0	0	0
Total	405	125 (30.86)	366	15 (4.1)	45	12 (26.66)	0	6 (13.33)	2 (4.44)	1 (2.22)	0	3 (6.66)

These were isolated from five batches of mozzarella cheese at various stages of production and throughout their shelf life.

However, no Salmonella spp. isolates were recovered from the product after its shelf life. This suggests that the antagonistic activity of the lactic acid bacteria used in production may have positively contributed to rendering this pathogen undetectable in the final product (Campagnollo et al., 2022).

The impact of pasteurization on the elimination of all pathogens in raw milk was observed, although this treatment, wisely, is not enough to eliminate toxins and other microbial enzymes. Postpasteurization environmental and fecal contamination was also identified, consequently, deficiencies in operational, environmental, and handler hygiene postpasteurization can compromise both the quality and safety of the milk (Pal et al., 2016).

Following the continuous cooking and stretching, no strains of E. coli were identified in the mozzarella curd. However, both Salmonella spp. and L. monocytogenes were detected poststretching, underscoring that this process does not guarantee microbiological safety. The study by Nobili et al. (2016) confirmed that when Shiga toxin–producing E. coli (STEC) is present in unpasteurized raw milk, it can remain viable throughout the entire mozzarella production process. This is true even when the quenching water is heated to a higher temperature (∼95°C) than that used in this study (∼80°C).

L. monocytogenes was detected only after the curd fermentation process. This process begins with a 4-h immersion of the curd in serum to maintain temperature, thereby accelerating the multiplication of lactic acid bacteria. Subsequently, the curd is transferred to fermentation tables for an hour at room temperature, which, at the time and location of collection, reached 38°C. This procedure is conducted on stainless steel tables, which are cleaned after each use. However, it is known that L. monocytogenes and other pathogens can form biofilms, thereby resisting standard hygiene procedures on equipment and facility surfaces in dairy and other food production factories (Almeida et al., 2013; Di Ciccio et al., 2022; Gérard et al., 2018). The vat in which the curd is immersed in whey, as well as the fermentation tables, could potentially be the contamination points for the curd by this pathogen. Of note, this pathogen remained detectable even after the straining stage, similar to Salmonella spp.

Following the brining process, no isolates of L. monocytogenes or E. coli were recovered. However, it was still possible to isolate Salmonella spp. and E. coli, suggesting that the conditions were conducive to maintaining the viability of enteropathogens.

The viability of L. monocytogenes was confirmed in one of five mozzarella samples after 120 d of refrigerated storage. Following brining, the samples were placed in cold chambers for drying and subsequent primary packaging. It is plausible that the samples were contaminated by L. monocytogenes on the drying racks. Given the psychrotrophic capacity of this microorganism, it could have multiplied in the product during the storage period, enabling its detection after 120 d at 4°C.

Salmonella spp. or E. coli were not identified in the product after the shelf-life period. This could be owing to a specific antagonistic action against Gram-negatives by lactic ferments (Volzing et al., 2013). In addition to supporting the acidification process, this specific antagonism may have contributed to the control of other groups of indicators, such as enterobacteria and coliforms, known to have a spoilage capacity and which could have limited the shelf life (Bassi et al., 2020). This antagonistic action was not observed for L. monocytogenes. The presence of this pathogen in cheeses was recently identified as the cause of a foodborne illness outbreak in several U.S. states (Palacios et al., 2022).

Table 3 provides the biomolecular characterization results of CPS's enterotoxigenic potential. The evaluation of raw milk in this study revealed that numerous isolates exhibited the potential to synthesize staphylococcal enterotoxins (B, C, and D). These isolates also demonstrated resistance to methicillin, indicating a potential Staphylococcus aureus—MRSA.

Although the toxigenic potential has been identified, it cannot be definitively stated that the cheeses and/or raw milk pose a risk for consumption. This is because the genetic potential for toxin production does not, in itself, guarantee the presence of these metabolites (Babić et al., 2019; Dai et al., 2019). This is further evidenced by the most recent Brazilian legislation, which mandates the investigation and quantification of staphylococcal toxins as a replacement for CPS counts (Brazil, 2022). Nevertheless, outbreaks of intoxication caused by CPS metabolites are also frequently reported (Le et al., 2021). Therefore, it is essential that future studies support the quantification of staphylococcal enterotoxins in Brazilian raw milk and cheese to determine risk mitigation measures for public health, considering the potential of the microbiota to produce these metabolites, demonstrated in this study.

