Absence of Commonly Reported Leucine-Rich Repeat Kinase 2 Mutations in Eastern Indian Parkinson's Disease Patients

Abstract

Background: Pathogenic mutations in leucine-rich repeat kinase 2 (LRRK2; PARK8) encoding dardarin, implicated in patients with autosomal dominant and sporadic Parkinson's disease (PD) among different ethnic groups (Ashkenazi Jews, North African Arabs, Basques) might be of some help in diagnostic screening and genetic counseling. Aim of the Study: We investigated the seven common mutations spanning exons 31, 35, and 41 reported in the LRRK2 gene among Eastern Indian patients with PD. Methods: Mutations R1441G, R1441C, R1441H, G2019S, Y1699C, I2020T, and I2012T were screened in 320 individuals (PD, 150 and controls, 170) by direct sequencing. Results: We did not observe any of these abovementioned mutations in our studied individuals. Conclusion: We conclude that these mutations are rare causes of PD in the Eastern Indian population and, therefore, of little help for genetic counseling and diagnostic purposes.

Introduction

Although Parkinson's disease (PD) is a common neurodegenerative condition affecting <1% of the population after the age of 65 years and is the second most common neurodegenerative disorder after Alzheimer's disease, the disease trait is rarely inherited in a simple Mendelian fashion. The disease is clinically defined by the association of bradykinesia, resting tremor, muscular rigidity, and postural instability and pathologically by loss of dopaminergic neurons in the substantia nigra-pars compacta and other brain sites, with formation of ubiquitin containing inclusions (Lewy bodies) in the surviving neurons. Its etiology is most likely a combination of complex genetic and environmental factors (Cordato and Chan, 2004). A breakthrough has been achieved by linkage of families with autosomal dominant PD to the PARK8 region located on chromosome 12p11.2-q13 (Funayama et al., 2002; Zimprich et al., 2004a). Leucine-rich repeat kinase 2 (LRRK2) (OMIM 609007) is a 145-kb gene of 51 exons encoding a large protein of 2527 amino acids. The protein Dardarin belongs to a group within the Ras/GTPase super family, termed ROCO, characterized by the presence of two conserved domains named Roc (Ras in complex proteins) and COR (C-terminal of ROC), together with other domains including a leucine-rich repeat region, a WD40 domain (Zimprich et al., 2004a), and a tyrosine kinase catalytic domain. Mutations in the LRRK2 gene are reported as a frequent cause of PD among autosomal dominant and sporadic patients in different ethnic groups (Lesage et al., 2006; Ozelius et al., 2006; Papapetropoulos et al., 2006; Simon-Sanchez et al., 2006) (Fig. 1). A common variant (LRRK2, G2385R), observed only on the Asian continent, was identified as a “risk factor” for PD (Tan et al., 2007). LRRK2 G2019S is present in Spain and Portugal in as high as 6% of familial and 3% of patients with sporadic PD (Bras et al., 2005; Gaig et al., 2006; Infante et al., 2006) and is geographically widespread throughout Europe and North America (Kachergus et al., 2005). Similarly, R1441C, R1441H, and R1441G have also been reported in several familial cases (Punia et al., 2006). These mutations have been associated with impairment of the functional activity of this protein (West et al., 2005; Gloeckner et al., 2006). The overall frequency of the common mutations (R1441C, R1441G, R1441H, I2012T, I2020T, G2019S, and Y1699C) remains to be established in Eastern Indian patients.

FIG. 1.

Reported frequencies of common reported leucine rich repeat kinase 2 (LRRK2) mutations in different populations.

Despite extensive studies on the molecular bases of PD in different population groups, very little information is available regarding the molecular pathogenesis of the disease among Eastern Indian patients with reference to this gene. A single report has demonstrated the absence or rarity of common LRRK2 mutations in North Indian patients (Punia et al., 2006). To develop a comprehensive mutation screening of the eastern part of India, we evaluated seven commonly reported pathogenic mutations. To our knowledge, this study is the first report on screening these seven common mutations of LRRK2 gene in the Eastern Indian population.

Subjects and Methods

Collection of patient samples

The base population recruited for this study is patients with PD visiting the Movement Disorder Clinic of Calcutta Medical College and Hospital (CMC) National Neuroscience Centre (NNC), Kolkata, India, from March 1, 2007 to December 23, 2009. Clinical data and a detailed family history of each patient were collected with the help of collaborating clinicians after physical and neurological examination by two independent consultant neurologists. Ethical approval of the research project using human subjects was obtained from the Institutional Ethical Committee of Anthropological Survey of India, Ministry of Culture, Government of India and National Neurosciences Center (collaborating hospital). Hospitals such as CMC and NNC are the main referral centers for cases related to movement disorders and are situated in the heart of Kolkata city, West Bengal. We have meticulously selected only those patients whose ancestors were residents of Eastern India. The demographic data (name, age, address, place of inhabitation, occupation, family pedigree, educational status, monthly income, occupation/professional status of subject during his/her life time, residence area [rural/urban], etc.) was collected by health professionals and epidemiologists.

