Association Study of Three Microsatellite Polymorphisms Located in Introns 1,8,and 9 of DISC1 with Schizophrenia in the Chinese Han Population

Abstract

Aims: This study explores more polymorphisms in Disrupted-in-schizophrenia-1 (DISC1) for schizophrenia, which confer risk of developing the disorder. Results: We report three short tandem repeat (STR) loci ((ATCC)_n1, D1S1621, and (ATCC)_n2) in DISC1 that showed a significant association with schizophrenia in a set of Chinese Han individuals, including 310 schizophrenics and 400 controls. The STRs in DISC1 associated with schizophrenia occur in intronic sequences in the vicinity of a critical splice junction that gives rise to the expression of DISC1 isoforms. The frequencies of allele 12 of (ATCC)_n1, alleles 11 and 12, allele 13 and allele 15 of D1S1621, and allele 10 of (ATCC)_n2 were significantly higher in schizophrenia patients than in controls. In contrast, the frequencies of alleles 9 and 10 of (ATCC)_n1 and allele 16 and alleles17 and 18 of D1S1621 were significantly lower in schizophrenia patients than in controls. Conclusions: Our results provide further evidence for an effect of the DISC1 gene on the etiology of schizophrenia and suggest that STRs in the DISC1 gene may be genetic risk factors for schizophrenia.

Introduction

Schizophrenia is a typical complex disorder. DISC1 (disrupted-in-schizophrenia-1) is a candidate gene for schizophrenia first identified in a schizophrenia family with the chromosome translocation t(1,11) (q42.1;q14.3) (Stclair et al., 1990; Millar et al., 2000). Several genetic associations were identified and functional characterization of the gene products was performed, but no firm evidence for a contribution of the DISC locus to schizophrenia has been identified to date. Different polymorphisms in the gene may play pathogenic roles in different populations (Bradshaw and Porteous, 2010).

DISC1 is strongly expressed in the brains of mammals, including humans (Schurov et al., 2004; Kirkpatrick et al., 2006; Young-Pearse et al., 2010). The translocation affecting DISC1 causes a loss of the C-terminal 257 amino acids from the DISC1 protein (Millar et al., 2000). Mutant DISC1 is proposed to contribute to schizophrenia susceptibility by disrupting intracellular transport, neurite modeling, neuronal migration, and proper development of the cerebral cortex (Morris et al., 2003; Ozeki et al., 2003; Cannon et al., 2005). Given the importance of the hippocampus, the prefrontal cortex and other brain regions in schizophrenia pathogenesis, expression of the mutant DISC1 protein within key brain regions may lead to schizophrenia. Thus, it has been proposed that DISC1 contributes to abnormal neurite sprouting as an etiological factor underlying schizophrenia (Bellon, 2007), providing a mechanistic explanation for the characteristic cognitive deficits of the disease (Mackie et al., 2007).

The correlation between DISC1 and schizophrenia has been widely studied. By analyzing schizophrenia family samples originating from an internal isolate of Finland and population-based samples from around Finland, Ekelund et al. (2001, 2004) found significant evidence of linkage at D1S2709 (Zmax=2.71), D1S251, D1S1621, and D1S3462. Haplotype transmission also showed that the DISC1 gene is involved in the etiology of schizophrenia (Hennah et al., 2003). Furthermore, D1S251 was located close to the breakpoint of a balanced translocation t(1,11) (q42.1;q14.3) involving DISC1 also observed in Taiwanese schizophrenia families (Hwu et al., 2003). D1S3462 was negatively correlated with schizophrenia in a small sample from Africa, America, and Europe (Chen et al., 2007). The results of a genetic association study also showed an association between DISC1 and schizophrenia in a variety of ethnic populations, including European, Japanese, Korean, Chinese, French, and Algerian (Kockelkorn et al., 2004; Chen et al., 2007; Kim et al., 2008; Schumacher et al., 2009; Lepagnol-Bestel et al., 2010).

