Possibility of Vertical Transmission of Sarcocystis spp. in Sika Deer in Japan

Abstract

In recent years, the wild deer population in Japan has grown exponentially, causing severe feeding damage to the agricultural and forestry industries. Therefore, the game meat industry is being promoted for effective utilization of hunted animals. Wild animals are not hygienically controlled and can serve as reservoirs for pathogenic microorganisms. However, epidemiological information on wild animals in Japan remains insufficient. Recently, food poisoning-like cases have occurred because of raw venison infection with Sarcocystis spp. As the prevalence of Sarcocystis spp. in sika deer is very high in Japan and even fawns are infected, this study attempted to verify the vertical infection of Sarcocystis spp. in sika deer in Japan. Genetic detection of Sarcocystis 18S ribosomal RNA in fetal and maternal tissues from early to late gestation in sika deer revealed Sarcocystis Types 1–5 and Sarcocystis fayeri in the mother and fetus. Types 1, 2, 4, and 5 were detected in the maternal tissues of Ezo sika deer (Cervus nippon yesoensis) in Hokkaido, whereas Types 1 and 2 and S. fayeri were detected in fetuses. Types 1–5 were detected in Honshu sika deer (Cervus nippon centralis) in Mie Prefecture but not in the fetuses. Types 1, 2, and 4 were detected in the udder and milk samples. This indicates that Sarcocystis Types 1 and 2 and S. fayeri have the ability to pass through the placenta of sika deer and invade fetal tissues and Types 1, 2, and 4 may be transmitted orally via milk. These findings suggest that there is transplacental and transmammary transmission of Sarcocystis spp. in sika deer.

Introduction

As a countermeasure against damage to farms and forests caused by wild animals, the Ministry of Environment issued the “Protection and control of wild birds and mammals and hunting management law” to promote hunting in order to control wildlife populations (https://www.env.go.jp/en/nature/biodiv/wp_pha.html). The Ministry of Health, Labor and Welfare established “Guidelines on the hygienic management of wild meat” in November 2014 to promote the game meat industry for the effective use of hunted animals (Kojima, 2020). However, owing to a lack of understanding of game meat hygiene, a number of cases of food poisoning have been reported in Japan (Kadohira et al., 2019).

Food poisoning-like symptoms due to venison infected with Sarcocystis spp. were reported from 2011 (Aoki et al., 2017; Aoki et al., 2013; Inomata et al., 2020). The presence of Sarcocystis spp. in venison is alarming because the same genus, Sarcocystis fayeri, has been reported as a new foodborne pathogen in Japan (Dubey et al., 1977; Kamata et al., 2014; Saito, 2012).

Sarcocystis is a two-host protozoan that requires intermediate and definitive hosts. When sporocysts excreted from the definitive host are orally ingested by the intermediate host, sporozoites emerge from the sporocysts in the intestinal endothelial cells, followed by schizogony in capillary endothelial cells throughout the body. Young cysts appear in the muscle and spherical mother cells called metrocytes emerge within the cysts. Metrocytes produce bradyzoites, which fill the cyst and enter the maturation stage. The definitive host is infected by feeding on mature cysts in the intermediate host and sexual reproduction begins immediately in the intestinal tissues of the definitive host. Young gametocytes appeared within the mucosal lining of the small intestine, and macrogametes and postfertilization zygotes were observed. When sporocysts are formed inside the subsequently emerged oocysts, sporocysts that have completed spore formation are excreted in the feces of the definitive host, thus completing their life cycle (Dubey et al., 2015).

Epidemiological studies on sika deer in Japan have shown that Sarcocystis spp. parasitize with a high prevalence (Matsuo et al., 2016; Matsuo et al., 2014; Yamazaki et al., 2023). Considering the mode of transmission, oral infection via sporocyst-contaminated grass and water, which is not consistent with the high prevalence in fawns under one year of age during the suckling period (Dmitriev and Ernst, 1989; Dubey et al., 2015; Yamazaki et al., 2023), the possibility of vertical infection by Sarcocystis spp. in sika deer in Japan has been inferred.

This study explored vertical infection of the genus Sarcocystis in sika deer. It is important to clarify the dynamics of Sarcocystis spp. in sika deer to control Sarcocystis infection in sika deer and ensure safe game meat distribution.