Case definition

All the cases had to meet the following symptoms at the time of diagnosis: (1) the presence of at least three of the following signs: resting tremor, cogwheel rigidity, bradykinesia, and postural reflex impairment, at least one of which must be either rest tremor or bradykinesia; (2) no suggestion of a cause for another parkinsonian syndrome such as drugs, trauma, brain tumor, or treatment within the last 12 months with dopamine blocking or dopamine depleting agents; and (3) no atypical features such as prominent occulomotor palsy, cerebellar signs, vocal cord paresis, severe orthostatic hypotension, pyramidal signs, amyotrophy, or limb apraxia. Clinical stage of the disease was evaluated according to the classification of Hoehn and Yahr (1967).

The control group consisted of patients' spouses and other healthy community-based, age-, sex-matched volunteers residing in the same ethnic background as the patients with PD. None of the control subjects had diagnosable neurological disorders.

Collection of blood samples and genomic DNA preparation

Approximately 5 mL peripheral blood samples were collected in BD Vacutainer K2 EDTA (6 mL) with written and informed consent from patients with PD, their family members, and from normal individuals as controls. Genomic DNA was prepared from fresh whole blood by using the conventional phenol-chloroform method (Sambrook and Russel, 2001). Genomic DNA was dissolved in TE (10 mM Tris-HCl and 0.1 mM EDTA, pH 8.0).

Polymerase chain reaction

Polymerase chain reaction (PCR) was carried out to amplify exons and adjacent flanking region in a total volume of 10.0 μL containing 40-100 ng genomic DNA, 0.4 μM of each primer, 0.2 mM of each dNTP, 0.5-1.5 mM of MgCl₂ (as appropriate), and 0.5 unit of Taq polymerase (Invitrogen, Carlsbad, CA) in a Thermocycler (GeneAmp-9700; PE Applied Biosystems, Foster City, CA). Annealing temperature is calculated based on Tm of the primer pairs. The primers (Table 1) used to amplify the LRRK2 exons (Nos. 31, 35, and 41) containing R1441C, R1441G (4321C>G), R1441H, Y1699C, G2019S (6059T>C), I2020T (6055G>A), and I2012T (T6044C) mutation have been previously reported (Berg et al., 2005). PCR-amplified DNA fragments were analyzed on 2% agarose gel and visualized by ethidium bromide staining.

Table 1.

Primer List for Leucine-Rich Repeat Kinase 2 Gene (Berg et al., 2005)

Exon	Length	Sequence (5′-3′)
31	332	AGCAGGCCCAGTTTGAAAG//GACATTTCTAGGCAGTTGAGAATC
35	291	AGGTTGGGTGTTTTGTGAGG//ATGCCATCTCCCTAATTTCTC
41	331	GCACAGAATTTTTGATGCTTG//GAGGTCAGTGGTTATCCATCC

Mutation and polymorphism detection

DNA sequencing

The PCR products free of contaminating bands due to nonspecific amplification were directly sequenced in forward and reverse direction. Nucleotide changes were detected by comparing sequence obtained in a chromatogram with the normal LRRK2 gene sequence (GenBank Accession No. AY792511) using pair-wise BLAST (Tatusova and Madden, 1999) and SeqScape software v2.5

Results

A total of 320 study subjects were included. The LRRK2 mutations were screened in a total of 150 (141 sporadic [94%] and 9 familial [6%]) patients with PD (mean ± SD, age at onset, 52.3 ± 5.17 years; age range, 37-80 years; 126 men and 24 women); Unified Parkinson's Disease Rating Scale (UPDRS) score was 31.2 ± 5.20, Hoehn and Yahr staging, 2.43 ± 1.10 and 170 controls (mean ± SD age [years] 57.6 ± 9.1; 130 men and 40 women). The age (p = 0.74) and sex (p = 0.23) distribution of patients and controls was similar. The patients and controls were classified into three common caste groups, namely Brahmin, Kayastha, and Baidya (Table 2). Minor groups such as Goala, Bagdi, and Poundra Khatriya were broadly named in the “others category” as the fourth group, and Muslims were taken as a religious group (Fig. 2). Most of the patients reported an increase in tremor and imbalance during periods of stress. Only four patients were untreated, whereas others are under antiparkinsonian treatment. Genetic analysis revealed none of the seven commonly reported mutations in the 320 subjects studied.

FIG. 2.

Caste-wise distribution of patients and controls.

Table 2.

