Isolation,Identification,and Characterization of Bacillus cereus Group Bacteria Isolated from the Dairy Farm Environment and Raw Milk in Tunisia

Abstract

Members of the Bacillus cereus group are well-known opportunistic foodborne pathogens. In this study, the prevalence, hemolytic activity, antimicrobial resistance profile, virulence factor genes, genetic diversity by enterobacterial repetitive intergenic consensus (ERIC)-polymerase chain reaction (PCR) genotyping, and adhesion potential were investigated in isolates from a Tunisian dairy farm environment and raw milk. A total of 200 samples, including bedding, feces, feed, liquid manure, and raw bovine milk, were examined. Based on PCR test targeting sspE gene, 59 isolates were detected. The prevalence of B. cereus group isolates in bedding, feces, liquid manure, feed, and raw milk was 48%, 37.8%, 20%, 17.1%, and 12.5%, respectively. Out of the tested strains, 81.4% showed β-hemolytic on blood agar plates. An antimicrobial resistance test against 11 antibiotics showed that more than 50% of the isolates were resistant to ampicillin and novobiocin, while a high sensitivity to other antibiotics tested was observed in most isolates. The distribution of enterotoxigenic genes showed that 8.5% and 67.8% of isolates carried hblABCD and nheABC, respectively. In addition, the detection rate of cytotoxin K (cytk), enterotoxin T (bceT), and ces genes was 72.9%, 64.4%, and 5.1%, respectively. ERIC-PCR fingerprinting genotype analysis allowed discriminating 40 different profiles. The adhesion potential of B. cereus group on stainless steel showed that all isolates were able to adhere at various levels, from 1.5 ± 0.3 to 5.1 ± 0.1 log colony-forming unit (CFU)/cm² for vegetative cells and from 2.6 ± 0.4 to 5.7 ± 0.3 log CFU/cm² for spores. An important finding of the study is useful for updating the knowledge of the contamination status of B. cereus group in Tunisia, at the dairy farm level.

Introduction

The Bacillus cereus group, also known as Bacillus cereus sensu lato, comprises a growing list of genetically closely related Gram-positive, spore-forming bacterial species (Carroll et al., 2022). The most prominent members are as follows: B. anthracis, B. cereus sensu stricto, B. thuringiensis, B. weihenstephanensis, B. mycoides, B. pseudomycoides, B. cytotoxicus, and B. toyonensis.

Members of the B. cereus group are widely distributed in the environment and commonly isolated from soil, water, air, and plants. Due to the formation of endospores highly resistant to heat, dehydration, and physical stresses, the B. cereus group has a strong possibility to contaminate various raw, heat-treated, and processed food products such as cereal grains, vegetables, meat, seafood, milk, and dairy products (Berthold-Pluta et al., 2019; Biesta-Peters et al., 2016; Gdoura-Ben Amor et al., 2018; Samapundo et al., 2011).

Moreover, the B. cereus group can cause two different types of food poisoning in humans, namely emetic and diarrheal (Granum, 1994). The emetic syndrome is caused by ingesting of a heat-stable cereulide, a nonribosomal peptide synthetase encoded by the ces gene cluster (Ehling-Schulz et al., 2005; Rajkovic et al., 2008).

The diarrheal syndrome is associated with the production of heat-labile enterotoxins (EntS), including hemolysin BL (Hbl), nonhemolytic enterotoxin (Nhe), and cytotoxin K (CytK) (Beecher and Wong, 2000; Fagerlund et al., 2004; Granum et al., 1999; Lund et al., 2000). In addition, enterotoxin FM (EntFM), enterotoxin T (bceT), and EntS have been described as potential diarrheal toxins; however, their role in the development of the disease is not clear (Agata et al., 1995; Choma and Granum, 2002; Hansen et al., 2003).

The B. cereus group has been highlighted as concerns for the dairy environment (Cruz-Facundo et al., 2023; Fusieger et al., 2023; Neokleous et al., 2023). The monitoring of B. cereus group in milk and dairy products is important since it presence can lead to both spoilage and safety problems.

Spores of B. cereus in milk are a source of contamination for milk-derived products, as the spores are resistant to heat treatment. In fact, milk pasteurization processes are not effective in reducing contamination and can instead act as an activator of spore germination. In this regard, it is essential to consider the isolates in raw milk, as many of the dairy products are still made with this milk (Adame-Gómez et al., 2020; Fei et al., 2019; Owusu-Kwarteng et al., 2017). In addition to spore production that the B. cereus group can produce, this process has been considered a possible way that products are systematically contaminated (Christison et al., 2007; Shemesh and Ostrov, 2020).

B. cereus group has been isolated not only from dairy products but also from dairy farms, mainly from feed, cattle feces, bedding, and milking equipment that come into touch with the cows' udders, which can explain its presence in the final product (Tirloni et al., 2022). Therefore, it is crucial to evaluate B. cereus group from the dairy farm, during production and until the product's sale.

To date, there is currently no reported study on the prevalence of B. cereus group in a dairy farm environment in Tunisia. Therefore, the specific objectives of this study were to assess the prevalence, hemolytic activity, antimicrobial resistance profile, virulence factor genes, genetic diversity by enterobacterial repetitive intergenic consensus (ERIC)-polymerase chain reaction (PCR) genotyping and adhesion potential of B. cereus group isolated from a dairy farm environment in Sfax, Tunisia.

Materials and Methods

Sampling

A total of 200 samples, including bedding (n = 50), feces (n = 45), liquid manure (n = 30), feed (n = 35), and raw milk (n = 40), were collected from a local dairy farm in the governorate of Sfax located in the south of Tunisia, from September 2020 to December 2021.

Isolation of presumptive B. cereus group strains

B. cereus group isolation was performed according to Owusu-Kwarteng et al.'s (2017) method.

In brief, 10 g of each sample was homogenized with 90 mL of buffered peptone water containing 5 g/L of lithium chloride. Serial dilutions were prepared, and 0.1 mL of each diluted sample was streaked in MYP agar medium (Oxoid, Basingstoke, UK) and incubated for 24 h at 30°C.