Materials and Methods

Samples

The samples used in this study were 17 sets of mother and fetus samples from Ezo sika deer (Cervus nippon yesoensis) and Honshu sika deer (Cervus nippon centralis) that were legally hunted in Hokkaido and Mie Prefecture, Japan. Since these individuals were captured for human consumption, maternal skeletal muscle was used for meat and fetuses in utero, which were not eligible for human consumption, were used as samples. Five individuals (6, 11, 15–17) were determined to be ineligible for meat consumption because of their status at the time of capture; therefore, their skeletal muscles were used in this study. The samples included skeletal muscle, fetuses, placenta, amniotic fluid, allantoic fluid, blood, udders, and milk. Fetal samples included skeletal muscle, blood, kidneys, and feces. Fetus and mother specimens were collected between December 2016 and June 2018 and udder tissue and milk samples were collected between May and September 2017. All the specimens were delivered to Iwate University within 48 h of capture at 4°C.

DNA extraction

Ten grams of skeletal muscle tissues, placenta, udder, kidney, stomach contents, and feces were homogenized in 30 mL of phosphate-buffered saline for 1 min at 5000 rpm using an Excel Auto Homogenizer (Nihonseiki Kaisha Ltd., Tokyo, Japan). Genomic DNA was extracted from 200 µL of the homogenate using Qiagen DNeasy Blood & Tissue Kits (Qiagen, Hilden, Germany), in accordance with the manufacturer’s protocol.

Blood (200 µL), amniotic fluid, allantoic fluid, and milk were also used for genomic DNA extraction using a Qiagen Dneasy Blood & Tissue Kit (Qiagen). Genomic DNA samples were stored at −80°C.

Nested PCR for the Sarcocystis spp. 18S ribosomal RNA gene

A 1760 bp DNA fragment of the 18S ribosomal RNA (18S rRNA) gene of the genus Sarcocystis was amplified by the first nested polymerase chain reaction (PCR) method using the Takara EX Taq kit (Takara Bio Inc., Shiga, Japan) with the following primers: forward, 5′-AGCCATGCATGTCTAAGTATAAG-3′ reverse, 5′-TTCCTCTAAGTGTTAAGGTTCAC-3′ (Table 1). The DNA templates (1 µL) were added to 19 µL reaction mixture containing 2 µL of 10×Ex Taq Buffer, 1.6 µL of each dNTP (2.5 mM), 0.4 µL of each primer (10 mM), 0.1 µL of 5 U/µL Takara Ex Taq, and 14.5 µL H₂O. The following cycling parameters were used: initial denaturation at 94°C for 3 min; 40 cycles of 94°C for 30 s, 54°C for 30 s, and 72°C for 90 s; and final extension at 72°C for 5 min.

Table 1.

Oligonucleotide Sequences Used in This Study

Name	Sequence (5′→3′)	Nucleotide position	Purpose
Sarcocystis 18S F	AGCCATGCATGTCTAAGTATAAG	46–68	First nested PCR
Sarcocystis 18S R	TTCCTCTAAGTGTTAAGGTTCAC	1778–1800	First nested PCR
Sarcocystis sp. 18S Fw	CTGGAAGCAATCAGTCCGCC	667–686	Second nested PCR
Sarcocystis sp. 18S Rv	TTCAACAACTTGTTGGATGCATC	1528–1550	Second nested PCR
Internal 1 forward	CGCGGGTAATTCCAGCTCCAA	529–548	Internal primer 1 for sequencing
Internal 1 reverse	CTGCTGGCACCAGACTTGC	509–527	Internal primer 1 for sequencing
Internal 2 forward	GCCTGCGGCTTAATTTGACTC	1147–1167	Internal primer 2 for sequencing
Internal 2 reverse	ATGCACCACCATAGAATC	1230–1251	Internal primer 2 for sequencing

The second nested PCR procedure was performed using the following primers: forward, 5′-CTGGAAGCAATCAGTCCGCC-3′ reverse, 5′-TTCAACAACTTGTTGGATGCATC-3′ (Table 1). The first nested PCR amplicon (1 µL) was added to a 19-µL reaction mixture composed of the same reagents as the first nested PCR procedure. The cycling parameters were the same as those used for the first nested PCR procedure.

The PCR products were subjected to agarose gel electrophoresis and 1760- or 900-bp PCR products were separated and visualized under UV light after staining with GRG-1000 (BIO CRAFT, Tokyo, Japan).