Similar to enterobacteria, total coliforms, and E. coli, recontamination of the product by CPS was observed from the coagulation of the curd before fermentation. This included isolates potentially producing staphylococcal enterotoxin B. It was further observed that these toxigenic CPS remained viable after the fermentation stage, but were reduced to undetectable levels in the cheese after stretching.

Thus, CPS, as microorganisms indicative of hygienic and sanitary handling quality (Bencardino et al., 2021), demonstrated critical steps for recontamination within the mozzarella production flowchart. This was evident both in their counts (Table 2) and toxigenic potential (Table 3), particularly during coagulation, serum separation, and brine immersion. The toxigenic CPS were recently described as a problem for other cheeses produced in the same Brazilian region (Ribeiro Júnior et al., 2024).

Conclusion

The pasteurization of raw milk effectively eliminated microbial vegetative hazards, but it cannot be said that it made the milk safe owing to the high contamination and possible presence of heat-stable metabolites. The stretching of the acidified curd can also contribute to the reduction of microorganisms in the mozzarella production process. However, this step alone is insufficient to ensure the product's safety for consumption. Even in regular dairy factories, there are vulnerabilities in mozzarella production, such as coagulation/dedraining and brine immersion, which may potentially reintroduce contaminants postpasteurization.

Dairy companies operating in tropical climate regions must decisively promote the enhancement of refrigerated raw milk quality from their producers. They should also reassess their self-monitoring strategies within the industrial setting, focusing primarily on the hygiene procedures for facilities and equipment. At the same time, regulatory agencies can adopt a risk-based inspection approach, continuously assessing and mitigating risks of microbiological hazards in cheese products.

Footnotes

Disclosure Statement

All authors contributed equally and declare that they have no conflict of interest.

Funding Information

This study was supported by the following Brazilian institutes: the National Council of Scientific and Technological Development (CNPq; grant No. 465725/2014-7), the Brazilian Federal Agency for Support and Evaluation of Graduate Education (CAPES), Financing of Studies and Projects (FINEP), Araucaria Foundation (FAP/PR), Tocantins Research Support Foundation (FAPT; Edital Pesquisa Agropecuária) and Federal University of North of Tocantins (Edital 17 and 18/2023).

References

Almeida

, Magalhães

, Carneiro

, et al. Foci of contamination of Listeria monocytogenes in different cheese processing plants. Int J Food Microbiol, 2013; 167(3):303–309; doi: 10.1016/j.ijfoodmicro.2013.09.006

Babić

, Pajić

, Radinović

, et al. Effects of temperature abuse on the growth and staphylococcal enterotoxin A gene (sea) expression of Staphylococcus aureus in milk. Foodborne Pathog Dis, 2019; 16(4):282–289; doi: 10.1089/fpd.2018.2544

Bassi

, Gazzola

, Sattin

, et al. Lactic acid bacteria adjunct cultures exert a mitigation effect against spoilage microbiota in fresh cheese. Microorganisms, 2020; 8(8):1199; doi: 10.3390/microorganisms8081199

Bencardino

, Amagliani

, Brandi

. Carriage of Staphylococcus aureus among food handlers: An ongoing challenge in public health. Food Control, 2021; 130:108362; doi: 10.1016/j.foodcont.2021.108362

Bonilla-Luque

, Possas

, Cabo

, et al. Tracking microbial quality, safety and environmental contamination sources in artisanal goat cheesemaking factories. Food Microbiol, 2023; 114:104301; doi: 10.1016/j.fm.2023.104301

Brazil. Ministry of Agriculture, Livestock and Supply - MAPA. Ordinance No. 364, of September 4, 1997. Technician Regulation for Establishing Identity and Quality of Mozzarella Cheese. Diário Oficial da União; 1997.

Brazil. Ministry of Agriculture, Livestock and Supply - MAPA. Decree No. 9,013, of March 29, 2017. Regulations Law No. 1,283, of December 18, 1950, and Law n 7,889, of November 23, 1989. Provides for inspection industrial and sanitary action of products of animal origin. Diário Oficial da União; 2017.

Brazil. Ministry of Agriculture, Livestock and Supply - MAPA. Normative Instruction No. 76, of November 26, 2018. Technical Regulations that establish the identity and quality characteristics that must present refrigerated raw milk, pasteurized milk and pasteurized type A. Diário Oficial da União; 2018.

Brazil. Ministry of Health - MS. National Surveillance Sanitary Agency - ANVISA. Resolution No. 724, of July 1, 2022. Microbiological standards of foods. Diário Oficial da União; 2022.

10.