Based on these findings, the DISC1 gene is a recognized risk factor for schizophrenia. Although several highly polymorphic microsatellite markers have been reported, results are variable among ethnic groups. Therefore, we aimed to analyze these microsatellite sites to identify new polymorphic DNA markers for association analyses. In the present study, we performed whole-gene scanning and DNA sequencing to screen and characterize polymorphic microsatellite sites in DISC1 in a case-control sample, including 310 schizophrenia patients and 400 controls from the Chinese western Han population in an attempt to identify sites associated with schizophrenia.

Materials and Methods

DNA sample procurement

All samples used in this study were Chinese Han individuals from the Shaanxi Province, with no migration history within the previous three generations. The case samples were 310 random unrelated schizophrenia patients (144 male and 166 female; age range: 16-62) who were being treated at the Medical Examination Center of First Affiliated Hospital of the Xi'an Jiaotong University. The diagnosis was established using DSM-IV (American Psychiatric Association. Task Force on DSM-IV., 2000) independently by two psychiatrists. No other psychiatric disorders were diagnosed. About 400 random unrelated blood donors were used as controls (200 male and 200 female, age range: 20-51), and they were diagnosed with no psychiatric diseases by the two psychiatrists. All donors were from the west area of China. The objective of the study was clearly explained, and written informed consent was obtained from all participants. The study was approved by the local Medical Ethics Committee.

Selection of microsatellite genetic markers

Whole-gene scanning was performed to identify microsatellite sites in DISC1 using SSRHunter software (www.biosoft.net) (Li and Wan, 2005). Microsatellite sequences were selected according to the following criteria (Yan and Hou, 2004): (1) the repeat unit is 3-4 bp long; (2) the core sequence is strictly regular repeats; (3) there is only one repeat unit contained in each fragment, which means only one motif is included; and (4) the repeat number of the core sequence is ≥5. Based on the results of a search using RepeatMask software (http//:ftp.genome.Washington.edu:80/cgi-bin/RepeatMasker), we confirmed that the microsatellite sites screened according to the above criteria did not belong to the Alu family or other repetitive sequences. The seven candidate microsatellite sequences of the DISC1 gene selected using the SSRHunter software distribute in different introns (see Fig. 1).

FIG. 1.

Schematic diagram of the 1q42 region showing the structure of the DISC1 gene. The analyzed short tandem repeats (STRs) are also shown with respect to the intronic structure of the gene. Bold markers below the gene indicate STRs that are involved in the association findings reported here. Italic markers are nonpolymorphic. Ex=exon; In=intron.

Genotyping

Peripheral blood (3-5 mL) was collected from each participant and placed in ethylenediaminetetraacetic acid-containing specimen tubes. Genomic DNA was extracted using the TIANamp Blood DNA Kit (TIANGEN, Beijing, China) and stored at −20°C until use.

We designed specific primers for all seven candidate microsatellite sites using Primer 5.0 software. A polymerase chain reaction (PCR) was carried out in a total volume of 15 μL containing 50-300 ng of genomic DNA, 200 μM dNTPs, 10 μM primer, 15 mM MgCl₂, and 0.5 U of Taq polymerase (TIANGEN). Products were separated on 6% polyacrylamide gels and silver-stained to check for the presence of the microsatellite sites. Three polymorphic short tandem repeat (STR) loci were genotyped using fluorescently labeled PCR primers (the PCR primers used to amplify the three loci are shown in Table 1) and analyzed separately on a DNA sequencer (ABI PRISM 377; Applied Biosystems, Foster City, CA) using appropriate size markers (ROX-350). GeneScan 3.0 and Genotyper 2.1 software were used to analyze STR data. The alleles were named according to the number of repeats (Kimmel and Chakraborty, 1996).

Table 1.