Sequencing of Sarcocystis spp. 18S rRNA gene by TA-cloning

A 1760 bp or 900 bp band was cut out from the agarose gel after electrophoresis to extract the target gene fraction using NucleoSpin Gel and PCR Clean-up (Takara Bio Inc.). Purified nested PCR products (1 µL) were added to 4 µL of reaction mixture containing 1 µL of T-Vector pMD20 and 3 µL of dH₂O and then mixed thoroughly with 5 µL of DNA Ligation Kit <Mighty Mix> (Takara Bio Inc.). After incubation for 15 min at 50°C, the reaction solution was added to 50 µL of Escherichia coli DH5α competent cells (Takara Bio, Inc.). The microcentrifuge tube was gently flicked to mix the contents and then placed on ice for 30 min. Competent cells were transformed by heat shock for 45 s in a water bath at 42°C and then immediately returned to ice for 1 min. Super-optimal broth with catabolite repression medium (890 µL) was added to the tube and incubated for 1 h at 37°C with shaking. Transformation cultures (100 µL) were plated on Lysogeny broth (LB)/ampicillin (final concentration: 100 µg/mL)/IPTG/X-Gal plates and incubated overnight at 37°C. Five white colonies were isolated and incubated overnight in LB/ampicillin broth (final concentration: 100 µg/mL) at 37°C. The plasmid vector was extracted using a FastGene ^TM Plasmid Mini Kit (Nippon Genetics Co., Ltd., Tokyo, Japan). Five clones were sequenced using the BigDye Terminator v3.1 Cycle Sequencing Kit and an Applied Biosystems 3500 Series Genetic Analyzer (Thermo Fisher Scientific, Tokyo, Japan).

Two sets of internal primers were designed to sequence the 1760 bp 18S rRNA sequence. The oligonucleotide sequences are listed in Table 1. The sequencing reaction was conducted in a 10 µL volume, including 2 µL of 5× sequence buffer, 0.5 µL of Big Dye v3.1, 3.2 pmol of sequencing primers, 20 ng of PCR product followed by 96°C heat reaction for 60 s, 25 cycles of 96°C for 10 s, and 50°C for 5 s before extension at 60°C for 4 min. The nucleotide sequence of Sarcocystis 18S rRNA from each clone was subjected to the BLAST program of the National Center for Biotechnology Information (NCBI) (https://blast.ncbi.nlm.nih.gov/Blast.cgi) for species identification.

Phylogenetic analyses by the Sarcocystis spp. 18S rRNA gene sequence

Sequences of Sarcocystis sp. 18S rRNA from this study and reference sequence of closely related Sarcocystis species from Gen Bank NCBI database (https://www.ncbi.nlm.nih.gov/) were aligned using ClustalW integrated into MEGA11 (Tamura et al., 2021). A phylogenetic tree was constructed using the maximum likelihood method based on the selected best-fit nucleotide substitution model (Hasegawa-Kiyono-Yano+G + I model) defined in MEGA 11 (Nei and Kumar, 2000; Tamura et al., 2021) and was tested using a bootstrap test with 200 replicates (Pattengale et al., 2010).

Results

Prevalence of Sarcocystis spp. in the maternal and fetal tissues of sika deer

Nested PCR for the Sarcocystis spp. 18S rRNA gene showed positive results for 11 maternal samples and 7 fetal samples from 17 samples (Table 2).

Table 2.

Prevalence of Sarcocystis spp. in the Maternal and Fetal Tissues of Sika Deer in Japan

Area	Sample	Number of the sample
Area	Sample	Tested	Positive	Double positive
Hokkaido	Maternal	17	11	5
Hokkaido	Fetal	17	7	5
Mie	Maternal	4	4	0
Mie	Fetal	4	0	0

In most cases, one examined tissue sample from a single animal was positive (e.g., maternal: 1, 7, 8, 15–17, fetal: 1–3, 10), followed by two tissue samples (maternal: 2, 4, 11; fetal: 7–9); most tissue samples were positive in only a few cases (maternal: 3, 6) (Supplementary Data S2). Five of the 17 samples were double-positive, showing a positive PCR signal in both the maternal and fetal tissues (Table 2).

