ACE and AGTR1 Polymorphisms in Elite Rhythmic Gymnastics

Abstract

In the angiotensin-converting enzyme (ACE) gene, Alu deletion, in intron 16, is associated with higher concentrations of ACE serum activity and this may be associated with elite sprint and power performance. The Alu insertion is associated with lower ACE levels and this could lead to endurance performance. Moreover, recent studies have identified a single-nucleotide polymorphism of the angiotensin type 1 receptor gene AGTR1, which seems to be related to ACE activity. The aim of this study was to examine the involvement of the ACE and the AGTR1 gene polymorphisms in 28 Italian elite rhythmic gymnasts (age range 21±7.6 years), and compare them to 23 middle level rhythmic gymnasts (age range 17±10.9 years). The ACE D allele was significantly more frequent in elite athletes than in the control population (χ²=4.07, p=0.04). Comparisons between the middle level and elite athletes revealed significant differences (p<0.0001) for the ACE DD genotype (OR=6.48, 95% confidence interval=1.48-28.34), which was more frequent in elite athletes. There were no significant differences in the AGTR1 A/C genotype or allele distributions between the middle level and elite athletes. In conclusion, the ACE D allele genotype could be a contributing factor to high-performance rhythmic gymnastics that should be considered in athlete development and could help to identify which skills should be trained for talent promotion.

Introduction

In the last decade, the relationships between elite sport performance and genetic predisposition has been widely explored (Moran et al., 2006; Hagberg et al., 2011). Every year, the number of genetic polymorphisms that are candidates to explain individual variations in sports performance is increasing (Bray et al., 2009). The local renin angiotensin system (RAS), which is involved in a variety of cellular functions, including tissue growth and repair, may also influence motor performance. Genes encoding components of the endocrine RAS play an important role in controlling the angiotensin-converting enzyme (ACE) levels as well as angiotensin II (ANG II) expression and function (Fatini et al., 2000). ACE insertion/deletion (I/D) polymorphism was the first specific gene variant to be associated with human performance (Montgomery et al., 1998). In the last 12 years, many studies have shown (e.g., Puthucheary et al., 2011), that the absence of a 287 base-pair fragment (deletion - D allele), rather than its presence (insertion of a 287 base-pair, I allele), is associated with elevated circulating plasma and ACE tissue activity (Danser et al., 1995; Williams et al., 2005), and with ANG II-induced hypertrophy of the skeletal muscle (Zhang et al., 2003; Kasikcioglu et al., 2004; Juffer et al., 2009). Moreover, recent studies have identified a single-nucleotide polymorphism of the angiotensin type 1 receptor gene, which seems to be related to increased ANG II sensitivity (Spiering et al., 2000). This polymorphism consists of a transversion A>C in position 1166 (A¹¹⁶⁶C). This C1166 variant has been associated with hypertension in humans (Bonnardeaux et al., 1994) and with left ventricular hypertrophy, in the presence of ACE DD (Di Mauro et al., 2010). To better understand the reason for the variable effects of ACE genotypes on sport performance, it may also be useful to study the AGTR1, which mediates all physiological effects of ANG II (vasoconstriction and catecholamine liberation).

It was demonstrated that the D allele variant of the ACE gene is found in athletes of sports characterized by sprint and power performance (Costa et al., 2009; Papadimitriou et al., 2009), instead of the I allele, which is found in endurance athletes (Scanavini et al., 2002; Tanriverdi et al., 2005). A high frequency of I was found in elite long-distance runners and rowers (Gayagay et al., 1998; Myerson et al., 1999; Alvarez et al., 2000; Hruskovicová et al., 2006).

It is well known that the athletes' responses to the physical loads in training are variable and strongly mediated by genetic variation (Bouchard et al., 1999). Nevertheless, several sport disciplines, like gymnastics, require mixed skills, and the identification of a particular genetic polymorphism associated with a high-level performance could help in the athletes' development. Rhythmic and artistic gymnastics, are classified as power performance, because they are based on technical movements performed at high velocity and power, where the high intensity and relative short duration of performance require, primarily, the intervention of an anaerobic mechanism. Rapid muscle contractions are necessary for jumping and for performing many technical movements of rhythmic gymnastics. At this time, no association study has been published on elite rhythmic gymnasts for this polymorphism.