Classification of Patients and Controls Ethnically

Ethnic groups	Patients	Controls	F-test value	p-Value	Comment
Kayastha	70	85	0.098799	1	Nonsignificant
Brahmin	30	37	0.255493	0.9998	Nonsignificant
Baidya	15	12	0.478313	0.9025	Nonsignificant
Others	21	19	0.681412	0.7974	Nonsignificant
Muslims	14	17	0.499102	0.894	Nonsignificant

Discussion

After screening a cohort of 150 PD patients and unrelated matched controls from Eastern India for the presence of seven common LRRK2 mutations in exon 31, 35, and 41, we did not observe any of these mutations. The LRRK2 G2019S mutation is the most common genetic determinant of PD (both familial and sporadic) identified to date (Fig. 1). Studies so far have reported frequencies of LRRK2 mutations between 1% and 7% in patients with PD of European origin and between 2% and 40% in Ashkenazi Jews and North African Arabs (Lesage et al., 2006; Ozelius et al., 2006; Ishihara et al., 2007). Though the G2019S mutation is absent in the Eastern Indian population, which is in accordance with the Chinese population (Tan et al., 2005), a single report demonstrated the presence of G2019S in only one Indian patient (0.12%) and low prevalence in Asia (Tan et al., 2005; Punia et al., 2006).

The I2012T and I2020T mutations are absent in our study, which is similar to the Taiwanese (Lu et al., 2005), Polish (Bialecka et al., 2005), and North Indian studies (Punia et al., 2006) earlier in contrast to the Japanese and Europeans (Zimprich et al., 2004b; Berg et al., 2005; Funayama et al., 2005). The R1441G mutation occurs in about 8% of patients with PD from the Basque country and 2.5% in the late-onset Spanish population (Paisan-Ruiz et al., 2004; Mata et al., 2005). This mutation is also not found in our cohort (Fig. 1), which is similar to the Italian (Goldwurm et al., 2005), Portuguese (Bras et al., 2005), and North Indian populations (Punia et al., 2006). Similarly, R1441C and R1441H were present neither in Eastern India (Fig. 1) nor among Portuguese (Bras et al., 2005) nor in a study from North India (Punia et al., 2006). Again, Y1669C is absent in our PD patient cohort, for example, the Italian population (Goldwurm et al., 2005), whereas it exists as 0.26% in German cohort (Zimprich et al., 2004b). Since most LRRK2 mutations appear to be limited to certain populations in various geographical locations (Fig. 1), different ancestry and founder effect (Zabetian et al., 2006) can be related to their variability, thereby explaining their absence in Indians.

Our study has some limitations. The studied cohort is relatively small. Although these common mutations are absent in our study, their contribution to PD cannot be completely excluded, as LRRK2 is a large gene and mutations, other rearrangements, or upstream region polymorphisms may exist in this population. Thus, mutation screening of the entire 51 exons of LRRK2 is important to determine the contribution of this gene to PD in Eastern India. Based on our results, routine testing for these mutations for diagnostic purpose and genetic counseling may not be cost effective, at least in the studied population.

Although LRRK2 mutations are reported at various frequencies in populations of Spain, Basques, African Arabs, and Ashkenazi Jews, this study indicates that these mutations do not significantly contribute to PD among the cases with familial PD and sporadic patients cutting across all the castes and groups taken in our study; thereby, they are of little relevance for their pathogenic role in this disease inheritance and cannot be recommended for the diagnostic screening.

Footnotes

Acknowledgments

This research work is supported by the grant from Anthropological Survey of India, Ministry of Culture, Government of India. The authors are thankful to the patients with PD and control subjects for voluntarily taking part in this research work and donating their blood samples. Mitali Maity (nurse in NNC) helped in the collection of blood samples from the OPD of NNC.

Disclosure Statement

No competing financial interests exist.

References

Berg

, Schweitzer

, Leitner

et al. 2005. Type and frequency of mutations in the LRRK2 gene in familial and sporadic Parkinson's disease. Brain, 128:3000-3011.

Bialecka

, Hui

, Klodowska-Duda

et al. 2005. Analysis of LRRK2 G 2019 S and I 2020 T mutations in Parkinson's disease. Neurosci Lett, 390:1-3.

Bras

, Guerreiro

, Ribeiro

et al. 2005. G2019S dardarin substitution is a common cause of Parkinson's disease in a Portuguese cohort. Mov Disord, 20:1653-1655.

Cordato

, Chan

. 2004. Genetics and Parkinson's disease. J Clin Neurosci, 11:119-123.

Funayama

, Hasegawa

, Kowa

et al. 2002. A new locus for Parkinson's diseases (PARK8) maps to chromosome 12p11.2-q13.1. Am Neurol, 51:296-301.

Funayama

, Hasegawa

, Ohta

et al. 2005. An LRRK2 mutation as a cause for the parkinsonism in the original PARK8 family. Ann Neurol, 57:918-921.