Identification of Sarcocystis spp. by 18S rRNA gene sequence

The Sarcocystis-positive samples were classified into five types (Types 1–5) and S. fayeri based on 18S rRNA sequence homology using BLAST (Table 3, Supplementary Data S1) (Abe et al., 2019; Yamazaki et al., 2023).

Table 3.

Detection of Sarcocystis spp. in the Samples of Sika Deer Showing Positive Responses on Nested PCR

Sample no.	Area	Origin of tissue	Sarcocystis identified
1	Hokkaido	Maternal	Type 2
1		Fetal	Type 1
2		Maternal	Type 1 ^a, Type 2
2		Fetal	Type 1
3		Maternal	Type 1, Type4
3		Fetal	Type 2
4		Maternal	Type 1, Type 2, Type 5
4		Fetal	—
7		Maternal	Type 2
7		Fetal	Type 2, S. fayeri
8		Maternal	Type 2
8		Fetal	Type 1, Type 2
9		Maternal	—
9		Fetal	Type 1
10		Maternal	—
10		Fetal	Type 1, Type 2
11		Maternal	Type 1, Type 4
11		Fetal	—
6	Mie	Maternal	Type 1, Type 2
6		Fetal	—
15		Maternal	Type 4
15		Fetal	—
16		Maternal	Type 4
16		Fetal	—
17		Maternal	Type 3
17		Fetal	—

Bold-type shows common species both in maternal and fetal specimens.

Types 1–5 were detected in the samples originating from the maternal tissues (skeletal muscle: 6, 11, 15–17; placenta: 2, 3, 6, 11; blood: 1–3, 6; amniotic fluid: 3, 4, 6, 8; and allantoic fluid: 4, 7) and Types 1, 2 and S. fayeri were detected in fetal specimens (skeletal muscle: 1, 3, 8–10; blood: 2, 7; feces: 7, 9; and kidney: 8) (Table 3, Table 4, and Supplementary Data S2). Type 1 was the most frequently detected type in fetuses. In most paired maternal/fetal samples, multiple Sarcocystis species were detected in tissues from a single animal (Supplementary Data S1).

Table 4.

Detection of Sarcocystis spp. in the Maternal and/or Fetal Samples Showing Double-Positive Responses on Nested PCR

Origin of sample	Sample no.
Origin of sample	1	2	3	7	8
Maternal
Skeletal muscle	Type 2
Placenta		Type 1 ^a	Type 1, Type 4
Blood		Type 1, Type 2	Type 4
Amniotic fluid			Type 1		Type 2
Allantoic fluid				Type 2
Fetal
Skeletal muscle	Type 1		Type 2		Type 1
Blood		Type 1		S. feyeri
Feces				Type 2
Kidney					Type 2

Bold-type shows the common species both in maternal and fetal specimens.

Phylogenetic analyses by the Sarcocystis 18S rRNA gene sequence

The following four clusters were formed in a phylogenetic tree, including each Sarcocystis type; Cluster 1 (C1), Type 1; Cluster 2 (C2), Type 2; Cluster 3 (C3), Types 3–5; Cluster 4 (C4), S. fayeri (Fig. 1).

FIG. 1.

Phylogenetic analyses based on Sarcocystis 18S rRNA gene sequence. A phylogenetic tree was constructed based on the Sarcocystis 18S rRNA sequence obtained in this study and the sequences of closely related species. White circles indicate species derived from maternal samples, black circles indicate species derived from fetuses, and triangles indicate species derived from udder tissue and milk. The phylogenetic tree was classified into four clusters (C1–C4); C1, Type 1; C2, Type 2; C3: Types 3–5, and C4: S. fayeri. C1 and C2 included species derived from both maternal and fetal samples, whereas C3 and C4 included only species derived from maternal samples.

C1 and C2 contained Sarcocystis spp. detected from both the mother and fetus, whereas C3 and C4 contained only Sarcocystis spp. detected from the mother.

Detection of Sarcocystis in the udder tissue and milk

Among the 24 pairs of samples, one udder sample and two milk samples were Sarcocystis positive (Table 5). Types 1, 2, and 4 were detected in udder tissue and milk (Table 4, Supplementary Data S3).

Table 5.

