Prevalence of the NKG2D Thr72Ala Polymorphism in Patients with Cervical Carcinoma

Abstract

Background: The natural killer group 2, member D (NKG2D) receptor is mainly situated on the surface of NK and CD8⁺ αβ T cells that are involved in the defense against viral agents and in cancer immunosurveillance. The G>A transition (Thr72Ala) (rs2255336) located in the NKG2D region encoding the transmembrane part of this receptor has been associated with decreased functionality of NK and T cells. Methods: Using polymerase chain reaction-restriction fragment length polymorphisms, we examined the NKG2D Thr72Ala polymorphism in patients with cervical cancer (n=353) and controls (n=366) in a Polish population. Results: We observed an increased frequency of Thr/Thr or/and Thr/Ala genotypes in controls compared with all patients with cervical cancer; however, these differences were not significant. We found a significantly increased frequency of the NKG2D 72Thr allele in controls than in all patients (odds ratio [OR]=0.7410 [95% confidence intervals (CI)=0.5683-0.9662, p=0.0265]). Moreover, stratification of patients based on cancer stage showed a significant increase in the Thr/Thr genotype frequency (OR=0.3086 [95% CI=0.09097-1.047, p=0.0461]), as well as in the Thr/Thr and Thr/Ala genotype frequency (OR=0.4504 [95% CI=0.2891-0.7018, p=0.0003]), in controls compared with patients with cervical cancer in stages III and IV. The frequency of the NKG2D 72Thr allele was also significantly increased in controls as compared with patients in stage III and IV cancer (OR=0.4699 [95% CI=0.3170-0.6967, p=0.0001]). Conclusion: Our studies may suggest that the women with cervical cancer bearing the NKG2D 72Thr gene variant might be protected against progression to advanced stages of this cancer.

Introduction

Cervical cancer is one of the most prevalent female malignant neoplasms and the main cause of early-onset death in women (Arbyn et al., 2007). The human papilloma virus (HPV) is recognized as being the major cause of cervical tumors and their precursor lesions, which are of varying degrees and are called cervical intraepithelial neoplasias (CIN) (Walboomers et al., 1999; Giuliano et al., 2002). HPV is one of the common viruses sexually transmitted, existing in about 100 different subtypes that differ in genetic and oncogenic potential (Muñoz et al., 2003). The oncogenic subtypes of HPV contributing to cervical carcinogenesis include HPV 16, 18, 31, 33, 35, 39, 45, 51, 52, 56, 58, 59, 68, and others (Muñoz et al., 2003). It has been shown that both adaptive and innate immune responses are involved in the clearance of HPV infection (Kobayashi et al., 2004; Frazer, 2007; Stanley, 2008; Peng et al., 2007). Spontaneous regression of HPV16-positive squamous intraepithelial lesions of the cervix has been accompanied by CD4⁺ T-cell responses against the viral E7 peptide (Peng et al., 2007). By contrast, in cervical tissue, the innate immune response acts against various viruses using the activation of toll-like receptors, as well as dendritic and natural killer (NK) cells (Wira et al., 2005; Manickam et al., 2007; Hasan et al., 2007). NK cells spearhead the defense against viral agents and play an elementary role in immunosurveillance against various cancers (Lanier et al., 2008; Waldhauer and Steinle, 2008). These cells are activated for the killing of cancer cells via complex interactions between various receptors, including natural killer group 2, member D (NKG2D), and ligands located on the surface of cancer cells (Sivori et al., 1997; Pessino et al., 1998; Pende et al., 1999; Wu et al., 1999; Moretta et al., 2006). The NKG2D receptor is a member of the C-type lectin family (Houchins et al., 1991). NKG2D is also involved in the adaptive immune response as a co-stimulatory receptor in CD8⁺ αβ T cells and is found on γδ T cells (Wu et al., 1999; Moretta et al., 2006; Houchins et al., 1991). The ligands of NKG2D encompass some of the cytomegalovirus UL16-binding proteins (ULBPs), and major histocompatibility complex (MHC) class I-related chains A (MICA) and B (MICB) (Raulet, 2003; Bahram et al., 1994; Cosman et al., 2001; Chalupny et al., 2003; Bacon et al., 2004). Some studies have recently demonstrated a change in the number of NKG2D molecules on the surface of immune cells from patients with cervical cancer (Arreygue-Garcia et al., 2008; Garcia-Iglesias et al., 2009).