Suspected B. cereus group colonies with pink-orange color surrounded by a precipitation zone were enumerated and a typical colony from each plate was subcultured on BHI-YE agar (Fisher Bioblock, Illkirch, France) and incubated for 24 h at 30°C. These strains were stored at −80°C in glycerol 25% for further identification.

Detection of hemolytic activity

According to Da et al. (2014), a 24-h culture of each isolate was streaked on blood agar plates (Oxoid) and incubated at 30°C for 24–48 h.

Identification of B. cereus group by PCR

Genomic DNA was extracted using the Chelex extraction method as described by Techer et al. (2014). As reported by Kim et al. (2005), B. cereus group was identified by amplification of 71 bp sequence of sspE gene, using the following primers:

sspE1-F (5′-GAAAAAGATGAGTAAAAAACAACAA-3′) and

sspE1-R (5′-CATTTGTGCTTTGAATGCTAG-3′).

The amplification conditions and the composition of the PCR used were described in Gdoura-Ben Amor et al.'s (2018) study.

ERIC-PCR genotyping

For ERIC-PCR, the primer 5′ -ATGTAAGCTCCTGGGGAT TCAC-3′ (Versalovic et al., 1991) was used. The amplification conditions and the composition of the PCR used were described in Gdoura-Ben Amor et al.'s (2018) study.

The comparison between gel patterns was made using the unweighted-pair group method with arithmetic mean/Dice, optimization 1%, and similarity 80%. The data were analyzed with the BioNumerics 6.5 software (BioMerieux, Belgium).

Detection of virulence genes

Confirmed B. cereus group strains were screened by PCR for the presence/absence of EntS and emetic toxin encoding genes. The primers used, their annealing temperatures, and the size of the amplified fragment are shown in Table 1.

Table 1.

Primers Used in the Simplex Polymerase Chain Reaction for the Detection of Virulence Genes in Bacillus cereus Group

Targeted gene	Primer name	Sequence (5′-3′)	Product size (bp)	Annealing temp (°C)	Reference
hblA	HA F HA R	AAGCAATGGAATACAATGGG AGAATCTAAATCATGCCACTGC	1154	56	Guinebretière et al. (2002)
hblB	HA F HB R	AAGCAATGGAATACAATGGG AATATGTCCCAGTACACCCG	2684	58	Guinebretière et al. (2002)
hblC	HC F HC R	GATACTCAATGTGGCAACTGC TTGAGACTGCTCGTCTAGTTG	740	58	Guinebretière et al. (2002)
hblD	HD F HD R	ACCGGTAACACTATTCATGC GAGTCCATATGCTTAGATGC	829	58	Guinebretière et al. (2002)
nheA	NA F NA R	GTTAGGATCACAATCACCGC ACGAATGTAATTTGAGTCGC	755	56	Guinebretière et al. (2002)
nheB	NB F NB R	TTTAGTAGTGGATCTGTACGC TTAATGTTCGTTAATCCTGC	743	54	Guinebretière et al. (2002)
nheC	NC F NC R	TGGATTCCAAGATGTAACG ATTACGACTTCTGCTTGTGC	683	54	Guinebretière et al. (2002)
bceT	bceT-f bceT-r	GCTACGCAAAAACCGAGTGGTG AATGCTCCGGACTATGCTGACG	679	57	Agata et al. (1995)
cytK	CK F CK R	ACAGATATCGG(G,T)CAAAATGC TCCAACCCAGTT(A,T)(G,C) CAGTTC	809	54	Guinebretière et al. (2006)
cytK-1	CK1 F CK1 R	CAATTCCAGGGGCAAGTGTC CCTCGTGCATCTGTTTCATGAG	426	57	Guinebretière et al. (2006)
cytK-2	CK2 F CK2 R	CAATCCCTGGCGCTAGTGCA GTGIAGCCTGGACGAAGTTGG	585	57	Guinebretière et al. (2006)
Ces	EM1F EM1R CesF1 CesR2	GACAAGAGAAATTTCTACGAGCAAGTAAT GCAGCCTTCCAATTACTCCTTCTGCCACAGT GGTGACACATTATCATATAAGGTG GTAAGCGAACCTGTCTGTAACAACA	635 1271	58 58	Ehling-Schulz et al. (2004) Ehling-Schulz et al. (2005)

bceT, enterotoxin T; cytK, cytotoxin K; hbl, hemolysin BL; nhe, nonhemolytic enterotoxin.

The amplification conditions, the composition of the PCR, and positive controls used were based on our previous study (Gdoura-Ben Amor et al., 2019).

Antibiotic susceptibility testing

The Kirby–Bauer disk diffusion method (Bauer et al., 1966) was used. A total of 11 antibiotics (Oxoid) were tested: ampicillin (10 μg), vancomycin (30 μg), gentamicin (10 μg), erythromycin (15 μg), tetracycline (30 μg), ciprofloxacin (5 μg), chloramphenicol (30 μg), novobiocin (30 μg), streptomycin (10 μg), kanamycin (30 μg), and rifampicin (5 μg). The diameter of the inhibition zone was determined according to the CLSI disk diffusion breakpoints of Staphylococcus aureus (CLSI, 2010).

Adhesion on stainless steel

Treatment of stainless-steel coupons

The adhesion test was studied on 2-mm-thick and 15-mm-diameter 304 L stainless-steel coupons (Bretagne Laser, Guer, France). The coupons were treated according to the protocol of Jan et al. (2011), which consisted of immersing the coupons in 2% (v/v) RBS 35 solution (Sigma) followed by a series of rinses with distilled water and autoclaving.

Preparation of spore suspensions

As recommended by Leguerinel et al. (2000), sporulation was induced by adding magnesium sulfate (40 mg/L) and calcium chloride (100 mg/L) in nutrient agar at 30°C. After 5 d of incubation, the culture was harvested, heated for 10 min at 80°, and then centrifuged 3 times at 4000 g for 10 min. The sporal suspensions are stored at 4°C in sterile water until use.

