A Multiplex Polymerase Chain Reaction Method for the Simultaneous Detection of GSTM1,GSTT1,and GSTP1 Polymorphisms

Abstract

Background: Glutathione S-transferases (GSTs) play an important role in the detoxification of a wide variety of toxicants. Among GSTs, GSTM1 and GSTT1 polymorphic deletions and the GSTP1 Ile105Val polymorphism were often studied in combination in many diseases because of their additive effects, but they were usually genotyped by two separate methods. Aim: The purpose of the present study was to develop a simple and reliable method to simultaneously detect these three polymorphisms. Methods: The three polymorphisms of 259 volunteers were genotyped using a multiplex polymerase chain reaction (PCR) method based on a tetra-primer amplification refractory mutation system-PCR (T-ARMS-PCR), and the results were validated by multiplex PCR for GSTM1 and GSTT1 polymorphisms and DNA sequencing of the GSTP1 Ile105Val polymorphism, respectively. Results: The multiplex PCR method of GSTM1, GSTT1, and GSTP1 polymorphisms based on T-ARMS-PCR can simultaneous detect the three polymorphisms in a single PCR. The results of this method are in perfect accord with the results of the multiplex PCR method of determining GSTM1, GSTT1 polymorphisms, and DNA sequencing of GSTP1 Ile105Val polymorphism. Conclusion: The novel multiplex PCR method of GSTM1, GSTT1, and GSTP1 polymorphisms is simple, fast, low-cost, and reliable for the simultaneous detection of GSTM1, GSTT1, and GSTP1 Ile105Val polymorphisms.

Introduction

Glutathione S-transferases (GSTs) are a superfamily of phase II enzymes that play an important role in metabolism and detoxification of numerous endo- and xenobiotics, including environmental carcinogens, chemotherapeutic agents, and reactive oxygen species (Wu and Dong, 2012; Rebbeck 1997). In humans, GSTs include many cytosolic, mitochondrial, and microsomal proteins. The cytosolic GST group contains at least 18 genes subdivided into seven distinct classes (Board and Menon, 2013). Some polymorphisms of these genes have a direct impact on the structure, function, and expression of human cytosolic GSTs (Board and Menon, 2013). The most commonly studied GST polymorphisms include a GSTM1 deletion, a GSTT1 deletion, and the GSTP1 Ile105Val (rs1695) polymorphism. People with homozygous deletions of GSTM1 or GSTT1 have no activity of the respective enzyme (Zhong et al., 1991; Bruhn et al., 1998). The GSTP1 Ile105Val polymorphism is an A-G transition at nucleotide 313 of GSTP1. The substitution of valine decreases the enzyme activity (Ali-Osman et al., 1997; Johansson et al., 1998). All three polymorphisms are associated with the occurrence and progression of multiple diseases, such as cancer (Palma et al., 2010; Yadav et al., 2010; Hashemi et al., 2012; Oliveira et al., 2012; Cotignola et al., 2013; Russo et al., 2013; Sohail et al., 2013), diabetes mellitus (Ramprasath et al., 2011; Moasser et al., 2012), and idiopathic male infertility (Safarinejad et al., 2010). Moreover, these polymorphisms are also associated with the response to breast cancer treatment (Ambrosone et al., 2001; Romero et al., 2012). Because all three are functional polymorphisms of GSTs, they have been frequently studied in combination (Palma et al., 2010; Safarinejad et al., 2010; Yadav et al., 2010; Ramprasath et al., 2011; Hashemi et al., 2012; Moasser et al., 2012; Oliveira et al., 2012; Romero et al., 2012; Cotignola et al., 2013; Russo et al., 2013; Sohail et al., 2013). GSTT1 and GSTM1 polymorphisms are usually assessed by multiplex polymerase chain reaction (PCR) (Ambrosone et al., 2001; Palma et al., 2010; Safarinejad et al., 2010; Yadav et al., 2010; Ramprasath et al., 2011; Hashemi et al., 2012; Moasser et al., 2012; Oliveira et al., 2012; Romero et al., 2012; Cotignola et al., 2013; Russo et al., 2013; Sohail et al., 2013). For the GSTP1 Ile105Val polymorphism, PCR restriction fragment-length polymorphism is the most commonly used genotyping method (Palma et al., 2010; Safarinejad et al., 2010; Yadav et al., 2010; Ramprasath et al., 2011; Moasser et al., 2012; Oliveira et al., 2012; Cotignola et al., 2013; Russo et al., 2013; Sohail et al., 2013). This technique requires the use of restriction enzymes and incubation for long periods of time.