The aim of this study was to test the involvement of the ACE I/D and the AGTR1 A1166C gene polymorphisms in a sample of Italian National rhythmic gymnasts, World Rhythmic Gymnastics Champions, for the years 2009, 2010, and 2011, and in a sample of a middle-level gymnasts with respect to a control population. Knowledge regarding this genotype could help early identification of an athlete's phenotype trait, and aid high-level training for competitions. Furthermore, this study could give information about the main skills and physical characteristics, which should lead to an exceptional performance, in rhythmic gymnastics.

Materials and Methods

Subjects

The study protocol was approved by our institutional ethics committee, and was in accordance with the Declaration of Helsinki for Human Research of 1974 (last modified in 2000) and Title 45, U.S. Code of Federal Regulations, Part 46, Protection of Human Subjects (revised November 13, 2001, effective December 13, 2001). This study was designed and performed in accordance with the recommendations for the human genotype-phenotype association studies recently published by the NCI-NHGRI Working Group on Replication in Association Studies (NCI-NHGRI Working Group, 2007). All participants and their parents (or legal guardians) received a full written description of the nature of the study and signed an informed consent form before participating.

Fifty-one gymnasts, of two different technical levels, were enrolled for the study. Twenty-eight elite athletes (age range 21±7.6 years) were competing at the international level, World Champions in Miè (2009), in Moscow (2010), and in Montpellier (2011). They underwent 8-h training sessions every day, with one and a half rest days per week (Thursday afternoon and Sunday). The direct control group consisted of twenty-three mid-level gymnasts, (age range 17±10.9 years) competing at a national level in the premier league of the Italian Gymnastics Federation (FGI). They underwent 4/5-h training sessions per day, with one rest day per week (Sunday). The following exclusion criteria were applied: gymnastics training for <5 years, not a member of the Italian Gymnast Federation, health problems, or injuries. All gymnast characteristics are reported in Table 1.

Table 1.

Sample Characteristics

	Elite athletes (n=28) Mean±standard deviation	Mid-level athletes (n=23) Mean±standard deviation
Age (years)	20.6±7.5	17.2±10.9
Height (m)	1.65±0.10	1.54±0.09
Weight (kg)	46.02±8.72	36.66±6.44
Body mass index (kg/m²)	16.77±1.68	15.46±1.27
Training days	6	5.6±0.5
Training hours	6.94±1.39	4.25±0.79
Races number	59.78±24.22	51.75±24.99
Best results	Worldwide, Olympics, European, National	Interregional, National

Allele frequencies, calculated for ACE and AGTR1 genes were compared with similar historical data obtained from the Italian population n=222 and from European population n=72 (Rajeevan et al., 2003).

DNA extraction and genotyping

DNA was isolated, after a mouth wash, from the buccal cells of each subject by following a standard protocol of a specific kit (Norgen Biotek Corporation, Thorold, ON, Canada). The extraction was performed under sterile conditions, ensuring that new materials and equipment were used for each subject so as to prevent contamination. Samples were quantified by spectrophotometric readings at 260 nm, using the Nanodrop (Thermo Fisher Scientific, Madison, WI), and were then diluted to 60 ng/μL to analyze approximately the same amount of DNA. The extracted DNA was stored at 4°C until subsequent genotyping. The ACE I/D polymorphism was typed using polymerase chain reaction (PCR)-based amplification. This method has been applied in many previous studies (e.g., Shanmugam et al., 1993; Santiago et al., 2010).

To avoid ID or DD mistyping, we re-amplified only the DNA samples that typed as DD using the standard amplification procedure in the presence of an insertion-specific primer: 5′ TTTGAGACGGAGTCTCGCTC 3′ and a positive control (ID/II). This procedure allowed us to identify the ID genotypes that were mistyped as DDs during the first amplification. Using this additional amplification, the typing of the DD and ID polymorphisms is accomplished with 100% accuracy, and satisfied to the recent recommendations for replicating genotype-phenotype association studies (NCI-NHGRI Working Group, 2007). Allelic analysis of the ACE gene was examined by size fractionation of the PCR product through a 1.5% agarose/1× TAE (0.04M Tris-acetate, 0.001M EDTA) gel containing 0.5 μg/mL ethidium bromide. A 100-bp ladder was added, in the first well, to provide a standard measurement to evaluate the molecular weight of bands in experimental samples. Genotyping of AGTR1 A1166C polymorphisms was carried out by PCR, followed by DdeI digestions and agarose electrophoresis as previously described (Takemoto et al., 1998). Following the NCI-NHGRI Working Group recommendations, we amplified and digested each sample in duplicate.