Adhesion test

The adhesion test is performed by adding 300 μL of bacterial (vegetative cells or spores) suspension (10⁶ colony-forming unit [CFU]/mL) in each well. After a 2-h incubation at 30°C, suspensions were eliminated and the coupons maintained in the wells were rinsed with 9 g/L NaCl to remove nonadhering cells.

To detach adherent cell, the coupons were scraped for 1 min after addition of 300 μL of saline at 9 g/L of NaCl and 0.02% of Tween 80 for the vegetative cell and spore adhesion assays, respectively.

The number of adhering cells was then measured after growth on BHI-YE agar at 30°C for 24 h, using a plate counting micromethod (Baron et al., 2006). Tests were done in triplicate and results were expressed as average log CFU per cm².

Statistical analysis

All assays were performed in triplicate, and the results were calculated as the mean ± standard deviation. The statistical significance was carried out using the Excel program. The differences between measurements were considered significant at p < 0.05.

Results

Isolation and identification of bacterial strains

Among the 200 examined samples, 65 were positive for B. cereus group-like strains with an overall prevalence of 32.5%% (Table 1).

PCR test targeting the sspE gene showed that 59 isolates are confirmed to belong to B. cereus group.

As shown in Table 2, the highest number of isolates was found in bedding samples (24/50, 48%), followed by feces (17/45, 37.8%), liquid manure (7/30, 20%), feed (6/35, 17.1%), and raw milk (5/40, 12.5%) samples.

Table 2.

Prevalence of Bacillus cereus Group Bacteria in Local Dairy Farm Samples Collected in Tunisia During the Period from September 2020 to December 2022

	Total no. (%) of samples contaminated by B. cereus group-like organisms	Total no. (%) of samples contaminated by confirmed B. cereus group organisms
Sample sources (total no. of samples)	Conventional culture	PCR test
Bedding (50)	26 (52.0)	24 (48.0)
Feces (45)	19 (42.2)	17 (37.8)
Liquid manure (30)	9 (30.0)	7 (20.0)
feed (35)	6 (17.1)	6 (17.1)
Raw milk (40)	5 (12.5)	5 (12.5)
Total (200)	65 (32.5)	59 (29.5)

PCR, polymerase chain reaction.

The incidence of B. cereus group strains in environmental samples (33.75%) was much higher than for raw milk samples (12.5%).

Hemolytic activity

Out of the 59 confirmed B. cereus group isolates, 48 isolates (81.4%) were found to be β-hemolytic, 7 isolates (11.9%) showed indeterminate hemolytic activity, while the remaining 4 isolates (6.7%) were γ-hemolytic.

ERIC-PCR typing analysis

Considering 80% similarity in band pattern as cutoff criteria, the analysis of the ERIC-PCR profiles allowed to discriminate 40 profiles on a total of 59 tested strains.

As shown in Figure 1, 24 isolates were unclustered, while the remaining 35 isolates were grouped into 16 clusters.

FIG. 1.

ERIC-PCR dendrogram showing the relationship between Bacillus cereus group isolates. The similarities between strains were evaluated using the Dice coefficient and the UPGMA clustering method. Genetic similarity between samples in duplicate is 80%. ERIC, enterobacterial repetitive intergenic consensus; PCR, polymerase chain reaction; UPGMA, unweighted-pair group method with arithmetic mean.

Distribution of virulence factor genes

The distribution of virulence genes among the 59 isolates is shown in Table 3.

Table 3.

Distribution of Enterotoxin and Emetic Toxin Genes in Bacillus cereus Group Strains Isolated from Dairy Farm Environment and Raw Milk in Tunisia

Toxigenic genes	No. (%) of strains positive for target gene(s)
Toxigenic genes	Bedding (n = 24)	Feces (n = 17)	Liquid manure (n = 7)	Feed (n = 6)	Raw milk (n = 5)	Total (n = 59)
HBL gene complexes
hblC	2 (8.3)	2 (11.8)	1 (14.3)	1 (16.7)	0 (0.0)	6 (10.2)
hblD	2 (8.3)	2 (11.8)	1 (14.3)	0 (0.0)	0 (0.0)	5 (8.5)
hblA+ hblC	0 (0.0)	1 (5.8)	0 (0.0)	2 (33.3)	0 (0.0)	3 (5.1)
hblC+ hblD	1 (4.2)	1 (5.8)	2 (28.6)	0 (0.0)	1 (20.0)	5 (8.5)
hblA+ hblC+ hblD	2 (8.3)	3 (17.7)	0 (0.0)	0 (0.0)	0 (0.0)	5 (8.5)
hblB+ hblC+ hblD	2 (8.3)	0 (0.0)	0 (0.0)	0 (0.0)	0 (0.0)	2 (3.3)
hblA+ hblB+ hblC+ hblD	2 (8.3)	1 (5.8)	0 (0.0)	1 (16.7)	1 (20.0)	5 (8.5)
None detected	13 (54.2)	7 (41.2)	3 (42.8)	2 (33.3)	3 (60.0)	28 (47.5)
NHE gene complexes
nheA	1 (4.2)	0 (0.0)	0 (0.0)	0 (0.0)	0 (0.0)	1 (1.7)
nheB	1 (4.2)	1 (5.8)	0 (0.0)	0 (0.0)	0 (0.0)	2 (3.3)
nheA+ nheB	3 (12.5)	2 (11.8)	0 (0.0)	0 (0.0)	1 (5.9)	6 (10.2)
NheA+ nheC	2 (8.3)	1 (5.8)	1 (14.3)	0 (0.0)	1 (20.0)	5 (8.5)
nheB+ nheC	1 (4.2)	1 (5.8)	1 (14.3)	1 (16.7)	1 (20.0)	5 (8.5)
nheA+ nheB+ nheC	16 (66.6)	12 (70.6)	5 (71.4)	5 (83.3)	2 (60.0)	40 (67.8)
None detected	0 (0.0)	0 (0.0)	0 (0.0)	0 (0.0)	0 (0.0)	0 (0.0)
Other genes
cytK	20 (83.3)	12 (70.6)	5 (71.4)	4 (66.6)	2 (20.0)	43 (72.9)
bceT	17 (70.8)	9 (52.9)	7 (100.0)	3 (50.0)	2 (20.0)	38 (64.4)
Ces	0 (0.0)	0 (0.0)	0 (0.0)	0 (0.0)	3 (60.0)	3 (5.1)

bceT, enterotoxin T; cytK, cytotoxin K; HBL, hemolysin BL; NHE, nonhemolytic enterotoxin.