The tetra-primer amplification refractory mutation system-PCR (T-ARMS-PCR) method is a fast, cost-effective, reliable method for single-nucleotide polymorphism (SNP) genotyping (Ye et al., 2001). Because it does not require any special equipment, the assay can be set up in most molecular biology laboratories (Etlik et al., 2011). A quadruplex T-ARMS-PCR method has been developed to detect three SNPs and one indel polymorphism in a single PCR (Lajin et al. 2012a).

The aim of the present work was to develop a multiplex PCR method for the simultaneous detection of GSTM1, GSTT1, and GSTP1 polymorphisms in a single PCR to reduce detection cost and time.

Materials and Methods

Participants

The study participants consisted of 259 volunteers living in Jiangxi, China. Each participant provided informed consent. The study was approved by the Medical Ethics Committee of the First Affiliated Hospital of Nanchang University.

DNA extraction

For DNA extraction, 2 mL of blood was obtained from each participant. The genomic DNA was purified from whole blood using a DNA isolation kit (Bioteke, Beijing, China), and the procedure was performed according to the instruction manual.

Multiplex PCR method of the three polymorphisms

Table 1 shows the sequences of primers used for multiplex PCR of the three polymorphisms. A mismatch at the third nucleotide from the 3′ terminus of the GSTP1 allele-specific primers was introduced to maximize specificity. The primers for the GSTM1 and GSTT1 polymorphisms can be found elsewhere (Chen et al., 1996; Yadav et al., 2010). The PCR (10 μL) contained 5 μL of 2× Taq master mix (SinoBio, Shanghai, China), eight primers (the final concentration of each primer is listed in Table 1), and 10 ng of genomic DNA. PCR cycling was carried out on a MG96G thermal cycler (LongGene, Hangzhou, China). Amplification was performed by initial denaturation at 94°C for 3 min, followed by 35 cycles of 94°C for 20 s, 60°C for 20 s, and 72°C for 30 s. A final extension of 72°C for 5 min was performed and then the reaction was cooled to 10°C. PCR products were identified by electrophoresis on a 2% agarose gel. The gel was photographed using a JS-680B gel imaging system (Peiqing, Shanghai, China).

Table 1.

Primers for Multiplex Polymerase Chain Reaction of the Three Polymorphisms

Primer	Sequence ^a (5′-3′)	Concentration (μM)	Expected products
GSTP1-common-F	AGGTGTCAGGTGAGCTCTGA	0.30
GSTP1-common-R	CTCTGGCTACTCCAGGAAGC	0.30	Common 586 bp
GSTP1-G	CATAGTTGGTGTAGATGAGGGA T AC	1.60	G allele 284 bp
GSTP1-A	AGGACCTCCGCTGCAAAT C CA	0.80	A allele 347 bp
GSTM1-F	GAACTCCCTGAAAAGCTAAAGC	0.15
GSTM1-R	GTTGGGCTCAAATATACGGTGG	0.15	219 bp
GSTT1-F	TTCCTTACTGGTCCTCACATCTC	0.15
GSTT1-R	TCACCGGATCATGGCCAGCA	0.15	459 bp

Specific nucleotides are underlined; specificity-enhancing mismatches are shown in bold italics.

Method validation

The β-globin gene forward (5′-CAACTTCATCCACGTTCACC-3′) and reverse (5′-GAAGAGCCAAGGACAGGTAC-3′) primers were used as an internal positive control for the multiplex PCR method to avoid false-negative results (Yadav et al., 2010). The PCR was performed in a 10-μL mixture containing 5 μL of 2× Taq master mix, 0.2 μM of each primer, and 10 ng of genomic DNA. Amplification was performed by initial denaturation at 94°C for 3 min, followed by 35 cycles of 94°C for 20 s, 60°C for 20 s, and 72°C for 25 s, and a final extension of 72°C for 5 min. The product lengths were 219 bp, 459 bp, and 268 bp for GSTM1, GSTT1, and β-globin, respectively. Absence and presence of PCR products for GSTM1 and GSTT1 were considered as null and positive genotypes, respectively.