There were three possible genotypes of the AGTR1 gene, AA, AC, and CC. The A allele that lacked the enzyme-restriction site was designated as the larger fragment (359 bp). The C allele that had an enzyme-restriction site at nucleotide position 1166 was designated as smaller fragments (220 and 139 bp). No failures occurred in sample collection and DNA acquisition.

Results

Statistical analysis was performed using the SPSS software (version 17.0 SSPS, Inc., Chicago, IL). The allele frequencies were calculated using the method of gene-counting. The χ² test was used to measure the Hardy-Weinberg equilibrium for genotype distribution among elite gymnasts and middle-level athletes. The odds ratio was calculated with a confidence interval (CI) of 95%. For these analyses, a dominant model for the allele D in the ACE gene and allele A in the AGTR1 gene was assumed. Table 2 shows the results of allele and genotype frequencies for the ACE and AGTR1 polymorphisms studied, and in the reference Italian and European populations compared to middle-level and elite athletes. All genotype distributions were in Hardy-Weinberg equilibrium. There were no significant differences in ACE allele distributions between the Italian population and the middle-level athletes. The ACE I allele was significantly more frequent in the Italian population than in elite athletes (χ²=4.05, p=0.04). The ACE D allele was significantly more frequent in elite athletes than in the Italian population (χ²=4.07, p=0.04). Comparisons between middle-level and elite athletes revealed significant differences (p<0.0001) for the ACE DD genotype (OR=6.48, 95% CI=1.48-28.34), which was more frequent in elite athletes. There were no significant differences in AGTR1 A/C genotypes or allele distributions between the middle-level and elite athletes. In Table 3, ACE allele frequencies between elite athletes (artistic gymnastics and athletics sprinting from published data) and the rhythmic gymnasts of the present study are compared. Significant differences were found in the ACE genotype between data obtained from Massidda et al. in the artistic gymnastics and elite rhythmic gymnasts of our study. Furthermore, no differences were found between elite rhythmic gymnasts, sprint athletes (Nazarov et al., 2001), and artistic gymnasts (Astratenkova et al., 2007). Results obtained in middle-level athletes are similar to results obtained by Myerson et al. in sprinting athletes and by Massidda et al. in artistic gymnasts.

Table 2.

Angiotensin-Converting Enzyme and Angiotensin Receptor-Type 1 Allele Frequency and Genotype Distribution, Among Gymnasts and Controls

Gene	SNP ID	Genotype	Italian population n=222	Mid-level n=23	Elite athletes n=28	χ²	p-Value^a	p-Value^b
		I	34%	48%	21%	4.05	0.04
ACE	rs 4646994	D	66%	52%	78%	4.07	0.04
		II		17% (4)	7% (2)
		ID		60% (14)	28% (8)
		DD		22% (5)	64% (18)
		DD vs. ID+II^c		OR=6.4895% CI=1.48-28.34		15.8		0.0001

Gene	SNP ID	Genotype	European population n=72	Mid-level n=18	Elite athletes n=28	χ²	p-value^a	p-value^b
		A	65%	80%	71%
AGTR1	rs 5186	C	35%	20%	29%	0.83	0.36
		AA		66% (12)	50% (14)
		AC		27% (5)	42% (12)
		CC		5% (1)	8% (2)
		AA vs AC+CC^c		OR=0.6195% CI=0.31-1.18		0.91		0.34

Allele and genotype frequencies are indicated in percentages (absolute values).

Test of comparison of allele frequencies between Italian/European population and elite athletes.

Test of comparison of allele frequencies between mid-level and elite athletes assuming a dominant model.

For these analyses, a dominant model for allele D in ACE gene, and allele A in AGTR1 gene was assumed.

ACE, angiotensin-converting enzyme; CI, confidence interval.