At least one gene of each of the NHE and HBL complexes was detected in 100% and 52.5% of strains, respectively.

For NHE encoding genes, 67.8% (40/59) of isolates were found to harbor simultaneously the nheABC genes, 27.1% (16/59) harbored simultaneously two genes, and 5.1% (3/59) harbored only one gene.

For HBL encoding genes, 18.7% (11/59) possessed only one gene, 13.5% (8/59) possessed simultaneously two genes, 11.8% (7/59) possessed simultaneously three genes, 8.5% (5/59) possessed simultaneously all four hblABCD genes, and 47.5% (28/59) possessed no HBL encoding gene at all.

The cytK gene was present in 72.9% of the strains, but further testing revealed that strains harboring the cytK gene belonged to the cytK-2 variant. The cytK-1 gene was not found in any isolate.

The prevalence of bceT among isolates was 64.4%.

The prevalence of the emetic gene ces among isolates was 5.1%. The emetic gene was only detected in strains isolated from raw milk samples but not from environmental samples.

Antibiotic susceptibility

The results of the antimicrobial tests are presented in Table 4.

Table 4.

Antibiotic Susceptibility of 59 Bacillus cereus Group Strains Isolated from Dairy Farm Environment and Raw Milk in Tunisia

Antibiotics	Conc. (μg/disc)	No. of strains (%)
Antibiotics	Conc. (μg/disc)	Resistant	Intermediate	Susceptible
Rifampicin	5	0	0	59 (100)
Erythromycin	15	3 (5.1)	5 (8.5)	51 (86.4)
Chloramphenicol	30	0	0	59 (100)
Novobiocin	30	30 (50.8)	5 (8.5)	24 (40.7)
Ampicillin	10	32 (54.2)	6 (10.2)	21 (35.6)
Ciprofloxacin	5	0	0	59 (100)
Streptomycin	10	7 (11.9)	0	52 (88.1)
Gentamicin	10	0	0	59 (100)
Vancomycin	30	3 (5.1)	7 (11.9)	49 (83)
Kanamycin	30	0	2 (3.4)	57 (96.6)
Tetracycline	30	9 (15.2)	7 (11.9)	43 (72.9)

More than 50% of the isolates were resistant to ampicillin (54.2%) and novobiocin (50.8%). They were, however, susceptible to other antimicrobials such as rifampicin (100%), chloramphenicol (100%), ciprofloxacin (100%), gentamicin (100%), streptomycin (88.1%), kanamycin (96.6%), erythromycin (86.4%), vancomycin (83%), and tetracycline (72.9%).

Adhesion ability of B. cereus group on stainless steel

All the isolates were able to adhere on stainless steel at various levels. The values recorded are between 1.5 ± 0.3 and 5.1 ± 0.1 log CFU/cm² for vegetative cells and between 2.6 ± 0.4 and 5.7 ± 0.3 log CFU/cm² for spores (Fig. 2).

FIG. 2.

Study of the adhesion capacity of spores and vegetative cells of 59 isolates of the Bacillus cereus group on stainless-steel coupons.

In our study, it appears that 72.9% of the collection had greater attachment to stainless-steel surfaces of spores than vegetative cells of the same strain. For 8.5% of the strains, spores and vegetative cells showed the same adhesion capacity. While for 18.6% of the strains, the vegetative cells showed a higher adhesion than the spores (Fig. 3).

FIG. 3.

Comparison of the adhesion capacity of spores and vegetative cells of 59 Bacillus cereus group isolates.

Discussion

The B. cereus group is considered an important contaminant in the dairy environment and is related to milk quality and safety (Tirloni et al., 2022).

Hence, minimizing B. cereus group transmission at the farm level is crucial, as spores in used bedding (Magnusson et al., 2007) and soil (Christiansson et al., 1999) are major sources of contamination of raw milk via contaminated teats and udder surfaces.

The prevalence of B. cereus group in dairy farm environment varies across studies.

Compared with the prevalence of B. cereus group in our study (29.5%), a higher prevalence was reported by McAuley et al. (2014) and Meng et al. (2022) with 41% and 43%, respectively. Conversely, Fei et al. (2019) reported a lower prevalence (18%), whereas Cui et al. (2016) reported a similar prevalence (28.7%).

The high prevalence founded in bedding samples (48%) is comparable with that recorded by Fei et al. (2019) (40%), whereas Cui et al. (2016) reported a higher prevalence (93.3%).

The low prevalence of B. cereus group was recorded in raw milk samples (12.5%). Compared with our data, a higher prevalence was reported in raw milk samples analyzed by Hammad et al. (2021), Meng et al. (2022), Owusu-Kwarteng et al. (2017), and McAuley et al. (2014) with 85%, 61.11%, 46.6%, and 33%, respectively. Conversely, a lower B. cereus group prevalence in raw milk was reported by Cui et al. (2016) (9.8%) and Fei et al. (2019) (4%).

The low prevalence in raw milk (12.5%) compared with environmental samples (33.75%) is due to the inhibitory action of the natural microflora (lactic acid bacteria) in raw milk (Tirloni et al., 2017) and/or the effective hygienic practices during the milking process.

Hemolytic activity is crucial for assessing bacteria safety (Nwagu et al., 2020), as β-hemolysis indicates the presence of cytotoxic phospholipases (Sorokulova et al., 2008), a hemolytic factor reducing iron availability for the host (Seker et al., 2010).