Information and Primers of the Three Loci in the disc1 Gene

Name	Region	Repeats	Chromosome position^a	PCR product(bp)	Allele		Primers	Annealing
(ATCC)_n1	intron1	ATCC	231799787-231799932	141-161	9,10,11,12,13,14	F	5′ CTGTTTACTTTTGTGAGC 3′	55.9°C, 45 s
						R	5′ CTTAGACTGTTGTGATGG 3′
D1S1621	intron8	AAT	231950685-231950851	157-178	11,12,13,14,15,16,17,18	F	5′ TATAACCACTGCATCCTGACC 3′	59.3°C, 30 s
						R	5′ TTTCTCACCTTTAAATGTCATCA 3′
(ATCC)_n2	intron9	ATCC	231960623-231960822	195-215	8,9,10,11,12,13,14	F	5′ GGTCTCAGTTGCTTCATA 3′	57°C, 45 s
						R	5′ AGCCACAGGGACTATCTA 3′

Chromosome positions were based on the UCSC version hg19.

Statistical analysis

The Hardy-Weinberg equilibrium was examined in cases and controls using the chi-square test. Differences and potential association of allelic frequencies between tested samples and controls were evaluated using two-tailed tests of the Fisher's exact test or the Pearson's chi-square test. We set the nominal significance threshold to p=0.05. The odds ratios (ORs) and 95% confidence intervals (CIs) for risk alleles were also calculated. To avoid misleading results caused by rare alleles, all alleles with a frequency of ≤5% in both cases and controls were defined as rare and clumped together for calculation of ORs. All statistical analyses were carried out using SPSS16.0 software. Bonferroni correction is applied for multiple statistical tests. We also tested the linkage disequilibrium between the three STRs using Arlequin3.5 software.

Results

Three of the seven candidate microsatellite sites loci were found to be polymorphic, including two novel STRs, (ATCC)_n1 and (ATCC)_n2, and D1S1621, which has been studied by other researchers.

For each locus, the Hardy-Weinberg equilibrium was tested by comparing the observed and expected allele numbers. No deviations from the Hardy-Weinberg equilibrium were observed in the schizophrenia and control groups. The distribution of allele frequencies and the results of statistical analyses of the three STRs are shown in Table 2.

Table 2.

The Distribution of Allele Frequencies of the Str Polymorphisms in disc1 in Schizophrenia Cases and Controls, and p Values for Association with Disease

	(ATCC)_n1		D1S1621		(ATCC)_n2
Allele ^a	Control	Schizophrenia	Control	Schizophrenia	Control	Schizophrenia
8					0.095
9	0.028	0.002			0.006
10	0.111	0.040			0.035	0.066
11	0.504	0.484		0.006	0.641	0.700
12	0.310	0.426	0.011	0.085	0.128	0.116
13	0.044	0.048	0.084	0.232	0.095	0.108
14	0.003		0.293	0.213		0.010
15			0.201	0.318
16			0.346	0.131
17			0.064	0.013
18			0.001	0.002
X²	54.557		2.147e2		61.477
p ^b	4.83e-11^*		9.01e-43^*		6.02e-12^*
Corrected p^c	0.003		0.001		0.003

The alleles are named according to the number of repeats.

Differences and potential association in allelic distributions evaluated using the two-tailed Fisher's exact test, p<0.05 is considered significant.

The p-value for the mutiple test is corrected using Bonferroni correction.

The p-value is statistically significant.

Statistically significant differences were observed between the two groups with respect to the allele frequencies of (ATCC)_n1, D1S1621 and (ATCC)_n2 (p<0.003) (see Table 2). The frequencies of allele 12 of (ATCC)_n1 (OR=1.644), alleles 11 and 12 (OR=8.909), allele 13 (OR=3.314), and allele 15 (OR=1.851) of D1S1621, and allele 10 of (ATCC)_n2 (OR=1.602) were significantly higher in schizophrenia patients than in controls. The frequencies of alleles 9 and 10 of (ATCC)_n1, allele 16 and alleles 17 and 18 of D1S1621 were significantly lower in schizophrenia patients than in controls (Table 3). Each STR was also found to have group-specific alleles: allele 14 of (ATCC)_n1, and alleles 8 and 9 of (ATCC)_n2 were present only in the control group, while allele 11 of D1S1621 was only present in the case group. Also, we did not find linkage disequilibrium between the three STRs.