Identification of Sarcocystis spp. from Udder Tissue and Milk Based on18S rRNA Gene Sequencing

Area	Sample	Number of the sample		Sarcocystis species
Area	Sample	Tested	Positive	Sarcocystis species
Hokkaido	Udder tissue	24	1	Type 1
Hokkaido	Milk	24	2	Type 1, Type 2, Type 4

Discussion

The high prevalence of Sarcocystis infection in sika deer (Cervus nippon) has become a problem for the game meat industry in Japan. In this study, Sarcocystis Types 1–5 and S. fayeri were detected in fetal and maternal tissues and milk.

Sarcocystis is ubiquitous in cervids and numerous species of Sarcocystis have been detected and named (Dubey et al., 2015). Among them, coinfection with Sarcocystis spp. in sika deer has been reported both in Japan and internationally, and the present findings support this fact (Abe et al., 2019; Prakas et al., 2023). Considering that Sarcocystis spp. have been detected in the maternal skeletal muscle, placenta, blood, amniotic fluid, allantoic fluid, fetal skeletal muscle, blood, feces, kidney, udder tissue, and milk, it is suggested that the transmission of Sarcocystis spp. from the mother to the fawn occurs through the placenta. Since tachyzoites of Toxoplasma gondii, a protozoan similar to Sarcocystis, may cross the placenta and enter fetal circulation and fetal tissues, transmammary T. gondii transmission in several host species, including ruminants as intermediate hosts, has been reported (Powell et al., 2001; Tenter et al., 2000). Sarcocystis spp. in the maternal blood may consistently enter the fetal blood via the placenta and reach the muscles and Sarcocystis spp. in milk enter the fawn orally after birth. Amniotic fluid in the early stages of gestation is attributed to the leakage of maternal and fetal plasma (Cho et al., 2007; Nalls et al., 2013). This suggests that Sarcocystis spp. in the maternal blood migrate to the amniotic fluid and enter the fetus when the fetus swallows amniotic fluid (Grassi et al., 2005; Harding et al., 1984). This can be inferred from the fact that Sarcocystis spp. has been detected in fetal feces and allantoic fluid containing fetal urine (Ross and Nijland, 1998).

Sarcocystis was detected in the fetus but not in the mother in some sample pairs (9, 10) in this study. As the samples in this study were derived from individuals captured for human consumption, placenta, blood, amniotic fluid, and allantoic fluid other than skeletal muscle, which is eligible for meat, were used as the main maternally derived samples. As shown in results no. 15–17 of this study, there were cases in which only skeletal muscle was Sarcocystis positive and other samples were negative, suggesting that the prevalence may differ considerably between skeletal muscle and other tissues, even when derived from the same animal (Supplementary Data S2). Therefore, 10 samples (no. 1, 4, 5, 7–10, 12–14) that were not examined in skeletal muscle in this study may also have been positive (Supplementary Data S2). It is also possible that sample pairs 1, 3, and 7–10, in which the same species as in the fetus was not detected in maternal tissue, would have had the same species when the maternal skeletal muscle was examined (Table 4, Supplementary Data S2). These findings suggest that skeletal muscle is an important sample for epidemiological studies of Sarcocystis.

Sarcocystis Types 3–5 were detected only in the mother but not in the fetus. This suggests the ability of Sarcocystis spp. to pass through the placenta The bradyzoites of Sarcocystis spp. have been reported to vary in size among species (Dubey et al., 2015). Since Type 4 was also detected in milk, it is possible that sika deer in Japan are infected with Types 1 and 2 during gestation and with Type 4 via milk after birth. Fawns and young deer may be infected with Types 3 and 5 by ingesting grass or water contaminated with sporocysts shed by the definitive host. However, the sample size of this study was insufficient to determine the route of transmission and a larger sample size needs to be examined. Sarcocystis spp. were detected in the early and mid-gestation periods of sika deer and there was no temporal gradient, suggesting that maternal-fetal Sarcocystis spp. do not grow or multiply uniformly. However, this may simply represent individual variation of frequency in Sarcocystis placental passage, since the study sample did not follow a single mother and fetus pair but rather captured a different pair each time.

Schizonts of Sarcocystis tenella have been detected in the brain, lungs, and placenta of stillborn lambs, suggesting that S. tenella may be vertically transmitted in sheep (Agerholm and Dubey, 2014). However, because this molecular study did not identify the life stages of Sarcocystis spp. in fetal tissues, it is difficult to determine Sarcocystis spp. in sika deer are vertically transmitted to the fetus. Nevertheless, considering that the ITS1 region of S. neurona was detected in the placenta of thoroughbred pregnant mares (Cabral et al., 2022), and S. cruzi was detected in sera from precolostrum calves (Moré et al., 2009), it is possible that the genus Sarcocystis can pass through the placenta.