Similar to our finding, high frequencies (>80%) of hemolytic activity in B. cereus group strains have been reported (Arslan et al., 2014; Chaves et al., 2011; Chica et al., 2020).

In our study, ERIC-PCR genotyping allowed a better assessment of the biodiversity of strains. Our finding is in agreement with Chen et al.'s (2022) study demonstrating the high discriminatory capability of ERIC-PCR.

ERIC-PCR was easier and faster than other molecular typing methods such as pulsed-field gel electrophoresis and ribotyping (Dorneles et al., 2014; Magyar et al., 2019). However, due to its limited repeat capabilities, more accurate methods such as multilocus sequence typing and genomic sequencing may be more informative (Nguyen and Tallent, 2019; Shen et al., 2021; Zhang et al., 2020).

In this study, ERIC-PCR genotyping highlighted that some genetic relatedness is not correlated with sample origins. This diversity could suggest various origins of contamination (Tirloni et al., 2022).

The screening for the presence of virulence factors showed that HBL complex genes were less common than that of the NHE complex with a detection rate of 67.8% and 8.5%, respectively. Similar results of high prevalence of nheABC genes have previously been reported in strains from raw milk, dairy plants, and environmental samples (Lin et al., 2017; Zhao et al., 2020).

Conversely, various studies have reported higher prevalence rates, usually between 40% and 70.6% of the HBL complex in strains from milk and dairy products (Gao et al., 2018; Owusu-Kwarteng et al., 2017; Porcellato et al., 2021).

The cytK gene was present in 72.9% of the strains. A similar occurrence was observed in strains from raw milk, farms, and dairy products (Gao et al., 2018; Owusu-Kwarteng et al., 2017; Zhao et al., 2020). However, our detection rate of cytK is higher than previously reported by Meng et al. (2022).

The prevalence of bceT gene among strains was 64.4%. Although bceT encoded by bceT gene is categorized as a diarrheal EntS, its role in the development of the disease is not clear (Agata et al., 1995; Choma and Granum, 2002; Hansen et al., 2003).

The emetic gene ces was detected in 5.1% of B. cereus group strains isolated from raw milk samples. Previous studies have found a low incidence of ces gene in B. cereus group strains from dairy products (Andersen Borge et al., 2001; Cui et al., 2016; Owusu-Kwarteng et al., 2017; Svensson et al., 2006). However, several studies showed a high prevalence of ces gene among strains isolated from milk, dairy farm environments, and ultra-high-temperature milk processing lines (Cui et al., 2016; Lin et al., 2017; Meng et al., 2022; Owusu-Kwarteng et al., 2017).

Briefly, virulence factors vary across studies due to geographical locations, strain sources, and PCR assay primers, potentially affecting the results.

Antibiotic therapy remains the predominant treatment for B. cereus group infections. However, the emergence of antibiotic-resistant strains due to misuse of antibiotics or the acquisition of resistance genes leads to the failure of antibiotic treatment (Banerjee and Sarkar, 2004). Therefore, in this study, the resistance to antibiotics was determined, and we found that most of the isolates were sensitive to rifampicin, chloramphenicol, ciprofloxacin, gentamicin, streptomycin, kanamycin, erythromycin, vancomycin, and tetracycline, while more than 50% of the isolates were resistant to ampicillin and novobiocin.

Resistance to beta-lactams as well as sensitivity to different groups of antibiotics, including glycopeptides, aminoglycosides, tetracyclines, quinolones, and phenicols, has been reported previously in strains from farm environment, milk, and dairy products (Chang et al., 2021; Gao et al., 2018; Owusu-Kwarteng et al., 2017; Radmehr et al., 2020; Zhao et al., 2020).

The adhesion test showed that 72.9% of the collection had greater attachment to stainless-steel surfaces of spores than vegetative cells of the same strain. This finding is in agreement with the study of Andersson et al. (1998) showing that B. cereus group spores are 33–48% more adherent than vegetative cells.

The high hydrophobicity of spores enables them to adhere to the surfaces of food processing equipment and this can raise hygiene issues in the food industry due to their resistance to cleaning procedures (Andersson et al., 1998; Faille et al., 2010; Peng et al., 2001; Shaheen et al., 2010).

Our study shows that in 18.6% of strains, vegetative cells are more adherent than spores.

The high adhesion of vegetative cells could be attributed to their increased hydrophobicity during the stationary phase, the stage when they are placed in contact with coupons (Peng et al., 2001), as well as to their mobility, as flagella plays a crucial role in adhesion stages (Houry et al., 2010).

Conclusions

To conclude, this study forms the starting point for the control of B. cereus group in dairy products and production plants. The results of our work were useful for updating the knowledge of the contamination status of B. cereus group in Tunisia, especially at the dairy farm level. There is therefore the need to observe good hygienic and manufacturing practice by milk producers and traditional dairy processors to prevent contamination and the subsequent potential disease outbreak by B. cereus group.

Footnotes

Acknowledgments

This work is part of a doctoral thesis by R.B.A. The authors are grateful to all the collaborators in this study. They would like to thank the Ministry of Higher Education and Scientific Research of Tunisia and the European Commission of Erasmus+ program for their financial support.

Authors' Contributions

R.B.A.: conceptualization, methodology, and original draft preparation. M.G.-B.A.: writing—original draft preparation. H.S.: writing—reviewing and editing. N.G.: conceptualization and methodology. S.J.: visualization and investigation. M.G.: supervision and validation. R.G.: writing—reviewing and editing.

Disclosure Statement

No competing financial interests exist.

Funding Information

The 1st author's mobilities in France to carry out this work have been financed by the Ministry of Higher Education and Scientific Research of Tunisia and the European Commission of Erasmus+program.