Table 3.

Angiotensin-Converting Enzyme Genotype and Allele Frequencies Among Gymnasts and Reference Data from Different Sprinting Sports

Genotype	Myerson et al. Athletics sprinting (n)	Nazarov et al. Athletics sprinting (n)	Astratenkova et al. Artistic gymnastics	Massidda et al. Artistic gymnastics (n)	Present study Mid-level rhythmic gymnastics (n)	Present study Elite rhythmic gymnastics (n)
I	46%	25%	25%	36%	48%	21%
D	54%	75%	75%	64%	52%	78%
II	23% (3)	7% (1)		12% (4)	17% (4)	7% (2)
ID	46% (6)	36% (5)		48% (16)	60% (14)	28% (8)
DD	31% (4)	57% (8)		39% (13)	22% (5)	64% (18)

Discussion

The main result of the study was the association between the ACE D allele and elite rhythmic athletes. The ACE D allele may be associated with better sprint and power performance (Williams et al., 2005). In response to mechanical loads, the D allele has been associated with a high level of activity of the ACE enzyme in plasma and tissue and, consequently, with a greater probability that power performance will improve, (Myerson et al., 1999) and that muscular hypertrophy will develop in these athletes (Gordon et al., 2001). This molecular characterization could be very useful in identifying talent and in the training of rhythmic gymnastics athletes. It is known that the baseline performance was independent of the ACE genotype, unlike improvements in performance with training, which were strongly genotype-dependent (Puthucheary et al., 2011). There is evidence that the characteristics responsible for exceptional performance are innate; However, they must be completed by laborious training for ability development (Ericsson et al., 1993). The present study showed a significantly higher frequency of the ACE D allele and the DD genotype in elite rhythmic gymnasts, compared to the middle-level athletes and the general population. No significant differences were found in ACE I/D alleles between the Italian population and middle-level athletes. Other studies have also found that associations with ACE I or D alleles were more frequent in elite athletes than in middle-level or control populations (Boraita et al., 2010). For middle-level gymnasts, it is possible that sprint could be important, but not the prime determinant of middle-level success (Costa et al., 2009; Papadimitriou et al., 2009). Several research articles showed that the D allele variant of the ACE gene is associated to sports characterized by sprint and power performance (Costa et al., 2009; Papadimitriou et al., 2009), so sprint and power must be one of the hallmarks for rhythmic gymnastics ability.

In a previous study (Di Cagno et al., 2008), we demonstrated that power and stiffness were talent indicators that could distinguish elite from middle-level gymnasts. To date, very little is known about the frequencies of the ACE genotypes in rhythmic gymnasts, and no data are available for the world champions in this sport. Other studies investigated the association between genetic variation and artistic gymnastics performance, but no significant differences were found in the allele distribution of genotype and in the allele frequencies of the ACE I/D polymorphism (Massidda et al., 2011). Conflicting data about the association of the ACE I/D polymorphism and athletic performance exist, especially in studies in which elite athletes were recruited from sports with mixed metabolic capacity, like artistic and rhythmic gymnastics (Rankinen et al., 2000). Probably, the variation in results may be due to different population samples for age, gender, and fitness level.

Furthermore, it seems that the ACE DD genotype, associated with an enhanced production of ANG II, may favorably confer a protective effect against strenuous exercise and induced muscle injury (Yamin et al., 2007). This could be useful, considering that power and plyometric exercises in rhythmic gymnastics are based on the stretch-shortening cycle and eccentric contractions.

With respect to AGTR1 allele distribution, we did not find a statistically significant difference in the genotype distributions and allele frequencies of the elite athletes matched with the control population. We hypothesize that, in the presence of different ACE allelic variants, AGTR1 do not have an important role in determining sport performance.

The limitations of this study could be the following: the first is the sample size that should preclude drawing firm conclusions. Nevertheless, identifying a cohort of elite athletes will never yield massive numbers (Jones et al., 2002). The second limitation should be the various genetic variants that we did not include in the present study. A complex sport activity, like rhythmic gymnastics, may not be determined by a single gene, but from the interaction of more genes, in addition of other nongenetic factors that could explain the different results (Gordon et al., 2001; Sessa et al., 2011). The third limitation is that we considered only Italian athletes. Other research is needed in different ethnicities.