HPV infection alone is not sufficient for cervical tumorigenesis. The use of oral contraceptives, smoking, and genetic factors may also be involved in cervical tumor development (Castellsague et al., 2003; Magnusson et al., 2000). It has been reported that the G>A transition (Thr72Ala) (rs2255336) situated in the NKG2D region encoding the transmembrane part of this receptor may be associated with decreased functionality of NK and T cells (Kabalak et al., 2010; Hayashi et al., 2006). Therefore, we explored the genotype and allele frequencies of the NKG2D Thr72Ala polymorphism in patients with cervical cancer in a Polish population.

Patients and Methods

Patients and controls

The patient group consisted of three hundred fifty-three women with a histologically determined stage of cervical carcinoma according to the International Federation of Gynecology and Obstetrics. Patient data were collected for patients seen between April 2007 and July 2011 at the Department of Radiotherapy, Greater Poland Cancer Center in Poznań, Poland (Table 1). Three hundred sixty-six unrelated healthy women volunteers, of a similar age to the patients, were used as controls (Table 1). Women with cervical cancer and controls were Caucasians, collected from the Wielkopolska area of Poland. All subjects involved in the study provided written informed consent. The study was approved by the local ethics committee of the Poznań University of Medical Sciences.

Table 1.

Clinical and Demographic Characteristics of Patients and Controls

Characteristic	Patients (n=353)	Controls (n=366)
^aMean age±SD	49.7±10.4	48±9.9
Tumor stage
IA	51 (14.4%)
IB	54 (15.3%)
IIA	44 (12.5%)
IIB	51 (14.4%)
IIIA	74 (20.9%)
IIIB	61 (17.3%)
IVA	3 (0.8%)
IVB	15 (4.2%)
Histological grade
G1	81 (22.9%)
G2	153 (43.3%)
G3	52 (14.7%)
Gx	67 (19.0%)
Histological type
Squamous Cell Carcinoma	331 (93.8%)
Adenocarcinoma	14 (3.9%)
Other	8 (2.3%)
HPV genotypes
16 and 18	225 (63.7%)
16, 18, 31, 33, 35, 39,45,51,52,56,58,59 and 68	353 (100%)

age at first diagnosis.

HPV, human papilloma virus.

Genotyping

DNA was isolated from peripheral leucocytes by employing a standard salting-out procedure. The NKG2D Thr72Ala (c.214A>G) (rs2255336) polymorphic variant was identified by the polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP). PCR was performed employing the primer pair 5′ GAGGTATTTATGTTCTGTTCTGG 3′and 5′ TCTACTTCTCTGTTGTCACTTAC 3′. The PCR-amplified fragments of NKG2D that were 271bp in length were isolated and subjected to digestion by endonuclease MaeIII (/GTNAC) Roche Diagnostic GmbH, (Penzberg, Germany). The NKG2D 72Ala allele remained uncut, whereas the NKG2D 72Thr allele was cleaved into 217bp and 54bp fragments. The digestion products were separated by electrophoresis on 3% agarose gel. The NKG2D Thr72Ala polymorphism was confirmed by repeated PCR-RFLP and commercial sequencing analysis.

Statistical analysis

The distribution of genotypes in patients and controls was examined for deviation from the Hardy-Weinberg equilibrium. The chi-squared (χ²) test or Fisher exact test was used to determine the differences in genotypic and allelic distribution between patients and controls, and a p-value <0.05 was considered statistically significant. The odds ratio (OR) and 95% confidence intervals (95% CI) were calculated. Moreover, the polymorphism was tested for association with cervical cancer incidence using the χ²-test for trend (p_trend). Bonferroni correction for multiple comparisons was used, and both p-values, before (p) and after correction (p_corr), were determined. Power calculations for this study were performed using Quanto software (Gauderman WJ, Morrison JM. QUANTO 1.2: A computer program for power and sample size calculations for genetic-epidemiology studies, URL: http://hydra.usc.edu/gxe, 2006).

Results

Distribution of NKG2D Thr72Ala genotypes and alleles in women with cervical cancer in stage I, II, III, and IV

Analysis of the NKG2D Thr72Ala polymorphism did not reveal a significant deviation from the Hardy-Weinberg equilibrium in all women with cervical cancer and controls.