References

Adame-Gómez

, Munoz-Barrios

, Castro-Alarcón

, et al. Prevalence of the strains of Bacillus cereus group in artisanal Mexican cheese. Foodborne Pathog Dis, 2020; 17(1):8–14; doi: 10.1089/fpd.2019.2673

Agata

, Ohta

, Arakawa

, et al. The bceT gene of Bacillus cereus encodes an enterotoxic protein. Microbiology, 1995; 141(4):983–988; doi: 10.1099/13500872-141-4-983

Andersen Borge

, Skeie

, Sorhaug

, et al. Growth and toxin profiles of Bacillus cereus isolated from different food sources. Int J Food Microbiol, 2001; 69(3):237–246; doi: 10.1016/S0168-1605(01)00500-1

Andersson

, Mikkola

, Helin

, et al. A novel sensitive bioassay for detection of Bacillus cereus emetic toxin and related depsipeptide ionophores. Appl Environ Microbiol, 1998; 64(4):1338–1343; doi: 10.1128/AEM.64.4.1338-1343.1998

Arslan

, Eyi

, Küçüksari

. Toxigenic genes, spoilage potential, and antimicrobial resistance of Bacillus cereus group strains from ice cream. Anaerobe, 2014; 25:42–46; doi: 10.1016/J.ANAEROBE.2013.11.006

Banerjee

, Sakar

. Antibiotic resistance and susceptibility to some food preservative measures of spoilage and pathogenic micro-organisms from spices. Food Microbiol, 2004; 21(3):335–342; doi: 10.1016/S0740-0020(03)00073-X

Baron

, Cochet

, Ablain

, et al. Rapid and cost-effective method for micro-organism enumeration based on miniaturization of the conventional plate-counting technique. Lait, 2006; 86(3):251–257; doi: 10.1051/LAIT:2006005

Bauer

, Kirby

, Sherris

, et al. Antibiotic susceptibility testing by a standardized single disk method. Am J Clin Pathol, 1996; 45(4_ts):493–496; doi: 10.1093/ajcp/45.4_ts.493

Beecher

, Wong

. Tripartite haemolysin BL: Isolation and characterization of two distinct homologous sets of components from a single Bacillus cereus isolate. Microbiology, 2000; 146(6):71–1380; doi: 10.1099/00221287-146-6-1371

10.

Berthold-Pluta

, Pluta

, Garbowska

, et al. Prevalence and toxicity characterization of Bacillus cereus in food products from Poland. Foods, 2019; 8(7):269; doi: 10.3390/foods8070269

11.

Biesta-Peters

E G

, Dissel

, Reij

, et al. Characterization and exposure assessment of emetic Bacillus cereus and cereulide production in food products on the Dutch market. J Food Protect, 2016; 79(2):230–238; doi: 10.4315/0362-028X.JFP-15-217

12.

Carroll

L M

, Cheng R

, Wiedmann

, et al. Keeping up with the Bacillus cereus group: Taxonomy through the genomics era and beyond. Crit Rev Food Sci Nutr, 2022; 62(28):7677–7702; doi: 10.1080/10408398.2021.1916735

13.

Chang

, Xie

, Yang

, et al. The prevalence and characterization of Bacillus cereus isolated from raw and pasteurized buffalo milk in southwestern China. J Dairy Sci, 2021; 104(4):3980–3989; doi: 10.3168/jds.2020-19432

14.

Chaves

, Pires

, Vivoni

. Genetic diversity, antimicrobial resistance and toxigenic profiles of Bacillus cereus isolated from food in Brazil over three decades. Int J Food Microbiol, 2011; 147(1):12–16; doi: 10.1016/J.IJFOODMICRO.2011.02.029

15.

Chen

, Haupert

, Zimmermann

, et al. Global prevalence of post-coronavirus disease 2019 (COVID-19) condition or long COVID: A meta-analysis and systematic review. J Infect Dis, 2022; 226(9):1593–1607; doi: 10.1093/INFDIS/JIAC136

16.

Chica

, Correa

, Aceves-Diez

, et al. Genomic and toxigenic heterogeneity of Bacillus cereus sensu lato isolated from ready-to-eat foods and powdered milk in day care centers in Colombia. Foodborne Pathog Dis, 2020; 17(5):340–347; doi: 10.1089/FPD.2019.2709

17.

Choma

, Granum

. The enterotoxin T (BcET) from Bacillus cereus can probably not contribute to food poisoning. FEMS Microbiol Lett, 2002; 217(1):115–119; doi: 10.1111/J.1574-6968.2002.TB11464.X

18.

Christiansson

, Bertilsson

, Svensson

. Bacillus cereus spores in raw milk: Factors affecting the contamination of milk during the grazing period. J Dairy Sci, 1999; 82(2):305–314; doi: 10.3168/JDS.S0022-0302(99)75237-9

19.

Christison

C A

, Lindsay

, Von Holy

. Cleaning and handling implements as potential reservoirs for bacterial contamination of some ready-to-eat foods in retail delicatessen environments. J Food Protect, 2007; 70(12):2878–2883; doi: 10.4315/0362-028X-70.12.2878

20.

CLSI (Clinical and Laboratory Standards Institute). Performance Standards for Antimicrobial Susceptibility Testing: 20th Informational Supplement. CLSI Document M100–S20. CLSI: Wayne, PA, USA; 2010.

21.

Cruz-Facundo

, Toribio-Jiménez

, Castro-Alarcón

, et al. Bacillus cereus in the artisanal cheese production chain in Southwestern Mexico. Microorganisms, 2023; 11(5):1290; doi: 10.3390/microorganisms11051290

22.

Cui

, Liu

, Dietrich

, et al. Characterization of Bacillus cereus isolates from local dairy farms in China. FEMS Microbiol Lett, 2016; 363(12):fnw096; doi: 10.1093/FEMSLE/FNW096

23.

da Silva Fernandes

, Fujimoto

, Schneid

, et al. Enterotoxigenic profile, antimicrobial susceptibility, and biofilm formation of Bacillus cereus isolated from ricotta processing. Int Dairy J, 2014; 38(1):16–23; doi: 10.1016/j.idairyj.2014.03.009

24.

Dorneles

EMS

, Santana

, Ribeiro

, et al. Evaluation of ERIC-PCR as genotyping method for corynebacterium pseudotuberculosis isolates. PLoS One, 2014; 9(6):e98758; doi: 10.1371/JOURNAL.PONE.0098758

25.