Table 3.

The Odds Ratio Value and Confidence Interval of the Different Alleles of Short Tandem Repeats Loci Analyzed

(ATCC)_n1				D1S1621				(ATCC)_n2
		95%CI				95%CI				95%CI
Allele	OR	Lower	Upper	Allele	OR	Lower	Upper	Allele	OR	Lower	Upper
9&10^a	0.272	0.175	0.423	11&12	8.909	4.375	18.145	10	1.602	0.960	2.672
11	0.926	0.751	1.142	13	3.314	2.426	4.527	11	0.798	0.644	0.990
12	1.644	1.321	2.045	14	0.655	0.513	0.838	12	0.734	0.524	1.029
13&14	1.05	0.641	1.720	15	1.851	1.454	2.358	13&14	1.041	0.730	1.484
				16	0.284	0.216	0.374
				17&18	0.212	0.104	0.434

All alleles with a frequency of ≤5% in both cases and controls were defined as rare and clumped together for calculation of ORs.

ORs, odds ratios; CIs, confidence intervals.

Discussion

In the present study, we found three highly polymorphic STR loci in introns 1, 8, and 9 of the DISC1 gene and identified two novel loci, including (ATCC)_n1 and (ATCC)_n2. The three STRs showed a significant association with schizophrenia.

(ATCC)_n1 located in intron 1 of the DISC1 gene and (ATCC)_n2 located in intron 9 are, to our knowledge, the first reported STRs associated with schizophrenia in the Chinese Han population (p=4.83e-11; p=6.02e-12, see Table 2). We identified six alleles for (ATCC)_n1 and seven alleles for (ATCC)_n2 in our samples. (ATCC)_n1 alleles with more repeats had higher ORs, making them more likely to be present in the case group. Allele 14 of (ATCC)_n1 and alleles 8 and 9 of (ATCC)_n2 are only present in the control group, which may imply that these particular alleles offer some protection from the development of schizophrenia, while allele 14 of (ATCC)_n2, which was only found in the case group, and allele 10 with a high OR (OR=1.602, see Table 3), could be considered schizophrenia risk alleles.

The allele distribution of D1S1621 in our study was statistically different (χ²=214.7, p=0.000, two-tailed test) between case and control groups. Individuals with fewer repeats (particularly <16 repeats) in this allele showed a higher risk of schizophrenia, suggesting this allele as a schizophrenia risk allele.

The DISC1 gene encodes a protein with multiple coiled coil motifs, which is located in the nucleus, cytoplasm, and mitochondria. The protein is involved in neurite outgrowth and cortical development through its interaction with other proteins (Bradshaw and Porteous, 2010). DISC1 is disrupted in a balanced translocation (1;11)(q42.1;q14.3) that segregates with schizophrenia and related psychiatric disorders.

The STR (ATCC)_n1 is located in intron 1 of the DISC1 gene, and may affect the occurrence of schizophrenia through impacting the gene promoter or 5′-end of the DISC1 gene. Regarding the breakpoint between exon 8 and exon 9 in the DISC1 gene, individuals with the balanced translocation (1,11) (q42.1; q14.3) are susceptible to schizophrenia (Millar et al., 2001). A number of research groups have studied polymorphic sites located in the exon 9-intron 9-intron 10 region in several populations, including the Han population in Taiwan (Millar et al., 2001; Ekelund et al., 2004; Callicott et al., 2005; Hamshere et al., 2005; Hennah et al., 2005; Qu et al., 2007; Kim et al., 2008; Rastogi et al., 2009), but the results have been inconsistent for different markers in different populations. D1S1621 and (ATCC)_n2, which we studied, are located near the breakpoint and their allele distributions were statistically significantly different between cases and controls. Hence, we can infer that the two polymorphic loci may affect expressed sequence tags (ESTs) in introns 8 and 9 and the breakpoint, which may further affect DISC1 splicing and result in balanced translocation (1,11) (q42.1; q14.3), eventually leading to schizophrenia.