The frequency of the NKG2D Thr/Thr genotype in controls and all women with cervical cancer was 0.06 and 0.03, respectively (Table 2). The distribution of the heterozygous genotype frequency was approximately 1.2-fold higher in controls than in women with cervical cancer and was 0.31 and 0.27, respectively (Table 2). We observed an increased frequency of the Thr/Thr genotype in controls as compared with all patients with cervical cancer; however, these differences were not significant (OR=0.5029 [95% CI=0.2401-1.053, p=0.0637]). There was also an increased frequency of the Thr/Thr and Thr/Ala genotypes in controls compared with all patients, but these differences were also not significant (OR=0.7531 [95% CI=0.5517-1.028, p=0.0736]) (Table 2). We found a significantly higher frequency of the NKG2D 72Thr allele in controls than in patients (OR=0.7410 [95% CI=0.5683-0.9662, p=0.0265]) (Table 2). The p-value of the χ²-test for the trend observed for the NKG2D Thr72Ala polymorphism was also statistically significant (p_trend=0.0313). Moreover, we observed a statistical difference in the genotype distribution between patients with different tumor stage p=0.0038 (p_corr=0.0076) (Table 3). A power analysis of this patient group predicted sufficient power to detect an association of the NKG2D Thr72Ala polymorphism with a genetic effect of 0.5 or less for the Thr/Thr and Ala/Thr vs Ala/Ala genotypes or a genetic effect of 0.1 and less for the Thr/Thr vs Thr/Ala and Ala/Ala genotypes (Table 4).

Table 2.

Prevalence of NKG2D Thr72Ala Polymorphisms Among Patients with Cervical Cancer and Healthy Individuals

	Genotype distribution (frequency)			Minor allele frequency	Odds Ratio (95% CI)	p	p_trend
n	Ala/Ala	Ala/Thr	Thr/Thr
Controls n=366	232 (0.63)	112 (0.31)	22 (0.06)	0.21
Cervical cancer in stage I, II, III and IV n=353	246 (0.70)	96 (0.27)	11 (0.03)	0.17	0.5029 (0.2401-1.053)^a	0.0637^d	0.0313
					0.7531 (0.5517-1.028)^b	0.0736^d
					0.7410 (0.5683-0.9662)^c	0.0265^d
Cervical cancer in stage III and IV n=155	123 (0.79)	29 (0.19)	(0.02)	0.11	0.3086 (0.09097-1.047)^a	0.0461^e	0.0003
					0.4504 (0.2891-0.7018)^b	0.0003^d
					0.4699 (0.3170-0.6967) ^c	0.0001^d

The Odds Ratio (OR) was calculated for patients ^a(Thr/Thr genotype vs Ala/Thr and Ala/Ala enotypes).

(Thr/Thr and Ala/Thr genotype vs Ala/Ala genotype). We also determined the OR for the risk allele.

(Thr vs Ala allele).

uncorrected Chi².

Fisher exact test.

CI, confidence interval.

Table 3.

Prevalence of NKG2D Thr72Ala Genotypes Differentiated by Patient Tumor Stage and Histological Grade

	Tumor stage				Histological grade
	I	II	III	IV	G1	G2	G3
NKG2D Thr72Ala
Ala/Ala	70	53	110	13	48	116	39
Ala/Thr	29	38	25	4	30	33	11
Thr/Thr	6	2	2	1	3	4	2
				p=0.0038 (p_corr=0.0076)			p=0.0940

Data are presented as number of patients; p-values represent the significance of genotype distribution between tumor characteristics and were determined by the chi-squared test.

Table 4.

Power Analysis

	Genetic model
Genetic effect	Thr/Thr vs Ala/Thr and Ala/Ala	Thr/Thr and Thr/Ala vs Ala/Ala
Cervical cancer in stage I, II, III, and IV (n=353)
0.1	0.9599	0.9999
0.3	0.7089	0.9999
0.5	0.3706	0.9885
0.7	0.1480	0.6159
0.9	0.0592	0.1043
Cervical cancer in stage III and IV (n=155)
0.1	0.7832	0.9999
0.3	0.4732	0.9995
0.5	0.2376	0.9047
0.7	0.1074	0.4165
0.9	0.0556	0.0826

Power analysis was conducted with the following parameters: allele frequency 0.21, disease population frequency 0.018, and significance level 0.05, two-sided.