Our results are by no means an exhaustive solution for talent promotion, because we know that the gene represents approximately only 50% of athletic variation in performance, with the other 50% attributable to individual response to training, social factors, and support provided to athletes in pursuit of their goal (Sessa et al., 2011). The complex trait of being an athletic champion depends on many factors (Ruiz et al., 2009). Nevertheless, these results could help to find some of the main skills that should be trained for talent promotion in this sport.

Footnotes

Acknowledgments

This study has been supported by the Department of Medicine and Health Sciences of the University of Molise.

Author Disclosure Statement

No competing financial interests exist.

References

Alvarez

, Terrados

, Ortolano

et al. 2000. Genetic variation in the renin-angiotensin system and athletic performance. Eur J Appl Physiol, 82:117-120.

Astratenkova

, Ahmetov

, Yushin

et al. 2007 Genetic research in artistic gymnastics, (Congress Proceeding) 12th Annual Congress of the ECSS, Jyväskylä, Finland.

Bonnardeaux

, Davies

, Jeunemaitre

et al. 1994. Angiotensin II type 1 receptor gene polymorphisms in human essential hypertension. Hypertension, 24:63-69.

Boraita

, de la Rosa

, Heras

et al. 2010. Cardiovascular adaptation, functional capacity and angiotensin-converting enzyme I/D polymorphism in elite athletes. Rev Esp Cardiol, 63:810-819.

Bouchard

, An

, Rice

et al. 1999. Familial aggregation of VO(2max) response to exercise training: results from the HERITAGE family study. J Appl Physiol, 87:1003-1008.

Bray

, Hagberg

, Pérusse

et al. 2009. The human gene map for performance and health-related fitness phenotypes: the 2006-2007 update. Med Sci Sports Exerc, 41:35-73.

Costa

, Silva

, Garrido

et al. 2009. Association between ACE D allele and elite short distance swimming. Eur J Appl Physiol, 106:785-790.

Danser

, Schalekamp

, Bax

et al. 1995. Angiotensin-converting enzyme in the human heart. Effect of the deletion/insertion polymorphism. Circulation, 92:1387-1388.

Di Cagno

, Baldari

, Battaglia

et al. 2008. Leaping ability and body composition in rhythmic gymnasts for talent identification. J Sports Med Phys Fitness, 48:341-346.

10.

Di Mauro

, Izzicupo

, Santarelli

et al. 2010. ACE and AGTR1 polymorphisms and left ventricular hypertrophy in endurance athletes. Med Sci Sports Exerc, 42:915-921.

11.

Ericsson

, Krampe

, Tesh-Romer

. 1993. The role of deliberate practice in the acquisition of expert performance. Psychol Rev, 100:363-406.

12.

Fatini

, Guazzelli

, Manetti

et al. 2000. RAS genes influence exercise-induced left ventricular hypertrophy: an elite athletes study. Med Sci Sports Exerc, 32:1868-1872.

13.

Gayagay

, Yu

, Hambly

et al. 1998. Trent RJ. Elite endurance athletes and the ACE I allele—the role of genes in athletic performance. Hum Genet, 103:48-50.

14.

Gordon

, Davis

, Carlson

et al. 2001. ANG II is required for optimal overload-induced skeletal muscle hypertrophy. Am J Physiol Endocrinol Metab, 280:E150-E159.

15.

Hagberg

, Rankinen

, Loos

et al. 2011. Advances in exercise, fitness, and performance genomics in 2010. Med Sci Sports Exerc, 43:743-752.

16.

Hruskovicová

, Dzurenková

, Selingerová

et al. 2006. The angiotensin converting enzyme I/D polymorphism in long distance runners. J Sports Med Phys Fitness, 46:509-513.

17.

Jones

, Montgomery

, Woods

. 2002. Human performance: a role for the ACE genotype? Exerc Sport Sci Rev, 30:184-190.

18.

Juffer

, Furrer

, González-Freire

et al. 2009. Genotype distributions in top-level soccer players: a role for ACE? Int J Sports Med, 30:387-392.

19.