Neither Wilson-Annan et al. (1997) nor Ekelund et al. (2001, 2004) found a positive correlation between D1S1621 and schizophrenia, unlike us. The conflicting results might be due to the different genetic background of the participants and the limited sample size in our study. It should be taken into account that the results of analyses in a family-based sample and a case-control sample might not be identical (Ekelund et al., 2001). Second, schizophrenia is also inextricably linked with environmental factors. The same gene in different populations shows functional differences. Third, the diagnosis of schizophrenia is based on symptom-oriented criteria, selecting cases according to the diagnostic criteria does not assure an etiologically homogenous sample.

Conclusion

Our study found two novel STRs near the DISC1 promoter or the breakpoint. The present study identified a strong association between three STR polymorphisms of the DISC1 gene with schizophrenia in a Chinese Han population from the Shaanxi Province in northwest China. These findings should encourage future research of the three STRs, in vitro and in vivo, to confirm whether these loci affect the breakpoint and play an important role in the etiology of schizophrenia. Furthermore, further searches for polymorphisms within and close to the DISC1 gene using a systemic approach in a larger sample are needed.

Footnotes

Acknowledgments

This study was gratefully supported by a grant from the Genetic Resource of Chinese Population (57004) and the Fundamental Research Funds for the Central Universities. Sample resources are available from the Medical Examination Center of First Affiliated Hospital of the Xi'an Jiaotong University.

Author Disclosure Statement

No competing financial interests exist.

References

American Psychiatric Association. Task Force on DSM-IV. 2000. Diagnostic and statistical manual of mental disorders: DSM-IV-TR. American Psychiatric Association: Washington, DC.

Bellon

. 2007. New genes associated with schizophrenia in neurite formation: a review of cell culture experiments (vol 12, pg 620, 2007) Mol Psychiatry, 12:882-882.

Bradshaw

, Porteous

. 2012. DISC1-binding proteins in neural development, signalling and schizophrenia. Neuropharmacology, 62:1230-1241.

Callicott

, Straub

, Pezawas

et al. 2005. Variation in DISC1 affects hippocampal structure and function and increases risk for schizophrenia. Proc Natl Acad Sci U S A, 102:8627-8632.

Cannon

, Hennah

, van Erp

et al. 2005. Association of DISC1/TRAX haplotypes with schizophrenia, reduced prefrontal gray matter, and impaired short- and long-term memory. Arch Gen Psychiatry, 62:1205-1213.

Chen

, Chen

, Feng

et al. 2007. Case-control association study of Disrupted-in-Schizophrenia-1 (DISC1) gene and schizophrenia in the Chinese population. J Psychiatr Res, 41:428-434.

Ekelund

, Hennah

, Hiekkalinna

et al. 2004. Replication of 1q42 linkage in Finnish schizophrenia pedigrees. Mol Psychiatry, 9:1037-1041.

Ekelund

, Hovatta

, Parker

et al. 2001. Chromosome 1 loci in Finnish schizophrenia families. Hum Mol Genet, 10:1611-1617.

Hamshere

, Bennett

, Williams

et al. 2005. Genomewide linkage scan in Schizoaffective disorder - Significant evidence for linkage at 1q42 close to DISC1, and suggestive evidence at 22q11 and 19p13. Arch Gen Psychiatry, 62:1081-1088.

10.

Hennah

, Tuulio-Henriksson

, Paunio

et al. 2005. A haplotype within the DISC1 gene is associated with visual memory functions in families with a high density of schizophrenia. Mol Psychiatry, 10:1097-1103.

11.

Hennah

, Varilo

, Kestila

et al. 2003. Haplotype transmission analysis provides evidence of association for DISC1 to schizophrenia and suggests sex-dependent effects. Hum Mol Genet, 12:3151-3159.

12.

Hwu

, Liu

, Fann

CSJ

et al. 2003. Linkage of schizophrenia with chromosome 1q loci in Taiwanese families. Mol Psychiatry, 8:445-452.

13.

Yan

, Hou

. 2004. Exploring Novel STR Loci on Human Chromosome 21 for Forensic and Medical Genetics. Sichuan University.