Distribution of NKG2D Thr72Ala genotypes and alleles in women with cervical cancer in stage III and IV

The prevalence of the homozygous Thr/Thr genotype was approximately threefold higher in controls than in women with cervical cancer in stage III and IV (Table 2). The frequency of the NKG2D Thr/Ala heterozygous genotype in women with cervical cancer in stage III and IV was 0.19 (Table 2). We found a significantly increased frequency of the Thr/Thr genotype in controls compared with patients with cervical cancer in stage III and IV (OR=0.3086 [95% CI=0.09097-1.047, p=0.0461]). There was also a statistically increased frequency of the Thr/Thr and Thr/Ala genotypes in controls compared with these patients (OR=0.4504 [95% CI=0.2891-0.7018, p=0.0003]) (Table 2). We also observed a significantly higher frequency of the NKG2D 72Thr allele in controls than in this patient group [OR=0.4699 (95% CI=0.3170-0.6967, p=0.0001) (Table 2)]. The p-value of the χ²-test for the trend observed for the NKG2D Thr72Ala polymorphism was also statistically significant (p_trend=0.0003).

A power analysis of this patient group predicted sufficient power to detect an association of the NKG2D Thr72Ala polymorphism with a genetic effect of 0.5 or less for the Thr/Thr and Thr/Ala vs Ala/Ala genotypes but not for the Thr/Thr vs Ala/Thr and Ala/Ala genotypes (Table 4).

Discussion

NKG2D is one of the best recognized activating receptors of the NK cells that interacts with MICA, MICB, or the ULBPs to possibly trigger the killing of malignant cells (Diefenbach et al., Nature 2001; Pende et al., 2002; Carbone et al., 2005). The down-regulation of NKG2D in NK and T cells by metalloprotease-mediated release of MICA and MICB ligands from the cell surface has been demonstrated in various cancers (Jinushi et al., 2005; Holdenrieder et al., 2006; Salih et al., 2006; Groh et al., 2002). The activating ligands of NKG2D were also differentially expressed during the progression to cervical cancer (Textor et al., 2008). Arreygue-Garcia et al. (2008) have reported a reduced number of NKG2D receptors on the surface of NK and T cells in women with both cervical cancer and CIN (Arreygue-Garcia et al., 2008). Moreover, in patients with cervical cancer, the down-regulation of NKG2D was linked to low NK cell activity along with increased HPV16 infection and cervical tumor progression (Garcia-Iglesias et al., 2009).

We observed a statistically significant trend for the NKG2D Thr72Ala polymorphism in all patients with cervical cancer. Moreover, our study showed statistically significant differences in genotype distribution between patients with different tumor stages. Specifically, we found a statistically significant lower frequency of the NKG2D 72Thr gene variant in women with cervical cancer in stage III and IV as compared with healthy women.

This suggests that the NKG2D 72Thr gene variant may protect against cervical tumor progression by modulating cytotoxic T and NK cells. Hayashi et al. (2006) demonstrated that cancer patients having the NKG2D Ala/Ala genotype displayed decreased cytotoxicity of NK cells (Hayashi et al., 2006). Moreover, Kabalak et al. (2010) used anti-CD3 and anti-NKG2D antibodies to demonstrate decreased proliferation of peripheral blood lymphocytes bearing the NKG2D 72Ala/Ala genotype than lymphocytes with the NKG2D 72Thr gene variant (Kabalak et al., 2010). They also demonstrated that the NKG2D 72Thr gene variant could be a protective factor in the development of systemic lupus erythematosus (Kabalak et al., 2010).

The NKG2D Thr72Ala substitution is situated close to the transmembrane arginine at position 66, which binds via hydrogen bonds with the DAP10 adapter molecule (Garrity et al., 2005). The placement of this substitution may produce altered intracellular signals after ligand binding to the NKG2D molecule. A possible role of DAP10 adapter molecule levels in the modulation of NK cytotoxicity in cancer patients has also been reported (Hyka-Nouspikel and Phillips, 2006). Hyka-Nouspikel et al. (2007), using the murine model, reported that DAP10 signaling is involved in adjustments in the activation threshold controlling host immunity against tumors (Hyka-Nouspikel et al., 2007). Recently, Lee et al. (2011) demonstrated that reduced NK cytotoxicity in cancer patients due to down-regulation of surface NKG2D resulted from reduced levels of DAP10 molecules (Lee et al., 2011).

Our study may suggest that cervical cancer patients bearing the NKG2D 72Thr gene variant might be protected against the progression to advanced stages of this cancer. However, to confirm the role of the NKG2D Thr72Ala polymorphism in cervical cancer, this study should be replicated in a larger and independent cohort, and functional studies should be conducted on this polymorphism.