Kasikcioglu

, Kayserilioglu

, Ciloglu

et al. 2004. Angiotensin-converting enzyme gene polymorphism, left ventricular remodeling, and exercise capacity in strength-trained athletes. Heart Vessels, 19:287-293.

20.

Massidda

, Vona

, Calò

. 2011. Lack of association between ACE gene insertion/deletion polymorphism and elite artistic gymnastic performance of Italian gymnasts. Eur J Sport Sci, 11:149-153.

21.

Montgomery

, Marshall

, Hemingway

et al. 1998. Human gene for physical performance. Nature, 393:221-222.

22.

Moran

, Vassilopoulos

, Tsiokanos

et al. 2006. The associations of ACE polymorphisms with physical, physiological and skill parameters in adolescents. Eur J Hum Genet, 14:332-339.

23.

Myerson

, Hemingway

, Budget

et al. 1999. Human angiotensin I-converting enzyme gene and endurance performance. J Appl Physiol, 87:1313-1316.

24.

Nazarov

, Woods

, Montgomery

et al. 2001. The angiotensin converting enzyme I/D polymorphism in Russian athletes. Eur J Hum Genet, 9:797-801.

25.

NCI-NHGRI Working Group on Replication in Association Studies. 2007. Replicating genotype-phenotype associations. Nature, 447:655-660.

26.

Papadimitriou

, Papadopoulos

, Kouvatsi

et al. 2009. The ACE I/D polymorphism in elite Greek track and field athletes. Sports Med Phys Fitness, 49:459-463.

27.

Puthucheary

, Skipworth

, Rawal

et al. 2011. The ACE gene and human performance: 12 years on. Sports Med, 41:433-448.

28.

Rajeevan

, Osier

, Cheung

et al. 2003. ALFRED—the Allele Frequency Database—update. Nucleic Acids Res, 31:270-271.

29.

Rankinen

, Wolfarth

, Simoneau

et al. 2000. No association between the angiotensin-converting enzyme ID polymorphism and elite endurance athlete status. J Appl Physiol, 88:1571-1575.

30.

Ruiz

, Gómez-Gallego

, Santiago

et al. 2009. Is there an optimum endurance polygenic profile? J Physiol, 587:1527-1534.

31.

Santiago

, Ruiz

, Muniesa

et al. 2010. Does the polygenic profile determine the potential for becoming a world-class athlete? Insights from the sport of rowing. Scand J Med Sci Sports, 20:e188-e194.

32.

Scanavini

, Bernardi

, Castoldi

et al. 2002. Increased frequency of the homozygous II ACE genotype in Italian Olympic endurance athletes. Eur J Hum Genet, 10:576-577.

33.

Sessa

, Chetta

, Petito

et al. 2011. Gene polymorphisms and sport attitude in Italian athletes. Genet Test Mol Biomarkers, 15:285-290.

34.

Shanmugam

, Sell

, Saha

. 1993. Mistyping ACE heterozygotes. PCR Methods Appl, 3:120-121.

35.

Spiering

, Kroon

, Fuss-Lejeune

et al. 2000. Angiotensin II sensitivity is associated with the angiotensin II type 1 receptor A(1166)C polymorphism in essential hypertensives on a high sodium diet. Hypertension, 36:411-416.

36.

Takemoto

, Sakatani

, Takami

et al. 1998. Association between angiotensin II receptor gene polymorphism and serum angiotensin converting enzyme (SACE) activity in patients with sarcoidosis. Thorax, 53:459-462.

37.

Tanriverdi

, Evrengul

, Tanriverdi

et al. 2005. Improved endothelium dependent vasodilation in endurance athletes and its relation with ACE I/D polymorphism. Circ J, 69:1105-1110.

38.

Williams

, Folland

, Gohlke

et al. 2005. Circulating. Angiotensin converting enzyme activity is correlated with muscle strength. Med Sci Sports Exerc, 37:944-948.

39.

Yamin

, Amir

, Sagiv

et al. 2007. ACE ID genotype affects blood creatine kinase response to eccentric exercise. J Appl Physiol, 103:2057-2061.

40.

Zhang

, Tanaka

, Shono

et al. 2003. The I allele of the angiotensin-converting enzyme gene is associated with an increased percentage of slow-twitch type I fibers in human skeletal muscle. Clin Genet, 63:139-144.