Ehling-Schulz

, Fricker

, Scherer

. Identification of emetic toxin producing Bacillus cereus strains by a novel molecular assay. FEMS Microbiol Lett, 2004; 232(2):189–195; doi: 10.1016/S0378-1097(04)00066-7

26.

Ehling-Schulz

, Vukov

, Schulz

, et al. Identification and partial characterization of the nonribosomal peptide synthetase gene responsible for cereulide production in emetic Bacillus cereus . Appl Environ Microbiol, 2005; 71(1):105–113; doi: 10.1128/AEM.71.1.105-113.2005

27.

Faille

, Sylla

, Le Gentil

, et al. Viability and surface properties of spores subjected to a cleaning-in-place procedure: Consequences on their ability to contaminate surfaces of equipment. Food Microbiol, 2010; 27(6):769–776; doi: 10.1016/J.FM.2010.04.001

28.

Fagerlund

, Ween

, Lund

, et al. Genetic and functional analysis of the cytK family of genes in Bacillus cereus . Microbiology, 2004; 150(8):2689–2697; doi: 10.1099/mic.0.26975-0

29.

Fei

, Yuan

, Zhao

, et al. Prevalence and genetic diversity of Bacillus cereus isolated from raw milk and cattle farm environments. Curr Microbiol, 2019; 76:1355–1360; doi: 10.1007/s00284-019-01741-5

30.

Fusieger

, Russo

, Nero L

, et al. Emulsifying salts and P2O5 content as promising strategies to control Bacillus cereus growth during storage of processed cheese. Int J Dairy Technol, 2023; doi: 10.1111/1471-0307.13023

31.

Gao

, Ding

, Wu

, et al. Prevalence, virulence genes, antimicrobial susceptibility, and genetic diversity of Bacillus cereus isolated from pasteurized milk in China. Front Microbiol, 2018; 9:533; doi: 10.3389/FMICB.2018.00533/BIBTEX

32.

Gdoura-Ben Amor

, Jan

, Baron

, et al. Toxigenic potential and antimicrobial susceptibility of Bacillus cereus group bacteria isolated from Tunisian foodstuffs. BMC Microbiol, 2019; 19(1):1–12; doi: 10.1186/S12866-019-1571-Y

33.

Gdoura-Ben Amor

, Siala

, Zayani

, et al. Isolation, identification, prevalence, and genetic diversity of Bacillus cereus group bacteria from different foodstuffs in Tunisia. Front Microbiol, 2018; 9:447; doi: 10.3389/fmicb.2018.00447

34.

Granum

. Bacillus cereus and its toxins. J Appl Bacteriol, 1994; 76(S23):61S–66S; doi: 10.1111/J.1365-2672.1994.TB04358.X

35.

Granum

, O'sullivan

, Lund

. The sequence of the non-haemolytic enterotoxin operon from Bacillus cereus . FEMS Microbiol Lett, 1999; 177(2):225–229; doi: 10.1111/j.1574-6968.1999.tb13736.x

36.

Guinebretière

, Broussolle

, Nguyen-The

. Enterotoxigenic profiles of food-poisoning and food-borne Bacillus cereus strains. J Clin Microbiol, 2002; 40(8):3053–3056; doi: 10.1128/JCM.40.8.3053-3056.2002

37.

Hammad

A M

, Eltahan

, Khalifa

, et al. Toxigenic potential of Bacillus cereus strains isolated from retail dairy products in Egypt. Foodborne Pathog Dis, 2021; 18(9):655–660; doi: 10.1089/fpd.2020.2920

38.

Hansen

, Høiby

, Jensen

, et al. The Bacillus cereus bceT enterotoxin sequence reappraised. FEMS Microbiol Lett, 2003; 223(1):21–24; doi: 10.1016/S0378-1097(03)00249-0

39.

Houry

, Briandet

, Aymerlch

, et al. Involvement of motility and flagella in Bacillus cereus biofilm formation. Microbiology, 2010; 156(4):1009–1018; doi: 10.1099/MIC.0.034827-0

40.

Jan

, Brunet

, Techer

, et al. Biodiversity of psychrotrophic bacteria of the Bacillus cereus group collected on farm and in egg product industry. Food Microbiol, 2011; 28(2):261–265; doi: 10.1016/J.FM.2010.05.029

41.

Kim

, Seo

, Wheeler

, et al. Rapid genotypic detection of Bacillus anthracis and the Bacillus cereus group by multiplex real-time PCR melting curve analysis. FEMS Immunol Med Microbiol, 2005; 43(2):301–310; doi: 10.1016/j.femsim.2004.10.005

42.

Leguerinel

, Couvert

, Mafart

. Relationship between the apparent heat resistance of Bacillus cereus spores and the pH and NaCl concentration of the recovery medium. Int J Food Microbiol, 2000; 55(1–3):223–227; doi: 10.1016/S0168-1605(00)00175-6

43.

Lin

, Story

, Walker

, et al. Role of pH and ionic strength in the aggregation of TiO2 nanoparticles in the presence of extracellular polymeric substances from Bacillus subtilis . Environ Pollut, 2017; 228:35–42; doi: 10.1016/J.ENVPOL.2017.05.025

44.

Lund

, De Buyser

, Granum

. A new cytotoxin from Bacillus cereus that may cause necrotic enteritis. Mol Microbiol, 2000; 38(2):254–261; doi: 10.1046/j.1365-2958.2000.02147.x

45.

Magnusson

, Svensson

, Kolstrup

, et al. Bacillus cereus in free-stall bedding. J Dairy Sci, 2007; 90(12):5473–5482; doi: 10.3168/jds.2007-0284

46.

Magyar

, Gyuris É, Ujvári

, et al. Genotyping of Riemerella anatipestifer by ERIC-PCR and correlation with serotypes. Avian Pathol, 2019; 48(1):12–16; doi: 10.1080/03079457.2018.1535693

47.