Footnotes

Acknowledgments

This study was supported by grant No 502-01-01124182-07474, Poznań University of Medical Sciences. The technical assistance of Monika Świerczewska is gratefully acknowledged.

Author Disclosure Statement

None of the authors have any financial or other conflicts of interest to disclose. In addition, all authors have seen and approved the final version of this article for submission.

References

Arbyn

, Raifu

, Autier

, Ferlay

. 2007. Burden of cervical cancer in Europe: estimates for 2004. Ann Oncol, 18:1708-1715.

Arreygue-Garcia

, Daneri-Navarro

, del Toro-Arreola

et al. 2008. Augmented serum level of major histocompatibility complex class I-related chain A (MICA) protein and reduced NKG2D expression on NK and T cells in patients with cervical cancer and precursor lesions. BMC Cancer, 8:16.

Bacon

, Eagle

, Meyer

et al. 2004. Two human ULBP/RAET1 molecules with transmembrane regions are ligands for NKG2D. J Immunol, 173:1078-1084.

Bahram

, Bresnahan

, Geraghty

, Spies

. 1994. A second lineage of mammalian major histocompatibility complex class I genes. Proc Natl Acad Sci USA, 91:6259-6263.

Carbone

, Neri

, Mesuraca

et al. 2005. HLA class I, NKG2D, and natural cytotoxicity receptors regulate multiple myeloma cell recognition by natural killer cells. Blood, 105:251-258.

Castellsague

, Munoz

. 2003. Chapter 3: cofactors in human papillomavirus carcinogenesis-role of parity, oral contraceptives, and tobacco smoking. J Natl Cancer Inst Monogr, 31:20-28.

Chalupny

, Sutherland

, Lawrence

et al. 2003. ULBP4 is a novel ligand for human NKG2D. Biochem Biophys Res Commun, 305:129-135.

Cosman

, Müllberg

, Sutherland

et al. 2001. ULBPs, novel MHC class I-related molecules, bind to CMV glycoprotein UL16 and stimulate NK cytotoxicity through the NKG2D receptor. Immunity, 14:123-133.

Diefenbach

, Jensen

, Jamieson

, Raulet

. 2001. Rae1 and H60 ligands of the NKG2D receptor stimulate tumour immunity. Nature, 413:165-171.

10.

Frazer

. 2007. Correlating immunity with protection for HPV infection. Int J Infect Dis, 11:S10-S16.

11.

Garcia-Iglesias

, Del Toro-Arreola

, Albarran-Somoza

et al. 2009. Low NKp30, NKp46 and NKG2D expression and reduced cytotoxic activity on NK cells in cervical cancer and precursor lesions. BMC Cancer, 9:186.

12.

Garrity

, Call

, Feng

, Wucherpfennig

. 2005. The activating NKG2D receptor assembles in the membrane with two signaling dimers into a hexamericstructure. Proc Natl Acad Sci USA, 102:7641-7646.

13.

Giuliano

, Harris

, Sedjo

et al. 2002. Incidence, prevalence, and clearance of type-specific human papillomavirus infections: the Young Women's Health Study. J Infect Dis, 186:462-469.

14.

Groh

, Wu

, Yee

, Spies

. 2002. Tumour-derived soluble MIC ligands impair expression of NKG2D and T-cell activation. Nature, 419:734-738.

15.

Hasan

, Bates

, Takeshita

et al. 2007. TLR9 expression and function is abolished by the cervical cancer-associated human papillomavirus type 16. J Immunol, 178:3186-3197.

16.

Hayashi

, Imai

, Morishita

et al. 2006. Identification of the NKG2D haplotypes associated with natural cytotoxic activity of peripheral blood lymphocytes and cancer immunosurveillance. Cancer Res, 66:563-570.

17.

Holdenrieder

, Stieber

, Peterfi

et al. 2006. Soluble MICA in malignant diseases. Int J Cancer, 118:684-687.

18.

Houchins

, Yabe

, McSherry

, Bach

. 1991. DNA sequence analysis of NKG2, a family of related cDNA clones encoding type II integral membrane proteins on human natural killer cells. J Exp Med, 173:1017-1020.

19.

Hyka-Nouspikel

, Lucian

, Murphy

et al. 2007. DAP10 deficiency breaks the immune tolerance against transplantable syngeneic melanoma. J Immunol, 179:3763-3771.