14.

Kim

, Park

, Jung

et al. 2008. Association study of polymorphisms schizophrenia in a Korean between DISC1 and population. Neurosci Lett, 430:60-63.

15.

Kimmel

, Chakraborty

. 1996. Measures of variation at DNA repeat loci under a general stepwise mutation model. Theor Popul Biol, 50:345-367.

16.

Kirkpatrick

, Xu

, Cascella

et al. 2006. DISC1 immunoreactivity at the light and ultrastructural level in the human neocortex. J Comp Neurol, 497:436-450.

17.

Kockelkorn

TTJP

, Arai

, Matsumoto

et al. 2004. Association study of polymorphisms in the 5′ upstream region of human DISC1 gene with schizophrenia. Neurosci Lett, 368:41-45.

18.

Lepagnol-Bestel

, Dubertret

, Benmessaoud

et al. 2010. Association of DISC1 gene with schizophrenia in families from two distinct French and Algerian populations. Psychiatr Genet, 20:298-303.

19.

, Wan

. 2005. [SSRHunter: development of a local searching software for SSR sites] Yi Chuan, 27:808-810.

20.

Mackie

, Millar

, Porteous

. 2007. Role of DISC1 in neural development and schizophrenia. Curr Opin Neurobiol, 17:95-102.

21.

Millar

, Christie

, Anderson

et al. 2001. Genomic structure and localisation within a linkage hotspot of Disrupted In Schizophrenia 1, a gene disrupted by a translocation segregating with schizophrenia. Mol Psychiatry, 6:173-178.

22.

Millar

, Wilson-Annan

, Anderson

et al. 2000. Disruption of two novel genes by a translocation co-segregating with schizophrenia. Hum Mol Genet, 9:1415-1423.

23.

Morris

, Kandpal

, Ma

et al. 2003. DISC1 (Disrupted-In-Schizophrenia 1) is a centrosome-associated protein that interacts with MAP1A, MIPT3, ATF4/5 and NUDEL: regulation and loss of interaction with mutation. Hum Mol Genet, 12:1591-1608.

24.

Ozeki

, Tomoda

, Kleiderlein

et al. 2003. Disrupted-in-Schizophrenia-1 (DISC-1): mutant truncation prevents binding to NudE-like (NUDEL) and inhibits neurite outgrowth. Proc Natl Acad Sci U S A, 100:289-294.

25.

, Tang

, Yue

et al. 2007. Positive association of the Disrupted-in-Schizophrenia-1 gene (DISC1) with schizophrenia in the Chinese Han Population. Am J Med Genet Part B Neuropsychiatr Genet, 144B:266-270.

26.

Rastogi

, Zai

, Likhodi

et al. 2009. Genetic association and post-mortem brain mRNA analysis of DISC1 and related genes in schizophrenia. Schizophr Res, 114:39-49.

27.

Schumacher

, Laje

, Abou Jamra

et al. 2009. The DISC locus and schizophrenia: evidence from an association study in a central European sample and from a meta-analysis across different European populations. Hum Mol Genet, 18:2719-2727.

28.

Schurov

, Handford

, Brandon

et al. 2004. Expression of disrupted in schizophrenia 1 (DISC1) protein in the adult and developing mouse brain indicates its role in neurodevelopment. Mol Psychiatry, 9:1100-1110.

29.

Stclair

, Blackwood

, Muir

et al. 1990. Association within a family of a balanced autosomal translocation with major mental-illness. Lancet, 336:13-16.

30.

Wilson-Annan

, Blackwood

DHR

, Muir

et al. 1997. An allelic association study of two polymorphic markers in close proximity to a balanced translocation t(1: 11) that co-segregates with mental illness. Psychiatr Genet, 7:171-174.

31.

Young-Pearse

, Suth

, Luth

et al. 2010. Biochemical and functional interaction of disrupted-in-schizophrenia 1 and amyloid precursor protein regulates neuronal migration during mammalian cortical development. J Neurosci, 30:10431-10440.