This study suggests that Types 1 and 2 were more abundant than Types 3–5 in both the mother and fetal specimens. Conversely, Types 3 and 4 were detected more frequently in C. n. centralis specimens than in C. n. yesoensis specimens which might be a regional difference consistent with reports of Sarcocystis epidemiological studies of sika deer in Japan (Abe et al., 2019; Irie et al., 2019).

Sarcocystis spp. was detected less frequently in udder tissues and milk than in maternal and fetal tissues (Table 5). It is possible that only Type 1, which has a higher overall frequency of infection than others, was detected, or that Types 1, 2, and 4 were able to migrate to the udder tissue and milk; however, the results of this study alone are speculative. Since all udder tissue and milk specimens in this study were from C. n. yesoensis, it is possible that Type 3 would also have been detected if the C. n. centralis specimens had been examined.

Sequencing of cytochrome c oxidase subunit I (cox1) may identify the species in more detail; however, since the genomic DNA samples in this study were derived from sika deer tissue homogenate, it may contain a large amount of the deer genome. In addition, previously reported species-specific PCR and sequencing targeting cox1 failed to identify it because of many nonspecific reactions (data not shown) (Abe et al., 2019).

In this study, S. fayeri was detected in the blood of C. n. yesoensis. S. fayeri infects horses as intermediate hosts and dogs as end hosts and has been recognized as a cause of food poisoning in Japan (Dubey et al., 1977; Irikura et al., 2017). This is the first report of S. fayeri being detected in sika deer. Most reports describing S. fayeri and S. bertrami, a synonym of S. fayeri, being isolated from horses, but some reports of detection in donkeys in Gambia, Egypt, Italy, and China, it is possible that S. fayeri can infect animals other than horses as well (Coultous et al., 2017; Dubey et al., 2016; Passantino et al., 2019; Zeng et al., 2018).

In the present study, Sarcocystis spp. was detected in wild sika deer mothers and their fetuses in Japan, suggesting that Sarcocystis spp. may pass through the placenta of sika deer. However, Sarcocystis spp. are numerous and different species infect different hosts (Dubey et al., 2015). Therefore, it is possible that Sarcocystis species other than those discussed in this study may also cross the placenta or be vertically transmitted. Further studies on vertical infection of other Sarcocystis species should be conducted.

Conclusion

Vertical infection of the wild sika deer parasite Sarcocystis spp. was verified using mother–fetus sample pairs from early to late gestation and partial 18S rRNA of Sarcocystis Types 1–5 and S. fayeri were detected. Among them, Types 1 and 2 were detected in both the fetus and mother, suggesting the possibility that they cross the placenta of sika deer.

Compliance with Ethical Standards

The samples used in this study were collected from wild sika deer that were legally hunted for human consumption. None of the samples, materials, or methods used in this study involved human participants.

Footnotes

Authors’ Contributions

A.Y.: Conceptualization (supporting); formal analysis (supporting); methodology (lead); investigation (supporting); software (lead), validation (lead); writing—original draft (lead); visualization (equal); funding acquisition (equal); writing—review and editing (equal). Y.Y.: Formal analysis (lead); investigation (lead); software (supporting); visualization (equal); writing-original draft (supporting); writing—review and editing (equal). T.H.: Formal analysis (lead); investigation (lead); software (supporting); visualization (equal); writing-original draft (supporting); writing—review and editing (equal). Y.U.: Investigation (supporting); software (supporting); visualization (supporting); writing—review and editing (supporting). S.F.: writing—original draft (supporting); writing—review and editing (equal). Y.K.: Conceptualization (lead); methodology (supporting); writing—review and editing (equal); funding acquisition (equal).

Disclosure Statement

The authors declare no conflicts of interest associated with this article.

Funding Information

This work was supported by a Health Labour Sciences Research Grant for Young Scientists (JPMHKA H30-SHOKUHIN WAKATE 003) and KAKENHI Grant-in-Aid for Young Scientists (19K15974), Japan.

