Abstract
Background: Epidemiological and experimental evidence support the role of host genetics in treatment response and viral clearance in chronic hepatitis C (CHC). Recently, the CC genotype of IL28B single-nucleotide polymorphism (SNP) rs12979860 has been associated with spontaneous viral clearance and a better treatment response. The distribution of this polymorphism varies according to populations. Frequency of rs12979860 SNP alleles in the Moroccan population is unknown. The aim of our study was to estimate the frequency of the C allele of this SNP in the Moroccan population and, in parallel, in a cohort of Moroccan patients with CHC treated with pegylated interferon-alpha and ribavirin. Methods: We used real-time polymerase chain reaction assay based on TaqMan technology to determine the allele frequency of the rs12979860 SNP in 100 Moroccan newborn infants. We also compared the frequency of the CC genotype between two groups of patients with genotype 1-CHC treated by combination therapy: group1, n=30 patients, responders who achieved sustained viral response (SVR) and group2, n=30 patients, nonresponders. Results: The rs12979860 C allele frequency was estimated to be 73% in the Moroccan population. The frequency of this allele in the group of patients with CHC was only 58.3%, and the CC genotype is more prevalent in group1 (62.5%) than in group 2. Conclusions: This is the first report providing genetic data related to the frequency of genetic polymorphisms of IL28B in Morocco. The C-allele frequency of the IL28B gene SNP rs12979860 in Morocco is higher than in the African populations. Distribution of this SNP distinguishes in a population of CHC between SVR and nonresponders. This result merits consideration and should be studied by analyzing a larger sample size of patients.
Introduction
H
In Morocco, genotype 1 of HCV is the most frequent, and response to peg-IFN-a/ribavirin (RBV) combination therapy is around 50% (Benouda et al., 2009). Distribution of the C allele of the IL28B rs12979860 SNP varies according to ethnicity. Its frequency in Morocco is unknown. In this study, we sought to determine the allele C of the IL28B rs12979860 SNP frequency in the Moroccan population and, in parallel, in a cohort of Moroccan patients with chronic HCV infection who had been treated with peg-IFN-a/RBV therapy.
Materials and Methods
Subjects
We genotyped 100 DNA samples for the rs12979860 polymorphism. Blood samples were collected from the umbilical cords of 100 unrelated newborns who originated from different regions of Morocco. The Moroccan origin of their parents and grandparents was confirmed, and informed consent was obtained. Our population was in the Hardy-Weinberg equilibrium. Genomic DNA was extracted from 3 ml using the salting-out method (Sambrook et al., 1989). In a second step, we analyzed a retrospective cohort of 60 consecutive adult Moroccan patients with CHC genotype 1, followed by the HCV team of the Department of Functional Digestive Exploration of Gastroenterology and Hepatology of the Ibn Sina Hospital of Rabat. All of these patients received 48 weeks of combination therapy with peg-IFN-a/RBV. Thirty patients were responders who had obtained SVR, and 30 were nonresponders. All patients provided written informed consent. Genomic DNA was isolated from ethylenediaminetetraacetic acid anti-coagulated peripheral blood using the Quiagen DNA isolation kit.
Genotyping
Genotyping was performed in the Department of Medical Genetics of the National Institute of Health in Rabat. Genotyping was performed with an allele-specific probe of SNP using allele-specific real-time polymerase chain reaction (PCR) (Applied Biosystems). Alleles of rs12979860 were assessed on an ABI 7500 instrument using primers rs12979860_F: GCCTGTCGTGTACTGAACCA and rs12979860_R: GCGCGGAGTGCAATTCAAC and the Taqman probes rs12979860-C: VIC-TGGTTC
Result
In the study conducted on 100 DNA samples of Moroccan newborns, the CC genotype was identified in 55 samples. The TT genotype was found in 9 DNA samples, and the remaining 36 samples were CT heterozygous. Therefore, the rs12979860 C-allele frequency in the Moroccan population was estimated to be 73%. In the cohort of 60 adult Moroccan patients with CHC, the rs12979860 C-allele frequency was 58.3%. The CC genotype, which has been associated with spontaneous clearance of virus and better treatment response in many previous studies, was identified in 16 patients. Ten of these patients (62.5%) attained SVR. The unfavorable SNP genotype (TT) was found in six patients, and four of them were nonresponders. The remaining 38 patients were CT heterozygous, and 20 (52.6%) of them exhibited SVR.
Discussion
Accumulating epidemiological and experimental evidence suggest that human genetic factors play an essentially important role in immunodeficiency and susceptibility to infectious diseases, as seen in malaria and pulmonary tuberculosis (Allison, 2009; Casanova and Abel, 2007). In hepatitis C, several findings support the role of host genetics in the immune response, which may predict treatment response and viral clearance (Lloyd et al., 2007; Szabo and Dolganiuc, 2008). Genome-wide association studies in independent populations have confirmed that IL28B genetic variations are associated with a virologic response to peg-IFN and ribavirin therapy and spontaneous clearance of HCV (Ge et al., 2009; Thomas et al., 2009; Imazeki et al., 2010). Ge et al. identified a genetic polymorphism (rs12979860) near the IL28B gene on chromosome 19. Individuals with the CC genotype are twice as likely to respond to peg-IFN and ribavirin treatment compared with those with the TT genotype, both in patients of European origin and African-Americans (Ge et al., 2009). Thomas et al. (2009) compared the rs12979860 variation in HCV cohorts of individuals who spontaneously cleared the virus or had persistent infection, and found that patients with the CC genotype were associated with higher treatment response and were thrice more likely to clear the virus compared with patients with CT and TT genotypes of European and African origin. In addition, they analyzed the frequency of the rs12979860 C allele by genotyping 2371 individuals from 51 populations over the world and revealed a remarkable and overall tendency of allele frequencies: higher frequency in East Asia (>90%), lower frequency in Africa (<50%), and intermediate frequency in Europe (Thomas et al., 2009). This overall difference in allele frequency could explain the different frequencies in viral clearance and response to treatment in these populations.
In our study, we determined the frequency of the IL28B gene SNP rs12979860 C allele in the Moroccan population, which is 73%. This frequency is higher than in African populations and is more comparable to the Caucasian population. It was previously revealed that North-west Africans were genetically closer to Iberians and to other Europeans than to African-Americans (Bosch et al., 2000). In addition, we determined the genotypes and allele frequency of this SNP in Moroccan patients with chronic HCV infection who had been treated with peg-IFN-a/RBV combination therapy, and we compared this frequency between the two groups. In our cohort, the rs12979860 C allele frequency was 58.3%. This deficiency of C allele in the group of patients compared with the frequency in newborns could be explained by spontaneous viral clearance. The CC genotyped was indentified in 16 patients, and 10 of them (62.5%) had attained SVR. As expected, the CC genotype is more prevalent in the group with SVR compared with the group of nonresponders. This finding merits consideration for a study with a larger sample size of patients.
Conclusion
This is the first report providing genetic data related to the frequency of genetic polymorphisms of IL28B in Morocco. Our results show that the C-allele frequency of the IL28B gene SNP rs12979860 in Morocco is higher than in the African populations and is close to those of Caucasians. The distribution of this SNP distinguishes between healthy populations and patients with chronic HCV infection. The distribution of genotypes of IL28B rs12979860 in the population with chronic HCV infection with genotype 1 and with SVR and in nonresponders is similar to the data of previous reports. Due to its significant involvement in the response to treatment of CHC, genetic testing for IL28B SNP rs12979860 before antiviral therapy should be suggested.
Footnotes
Author Disclosure Statement
No competing financial interests exist.