Campagnollo

, Pedrosa

GTS

, Kamimura

, et al. Growth potential of three strains of Listeria monocytogenes and Salmonella enterica in Frescal and semi-hard artisanal Minas microcheeses: Impact of the addition of lactic acid bacteria with antimicrobial activity. LWT, 2022; 158:113169; doi: 10.1016/j.lwt.2022.113169

11.

Chen

, Knabel

. Multiplex PCR for simultaneous detection of bacteria of the genus Listeria, Listeria monocytogenes, and major serotypes and epidemic clones of L. monocytogenes . Appl Environ Microbiol, 2007; 73:6299–6304; doi: 10.1128/AEM.00961-07

12.

Cunha-Neto

, Carvalho

, Castro

, et al. Salmonella Anatum, S. Infantis and S. Schwarzengrund in Brazilian Cheeses: Occurrence and antibiotic resistance profiles. Int J Dairy Tech, 2020; 73(1):296–300; doi: 10.1111/1471-0307.12636

13.

Dai

, Wu

, Huang

, et al. Prevalence and characterization of Staphylococcus aureus isolated from pasteurized milk in China. Front Microbiol, 2019; 10:641; doi: 10.3389/fmicb.2019.00641

14.

Di Ciccio

, Rubiola

, Panebianco

, et al. Biofilm formation and genomic features of Listeria monocytogenes strains isolated from meat and dairy industries located in Piedmont (Italy). Int J Food Microbiol, 2022; 378:109784; doi: 10.1016/j.ijfoodmicro.2022.109784

15.

Fagnani

, Battaglini

APP

, Beloti

, et al. Points of microbiological contamination in mucarella cheese industries. Brazil J Vet Med, 2013; 35:217–223.

16.

Fox

, Guinee

. Cheese Science and Technology. In Milk and Dairy Products in Human Nutrition ( Park

, Haenlein

GFW

, eds). https://doi.org/10.1002/9781118534168.ch17. Chapter 17. 2013; pp. 357–389.

17.

Frank

, Yousef

. Test for Groups of Microrganisms. In: Standard Methods for the Examination of Dairy Products, 17th ed. (Wehr HM, Frank JK. eds.) American Public Health Association: Washington, DC, 2004, Chapter 8, Section 8.090 and 8.100; pp. 239–242.

18.

Fusco

, Chieffi

, de Angelis

. Fresh pasta filata cheeses: Composition, role, and evolution of the microbiota in their quality and safety. J Dairy Sci, 2022; 105(12):9347–9366; doi: 10.3168/jds.2022-22254

19.

Gasparini

, Amorim

, de Souza Correa

, et al. Psychrotrophs in raw milk: Effect on texture, proteolysis index, and sensory evaluation of smoked provolone cheese. J Sci Food Agric, 2020; 100(8):3291–3296; doi: 10.1002/jsfa.10329

20.

Gérard

, El-Hajjaji

, Niyonzima

, et al. Prevalence and survival of Listeria monocytogenes in various types of cheese—A review. Int J Dairy Technol, 2018; 71(4):825–843; doi: 10.1111/1471-0307.12552

21.

ISO 11290-1. Microbiology of Food and Animal Feeding Stuffs—Horizontal Method for the Detection and Enumeration of Listeria monocytogenes e Part 1: Detection Method. International Organization for Standardization, 1996, Amendment 1; 2004.

22.

ISO 6579. Microbiology of Food and Animal Feeding Stuffs—Horizontal Method for Detection of Salmonella spp. 4th ed. International Organization for Standardization, 2002, Amendment 1: 2007.

23.

ISO 6888-1. Microbiology of Food and Animal Feeding Stuffs—Horizontal Method for the Enumeration of Coagulase-Positive Staphylococci (Staphylococcus aureus and Other Species)—Part 1: Technique Using Baird-Parker Agar Medium. International Organization for Standardization, 1999, Amendment 1; 2003.

24.

HHT

, Dalsgaard

, Andersen

, et al. Large-scale Staphylococcus aureus foodborne disease poisoning outbreak among primary school children. Microbiol Res, 2021; 12(1):43–52; doi: 10.3390/microbiolres12010005

25.

Lembi

MKS

, Liutti

, Sabec

, et al. Microbiological analysis of industrialized mozzarella cheese and conduits to obtain quality in its processing. Braz J Hea Rev, 2020; 3(3):4951–4964; doi: 10.3411/9/bjhrv3n3-078

26.

Marinheiro

, Ghizzi

, Cereser

, et al. Microbiological quality of sliced and block mozzarella cheese. Semin Ciênc Agrár, 2015; 36(3):1329–1334; doi: 10.5433/1679-0359.2015v36n3p1329

27.