Supplementary Material

Supplementary Data S1

Supplementary Data S2

Supplementary Data S3

References

Abe

, Matsuo

, Moribe

, et al. Morphological and molecular characteristics of seven Sarcocystis species from sika deer (Cervus nippon centralis) in Japan, including three new species. Int J Parasitol Parasites Wildl, 2019; 10:252–262; doi: 10.1016/j.ijppaw.2019.10.002

Agerholm

, Dubey

. Sarcocystosis in a stillborn lamb. Reprod Domest Anim, 2014; 49(6):e60-63–e63; doi: 10.1111/rda.12398

Aoki

, Hayashi

, Kouno

, et al. An outbreak of suspected food poisoning related to consumption of undercooked deer meat in Shiga prefecture. Jpn J Food Microbiol, 2017; 34(3):166–169; doi: 10.5803/jsfm.34.166

Aoki

, Ishikawa

, Hayashi

, et al. An outbreak of suspected food poisoning related to deer meat containing Sarcocystis cysts. Jpn J Food Microbiol, 2013; 30(1):28–32.

Cabral

LDR

, Sato

, de Sousa

, et al. Detection of Neospora spp. and Sarcocystis neurona in amniotic fluid and placentas from mares. Vet Parasitol, 2022; 303:109678; doi: 10.1016/j.vetpar.2022.109678

Cho

C-KJ

, Shan

, Winsor

, et al. Proteomics analysis of human amniotic fluid. Mol Cell Proteomics, 2007; 6(8):1406–1415; doi: 10.1074/mcp.M700090-MCP200

Coultous

, Raftery

, Shiels

, et al. Molecular confirmation of Sarcocystis fayeri in a donkey. Vet Parasitol, 2017; 240:30–33; doi: 10.1016/j.vetpar.2017.04.026

Dmitriev

, Ernst

. Animal Genetic Resources of the USSR. FAO of the United Nations: Rome; 1989.

Dubey

, Calero-Bernal

, Rosenthal

, et al. Sarcocystosis of Animals and Humans. CRC Press; 2015.

10.

Dubey

, Streitel

, Stromberg

, et al. Sarcocystis fayeri sp. n. from the horse. The Journal of Parasitology, 1977; 63(3):443–447; doi: 10.2307/3279997

11.

Dubey

, VAN Wilpe

, Verma

, et al. Ultrastructure of Sarcocystis bertrami sarcocysts from a naturally infected donkey (Equus asinus) from Egypt. Parasitology, 2016; 143(1):18–23; doi: 10.1017/S0031182015001432

12.

Grassi

, Farina

, Floriani

, et al. Assessment of fetal swallowing with gray-scale and color doppler sonography. AJR Am J Roentgenol, 2005; 185(5):1322–1327.

13.

Harding

, Bocking

, Sigger

, et al. Composition and volume of fluid swallowed by fetal sheep. Q J Exp Physiol, 1984; 69(3):487–495.

14.

Inomata

, Aoki

, Kimura

, et al. A food poisoning case by the deer meat with three kinds of Sarcocystis spp. in Niigata prefecture, Japan. Jpn J Food Microbiol, 2020; 37(4):178–182; doi: 10.5803/jsfm.37.178

15.

Irie

, Ichii

, Nakamura

, et al. Molecular characterization of three Sarcocystis spp. from wild sika deer (Cervus nippon yesoensis) in Hokkaido, Japan. Vet Parasitol Reg Stud Reports, 2019; 18:100327; doi: 10.1016/j.vprsr.2019.100327

16.

Irikura

, Saito

, Sugita-Konishi

, et al. Characterization of Sarcocystis fayeri’s actin-depolymerizing factor as a toxin that causes diarrhea. Genes Cells, 2017; 22(9):825–835; doi: 10.1111/gtc.12515

17.

Kadohira

, Phiri

, Hill

, et al. Game meat consumption and foodborne illness in Japan: A web-based questionnaire survey. J Food Prot, 2019; 82(7):1224–1232.

18.

Kamata

, Saito

, Irikura

, et al. A toxin isolated from Sarcocystis fayeri in raw horsemeat may be responsible for food poisoning. J Food Prot, 2014; 77(5):814–819; doi: 10.4315/0362-028X.JFP-13-351

19.