Mcauley

, McMillan

, Moore

, et al. Prevalence and characterization of foodborne pathogens from Australian dairy farm environments. J Dairy Sci, 2014; 97(12):7402–7412; doi: 10.3168/jds.2014-8735

48.

Meng

, Zhang

, Dong

, et al. Characterization and spoilage potential of Bacillus cereus isolated from farm environment and raw milk. Front Microbiol, 2022; 13:940611; doi: 10.3389/FMICB.2022.940611

49.

Neokleous

, Tarapata

, Papademas

. Nonthermal turbulent flow ultraviolet-C (UV-C) radiation processing for cheese whey-brines purification. Int J Dairy Technol, 2022; 5(3):710–716; doi: 10.1111/1471-0307.12883

50.

Nguyen

, Tallent

. Screening food for Bacillus cereus toxins using whole genome sequencing. Food Microbiol, 2019; 78:164–170; doi: 10.1016/J.FM.2018.10.008

51.

Nwagu

, Dibia

SIC

, Odo

. Community readiness for drug abuse prevention in two rural communities in Enugu State, Nigeria. SAGE Open Nurs, 2020; 6:2377960820963758; doi: 10.1177/2377960820963758

52.

Owusu-Kwarteng

, Wuni

, Akabanda

, et al. Prevalence, virulence factor genes and antibiotic resistance of Bacillus cereus sensu lato isolated from dairy farms and traditional dairy products. BMC Microbiol, 2017; 17(1):1–8; doi: 10.1186/S12866-017-0975-9

53.

Peng J

Sen

, Tsai

, Chou

. Surface characteristics of Bacillus cereus and its adhesion to stainless steel. Int J Food Microbiol, 2001; 65(1–2):105–111; doi: 10.1016/S0168-1605(00)00517-1

54.

Porcellato

, Skeie

, Mellegård

, et al. Characterization of Bacillus cereus sensu lato isolates from milk for consumption; phylogenetic identity, potential for spoilage and disease. Food Microbiol, 2021; 93:103604;.doi: 10.1016/J.FM.2020.103604

55.

Radmehr

, Zaferanloo

, Tran

, et al. Prevalence and characteristics of Bacillus cereus group isolated from raw and pasteurised milk. Curr Microbiol, 2020; 77:3065–3075; doi: 10.1007/s00284-020-02129-6

56.

Rajkovic

, Uyttendaele

, Vermeulen

, et al. Heat resistance of Bacillus cereus emetic toxin, cereulide. Lett Appl Microbiol, 2008; 46(5):536–541; doi: 10.1111/j.1472-765X.2008.02350.x

57.

Samapundo

, Heyndrickx

, Xhaferi

, et al. Incidence, diversity and toxin gene characteristics of Bacillus cereus group strains isolated from food products marketed in Belgium. Int J Food Microbiol, 2011; 150(1):34–41; doi: 10.1016/j.ijfoodmicro.2011.07.013

58.

Seker

, Ustaalioĝlu

BBO

, Bilici

, et al. Eight-cycle rituximab therapy resulted in complete remission in primary cutaneous marginal zone lymphoma. Leuk Res, 2010; 34(7):e160–e163; doi: 10.1016/J.LEUKRES.2010.02.013

59.

Shaheen

, Svensson

, Andersson

, et al. Persistence strategies of Bacillus cereus spores isolated from dairy silo tanks. Food Microbiol, 2010; 27(3):347–355; doi: 10.1016/J.FM.2009.11.004

60.

Shemesh

, Ostrov

. Role of Bacillus species in biofilm persistence and emerging antibiofilm strategies in the dairy industry. J Sci Food Agric, 2020; 100(6):2327–2336; doi: 10.1002/jsfa.10285

61.

Shen

, Jia

, Dang

, et al. StrucGP: De novo structural sequencing of site-specific N-glycan on glycoproteins using a modularization strategy. Nat Methods, 2021; 18(8):921–929; doi: 10.1038/S41592-021-01209-0

62.

Sorokulova

, Pinchuk

, Denayrolles

, et al. The safety of two Bacillus probiotic strains for human use. Dig Dis Sci, 2008; 53:954–963; doi: 10.1007/S10620-007-9959-1

63.

Svensson

, Monthán

, Shaheen

, et al. Occurrence of emetic toxin producing Bacillus cereus in the dairy production chain. Int Dairy J, 2006; 16(7):740–749; doi: 10.1016/J.IDAIRYJ.2005.07.002

64.

Techer

, Baron

, Delbrassinne

, et al. Global overview of the risk linked to the Bacillus cereus group in the egg product industry: Identification of food safety and food spoilage markers. J Appl Microbiol, 2014; 116(5):1344–1358; doi: 10.1111/jam.12462

65.

Tirloni

, Ghelardi

, Celandroni

, et al. Bacillus cereus in fresh ricotta: Comparison of growth and Haemolysin BL production after artificial contamination during production or post processing. Food Control, 2017; 79:272–278; doi: 10.1016/J.FOODCONT.2017.04.008

66.

Tirloni

, Stella

, Celandroni

, et al. Bacillus cereus in dairy products and production plants. Foods, 2022; 11(17):2572; doi: 10.3390/FOODS11172572

67.

Versalovic

, Koeuth

, Lupski

. Distribution of repetitive DNA sequences in eubacteria and application to finerpriting of bacterial enomes. Nucleic Acids Res, 1991; 19(24):6823–6831; doi: 10.1093/NAR/19.24.6823

68.

Zhang

, Chen

, Yu

, et al. Prevalence, virulence feature, antibiotic resistance and MLST typing of Bacillus cereus isolated from retail aquatic products in China. Front Microbiol, 2020; 11:1513; doi: 10.3389/FMICB.2020.01513

69.

Zhao

, Chen

, Fei

, et al. Prevalence, molecular characterization, and antibiotic susceptibility of Bacillus cereus isolated from dairy products in China. J Dairy Sci, 2020; 103(5):3994–4001; doi: 10.3168/JDS.2019-17541