Gaig

, Ezquerra

, Marti

et al. 2006. LRRK2 mutations in Spanish patients with Parkinson disease: frequency, clinical features, and incomplete penetrance. Arch Neurol, 63:377-382.

Gloeckner

, Kinkl

, Schumacher

et al. 2006. The Parkinson disease causing LRRK2 mutation I2020T is associated with increased kinase activity. Hum Mol Genet, 15:223-232.

Goldwurm

, di Fonzo

, Simons

et al. 2005. The G6055A (G2019S) mutation in LRRK2 is frequent in both early and late onset Parkinson's disease and originates from a common ancestor. J Med Genet, 42:e65.

10.

Hoehn

, Yahr

. 1967. Parkinsonism: onset, progression, and mortality. Neurology, 17:427-442.

11.

Infante

, Rodriguez

, Combarros

et al. 2006. LRRK2 G2019S is a common mutation in Spanish patients with late-onset Parkinson's disease. Neurosci Lett, 395:224-226.

12.

Ishihara

, Gibson

, Warren

et al. 2007. Screening for LRRK2 G2019S and clinical comparison of Tunisian and North American Caucasian Parkinson's disease families. Mov Disord, 22:55-61.

13.

Kachergus

, Mata

, Hulihan

et al. 2005. Identification of a novel LRRK2 mutation linked to autosomal dominant parkinsonism: evidence of a common founder across European populations. Am J Hum Genet, 76:672-680.

14.

Lesage

, Durr

, Tazir

et al. 2006. LRRK2 G2019S as a cause of Parkinson's disease in North African Arabs. N Engl J Med, 354:422-423.

15.

, Simons

, Wu-chou

et al. 2005. The LRRK2 I2012T, G2019S, and I2020T mutations are rare in Taiwanese patients with sporadic Parkinson's disease. Parkinsonism Relat Disord, 11:521-522.

16.

Mata

, Kachergus

, Taylor

et al. 2005. LRRK2 pathogenic substitutions in Parkinson's disease. Neurogenetics, 6:171-177.

17.

Ozelius

, Senthil

, Saunders-Pullman

et al. 2006. LRRK2 G2019S as a cause of Parkinson's disease in Ashkenazi Jews. N Engl J Med, 354:424-425.

18.

Paisan-Ruiz

, Jain

, Evans

et al. 2004. Cloning of the gene containing mutations that cause PARK8-linked Parkinson's disease. Neuron, 44:595-600.

19.

Papapetropoulos

, Singer

, Ross

et al. 2006. Clinical heterogeneity certain populations, different ancestry and of the LRRK2 G2019S mutation. Arch Neurol, 63:1242-1246.

20.

Punia

, Behari

, Govindappa

et al. 2006. Absence/rarity of commonly reported LRRK2 mutations in Indian Parkinson's disease patients. Neurosci Lett, 409:83-88.

21.

Sambrook

, Russel

. 2001. Molecular cloning: a laboratory manual. Irwin

. Science. Cold Spring Harbor Press: Cold Sprig Harbor, NY, 6.23-6.27.

22.

Simon-Sanchez

, Marti-Masso

, Sanchez-Mut

et al. 2006. Parkinsons disease due to the R1441G mutation in Dardarin: a founder effect in the Basques. Mov Disord, 21:1954-1959.

23.

Tan

, Shen

, Tan

et al. 2005. The G2019S LRRK2 mutation is uncommon in an Asian cohort of Parkinson's disease patients. Neurosci Lett, 384:327-329.

24.

Tan

, Zhao

, Skipper

et al. 2007. The LRRK2 Gly2385Arg variant is associated with Parkinson's disease: genetic and functional evidence. Hum Genet, 120:857-863.

25.

Tatusova

, Madden

. 1999. BLAST 2 sequences a new tool for comparing protein and nucleotide sequences. FEMS Microbiol Lett, 174:247-250.

26.

West

, Moore

, Biskup

et al. 2005. Parkinson's disease-associated mutations in leucine-rich repeat kinase 2 augment kinase activity. Proc Natl Acad Sci U S A, 102:16842-16847.

27.

Zabetian

, Hutter

, Yearout

et al. 2006. LRRK2 G2019S in families with Parkinson disease who originated from Europe and the Middle East: evidence of two distinct founding events beginning two millennia ago. Am J Hum Genet, 79:752-758.

28.

Zimprich

, Biskup

, Leitner

et al. 2004a. Mutations in LRRK2 cause autosomal-dominant Parkinsonism with pleomorphic pathology. Neuron, 44:601-607.

29.

Zimprich

, Muller-Myhsok

, Farrer

et al. 2004b. The PARK8 LOCUS in autosomal dominant parkinsonism: confirmation of linkage and further delineation of the disease-containing interval. Am J Hum Genet, 74:11-19.