Kojima

. Risk management policy of the Ministry of Health, Labour and Welfare for ensuring safe wild game meat. J Vet Epidemol, 2020; 24(2):55–59; doi: 10.2743/jve.24.55

20.

Matsuo

, Morita

, Imai

, et al. Prevalence of Sarcocystis in Japanese sika deer (Cervus nippon centralis) in Hyogo prefecture, Japan. J Vet Epidemol, 2014; 18(2):124–129; doi: 10.2743/jve.18.124

21.

Matsuo

, Uetsu

, Takashima

, et al. High occurrence of Sarcocystis infection in sika deer Cervus nippon centralis and Japanese wild boar Sus scrofa leucomystax and molecular characterization of Sarcocystis and Hepatozoon isolates from their muscles. Jpn J Zoo Wildl Med, 2016; 21(2):35–40; doi: 10.5686/jjzwm.21.35

22.

Moré

, Bacigalupe

, Basso

, et al. Frequency of horizontal and vertical transmission for Sarcocystis cruzi and Neospora caninum in dairy cattle. Vet Parasitol, 2009; 160(1–2):51–54; doi: 10.1016/j.vetpar.2008.10.081

23.

Nalls

, McNulty

, Powers

, et al. Mother to offspring transmission of chronic wasting disease in reeves’ muntjac deer. PLOS ONE, 2013; 8(8):e71844–e11; doi: 10.1371/journal.pone.0071844

24.

Nei

, Kumar

. Molecular Evolution and Phylogenetics. Oxford University Press: New York; 2000. [Database].

25.

Passantino

, Lia

, Latrofa

, et al. Sarcocystis bertrami in skeletal muscles of donkeys (Equus africanus asinus) from southern Italy. Vet Parasitol Reg Stud Reports, 2019; 16:100283; doi: 10.1016/j.vprsr.2019.100283

26.

Pattengale

, Alipour

, Bininda-Emonds

ORP

, et al. How many bootstrap replicates are necessary? J Comput Biol, 2010; 17(3):337–354; doi: 10.1089/cmb.2009.0179

27.

Powell

, Brewer

, Lappin

. Detection of Toxoplasma gondii in the milk of experimentally infected lactating cats. Vet Parasitol, 2001; 102(1–2):29–33.

28.

Prakas

, Rehbein

, Rudaitytė-Lukošienė

, et al. Molecular identification of Sarcocystis species in sika deer (Cervus nippon) of free-ranging populations in Germany and Austria. Vet Res Commun, 2023; 47(4):2165–2171; doi: 10.1007/s11259-023-10079-0

29.

Ross

, Nijland

. Development of ingestive behavior. Am J Physiol, 1998; 274(4):R879–R893; doi: 10.1152/ajpregu.1998.274.4.R879

30.

Saito

. Food poisoning caused by Sarcocystis fayeri associated with ingestion of raw horse meat. J Vet Epidemol, 2012; 16(2):114–125; doi: 10.2743/jve.16.114

31.

Tamura

, Stecher

, Kumar

. MEGA11: Molecular evolutionary genetics analysis version 11. Mol Biol Evol, 2021; 38(7):3022–3027; doi: 10.1093/molbev/msab120

32.

Tenter

, Heckeroth

, Weiss

. Toxoplasma gondii: From animals to humans. Int J Parasitol, 2000; 30(12–13):1217–1258; doi: 10.1016/s0020-7519(00)00124-7

33.

Yamazaki

, Shirafuji

, Kamata

. The relationship between epidemiological factors and the parasite load of Sarcocystis in yezo-deer (Cervus nippon yesoensis) in Hokkaido, Japan. Foodborne Pathog Dis, 2023; 20(1):1–6; doi: 10.1089/fpd.2022.0049

34.

Zeng

, Sun

, Xiang

, et al. Morphological and molecular characteristics of Sarcocystis bertrami from horses and donkeys in China. Vet Parasitol, 2018; 252:89–94; doi: 10.1016/j.vetpar.2018.01.024

Supplementary Material

Please find the following supplemental material available below.

For Open Access articles published under a Creative Commons License, all supplemental material carries the same license as the article it is associated with.

For non-Open Access articles published, all supplemental material carries a non-exclusive license, and permission requests for re-use of supplemental material or any part of supplemental material shall be sent directly to the copyright owner as specified in the copyright notice associated with the article.

0.00 MB

0.05 MB

0.03 MB

0.02 MB