Mehrotra

, Wang

, Johnson

. Multiplex PCR for detection of genes for Staphylococcus aureus enterotoxins, exfoliative toxins, toxic shock syndrome toxin 1, and methicillin resistance. J Clin Microb, 2000; 38(3):1032–1035; doi: 10.1128/jcm.38.3.1032-1035.2000

28.

Morton RD. Aerobic Plate Cont. In: Compendium of Methods for the Microbiological Examination of Foods, 4th ed. (Downes FP, Ito K. eds.) American Public Health Association: Washington, DC, Chapter 7, 2001; pp. 63–67.

29.

Nobili

, Franconieri

, Basanisi

, et al. Isolation of Shiga toxin–producing Escherichia coli in raw milk and mozzarella cheese in southern Italy. J Dairy Sci, 2016; 99(10):7877–7880; doi: 10.3168/jds.2016-11613

30.

Oliveira

, Santos

IGC

. Dias BP, et al. Hygienic-health quality and microbiological hazard of clandestine Minas Frescal cheese commercialized in north Tocantins, Brazil. Semin Ciênc Agrár, 2021; 42(2):679–694; doi: 10.5433/1679-0359.2021v42n2p679

31.

Pal

, Mulu

, Tekle

, et al. Bacterial contamination of dairy products. Food Beverage, 2016; 43(9):40–43; doi: 10.3168/jds.2015-9886

32.

Palacios

, Otto

, Flaherty

, et al. Multistate outbreak of Listeria monocytogenes infections linked to fresh, soft hispanic-style cheese—United States, 2021. Morb Mortal Wkly Rep, 2022; 71(21):709; doi: 10.1558/5/mmwr.mm7139a6

33.

Panebianco

, Giarratana

, Caridi

, et al. Lactic acid bacteria isolated from traditional Italian dairy products: Activity against Listeria monocytogenes and modelling of microbial competition in soft cheese. LWT, 2021; 137:110446; doi: 10.1016/j.lwt.2020.110446

34.

Perry

KSP

. Cheeses: chemical, biochemical and microbiological aspects. Quím Nova, 2004; 27:293–300.

35.

Ribeiro Júnior

, Oliveira

, Silva

, et al. The main spoilage-related psychrotrophic bacteria in refrigerated raw milk. J Dairy Sci, 2018; 101(1):75–83; doi: 10.3168/jds.2017-13069

36.

Ribeiro Júnior

, Oliveira

, Silva

, et al. Influence of the microbiological quality of raw milk on the shelf life of the pasteurized milk. Semin Ciênc Agrár, 2019; 40(4):1469–1476; doi: 10.5433/1679-0359.2019v40n4p1469

37.

Ribeiro Júnior

, Rodrigues

, Dias

, et al. Toxigenic characterization, spoilage potential, and antimicrobial susceptibility of coagulase-positive Staphylococcus species isolated from Minas Frescal cheese. J Dairy Sci, 2024; 107(3):1386–1396; doi: 10.3168/jds.2023-23747

38.

Ribeiro Júnior

, Tamanini

, Soares

, et al. Efficiency of boiling and four other methods for genomic DNA extraction of deteriorating spore-forming bacteria from milk. Semin Ciênc Agrár, 2016; 7:3069–3078; doi: 10.5433/1679-0359.2016v37n5p3069

39.

Santana

EHW

, Luiz

, Silva Pasquim

, et al. Psychrotrophic microorganisms in raw milk and the cheese quality. Res Soc Dev, 2020; 9(9):e127997217; doi: 10.3344/8/rsd-v9i9.7217

40.

SAS Institute, Inc. SAS on Demand for Academics. SAS Institute, Inc.: Cary, NC; 2023.

41.

Shanmugasamy

, Velayutham

, Rajeswar

. Inv A gene specific PCR for detection of Salmonella from broilers. Vet World, 2011; 4(12):562; doi: 10.5455/vetworld.2011.562-564

42.

Silva

LHC

, Monteiro

, Beloti

, et al. Use of horse plasma in the coagulase test in Staphylococci isolated from raw milk. Semin Ciênc Agrár, 2005; 26(3):381–385.

43.

Spano

, Goffredo

, Beneduce

, et al. Fate of Escherichia coli O157:H7 during the manufacture of Mozzarella cheese. Lett Appl Microbiol, 2003; 36:73–76; doi: 10.1046/j.1472-765X.2003.01252.x

44.

Volzing

, Borrero

, Sadowsky

, et al. Antimicrobial peptides targeting Gram-negative pathogens, produced and delivered by lactic acid bacteria. ACS Synth Biol, 2013; 2(11):643–650; doi: 10.1021/sb4000367