20.

Hyka-Nouspikel

, Phillips

. 2006. Physiological roles of murine DAP10 adapter protein in tumor immunity and autoimmunity. Immunol Rev, 214:106-117.

21.

Jinushi

, Takehara

, Tatsumi

et al. 2005. Impairment of natural killer cell and dendritic cell functions by the soluble form of MHC class I-related chain A in advanced human hepatocellular carcinomas. J Hepatol, 43:1013-1020.

22.

Kabalak

, Thomas

, Martin

et al. 2010. Association of an NKG2D gene variant with systemic lupus erythematosus in two populations. Hum Immunol, 71:74-78.

23.

Kobayashi

, Greenblatt

, Anastos

et al. 2004. Functional attributes of mucosal immunity in cervical intraepithelial neoplasia and effects of HIV infection. Cancer Res, 64:6766-6774.

24.

Lanier

. 2008. Evolutionary struggles between NK cells and viruses. Nat Rev Immunol, 8:259-268.

25.

Lee

, Lee

, Ahn

et al. 2011. A possible mechanism of impaired NK cytotoxicity in cancer patients: down-regulation of DAP10 by TGF-beta1. Tumori, 97:350-357.

26.

Magnusson

, Lichtenstein

, Gyllensten

. 2000. Heritability of cervical tumours. Int J Cancer, 88:698-701.

27.

Manickam

, Sivanandham

, Tourkova

. 2007. Immunological role of dendritic cells in cervical cancer. Adv Exp Med Biol, 601:155-162.

28.

Moretta

, Bottino

, Pende

et al. 2006. Surface NK receptors and their ligands on tumor cells. Semin Immunol, 18:151-158.

29.

Muñoz

, Bosch

, de Sanjosé

et al. 2003. Epidemiologic classification of human papillomavirus types associated with cervical cancer. N Engl J Med, 348:518-527.

30.

Pende

, Parolini

, Pessino

et al. 1999. Identification and molecular characterization of NKp30, a novel triggering receptor involved in natural cytotoxicity mediated by human natural killer cells. J Exp Med, 190:1505-1516.

31.

Pende

, Rivera

, Marcenaro

, Chang

et al. 2002. Major histocompatibility complex class I-related chain A and UL16-binding protein expression on tumor cell lines of different histotypes: analysis of tumor susceptibility to NKG2D-dependent natural killer cell cytotoxicity. Cancer Res, 62:6178-6186.

32.

Peng

, Trimble

, Wu

et al. 2007. HLA-DQB1*02-restricted HPV-16 E7 peptide-specific CD4+T-cell immune responses correlate with regression of HPV-16-associated high-grade squamous intraepithelial lesions. Clin Cancer Res, 13:2479-2487.

33.

Pessino

, Sivori

, Bottino

et al. 1998. Molecular cloning of NKp46: a novel member of the immunoglobulin superfamily involved in triggering of natural cytotoxicity. J Exp Med, 188:953-960.

34.

Raulet

. 2003. Roles of the NKG2D immunoreceptor and its ligands. Nat Rev Immunol, 3:781-790.

35.

Salih

, Goehlsdorf

, Steinle

. 2006. Release of MICB molecules by tumor cells: mechanism and soluble MICB in sera of cancer patients. Hum Immunol, 67:188-195.

36.

Sivori

, Vitale

, Morelli

et al. 1997. p46, a novel natural killer cell-specific surface molecule which mediates cell activation. J Exp Med, 186:1129-1136.

37.

Stanley

. 2008. Immunobiology of HPV and HPV vaccines. Gynecol Oncol, 109:S15-S21.

38.

Textor

, Durst

, Jansen

et al. 2008. Activating NK cell receptor ligands are differentially expressed during progression to cervical cancer. Int J Cancer, 123:2343-2353.

39.

Walboomers

, Jacobs

, Manos

et al. 1999. Human papillomavirus is a necessary cause of invasive cervical cancer worldwide. J Pathol, 189:12-19.

40.

Waldhauer

, Steinle

. 2008. NK cells and cancer immunosurveillance. Oncogene, 27:5932-5943.

41.

Wira

, Fahey

, Sentman

et al. 2005. Innate and adaptive immunity in female genital tract: cellular responses and interactions. Immunol Rev, 206:306-335.

42.

, Song

, Bakker

et al. 1999. An activating immunoreceptor complex formed by NKG2D and DAP10. Science, 285:730-732.