For the GSTP1 Ile105Val polymorphism, 26 samples (about 10% of the total samples) were randomly sequenced (Sangon, Shanghai, China). The PCR (10 μL) contained 5 μL of 2× Taq master mix, 0.2 μM of GSTP1-common-F, 0.2 μM of GSTP1-common-R, and 10 ng of genomic DNA. The PCR cycling conditions were the same as those of the multiplex PCR method.

Results

Multiplex PCR of the three polymorphisms

A representative result of agarose gel electrophoresis is shown in Figure 1. The amplified DNA fragments are 284 bp for GSTP1 105Val (313G), 347 bp for GSTP1 105Ile (313A), 219 bp for GSTM1, and 459 bp for GSTT1, as well as a common 586 bp band for GSTP1. The bands were sufficiently clear for each sample to be genotyped correctly. All genotype combinations of the three polymorphisms are demonstrated in Fig. 1. Table 2 shows the observed genotype frequencies for GSTP1 Ile105Val, GSTM1, and GSTT1 among the 259 volunteers.

FIG. 1.

Genotyping of three polymorphisms by multiplex polymerase chain reaction. Lanes 1-11 show all genotype combinations of the three polymorphisms, and lane 12 is a negative control. Lane M is DNA marker I.

Table 2.

Genotype Frequencies of GSTM1, GSTT1, and GSTP1 Polymorphisms Among 259 Volunteers

Genotype
GSTP1	GSTM1	GSTT1	Participants, n (%)
AA			183 (70.7)
AG			69 (26.6)
GG			7 (2.7)
	−		162 (62.5)
	+		97 (37.5)
		−	116 (44.8)
		+	143 (55.2)
AA	−	−	49 (18.9)
AA	−	+	65 (25.1)
AA	+	−	33 (12.7)
AA	+	+	36 (13.9)
AG	−	−	19 (7.3)
AG	−	+	27 (10.4)
AG	+	−	12 (4.6)
AG	+	+	11 (4.2)
GG	−	−	2 (0.8)
GG	+	+	4 (1.5)
GG	+	−	1 (0.4)

Multiplex PCR of GSTM1 and GSTT1

All samples were genotyped by the multiplex PCR method for GSTM1 and GSTT1. No difference in genotype assignment was observed in any of the samples. Figure 2 shows the electrophoretogram of the multiplex PCR for GSTM1 and GSTT1 of 11 different samples, corresponding to the samples described in Figure 1.

FIG. 2.

Genotyping of GSTM1 and GSTT1 by multiplex polymerase chain reaction. Lanes 1-11 correspond to the samples described in Figure 1, and lane 12 is a negative control. Lane M is DNA marker I.

DNA sequencing

The results of DNA sequencing for the GSTP1 Ile105Val polymorphism were consistent with the results of the multiplex PCR method for the three polymorphisms.

Discussion

GSTM1, GSTT1, and GSTP1 polymorphisms have been extensively investigated because they may influence enzyme activity. To date, many meta-analyses have investigated the relationships between GST polymorphisms and many different diseases. The dual null genotype of GSTM1 and GSTT1 was associated with increased risk of prostate cancer (Gong et al., 2012), diabetes mellitus (Zhang et al., 2013), and hepatocellular carcinoma in Chinese people (Liu et al., 2013). The GSTM1 null genotype was associated with increased risk of prostate cancer (Gong et al., 2012), childhood asthma ( Li et al., 2013), male infertility (Ying et al., 2013), diabetes mellitus (Zhang et al., 2013), and oral cancer in the Asian population (Zhang et al., 2011), while the GSTT1 null genotype was associated with increased risk of chronic myeloid leukemia (Zintzaras, 2009) and diabetes mellitus (Zhang et al., 2013). The GSTP1 Ile105Val polymorphism may increase susceptibility to bladder cancer (Wang et al., 2013) and breast cancer in the Asian population (Lu et al., 2011). The GSTT1 null genotype and GSTP1 Ile105Val polymorphism are also associated with high risk of prostate cancer (Gong et al., 2012), and the GSTM1 null genotype and GSTP1 Ile105Val polymorphism are associated with high risk of primary open-angle glaucoma (Yu et al., 2013). Compared with single gene analysis, the investigation of multiple genetic polymorphisms could contribute to a better understanding of the effects of susceptibility genes on cancer risk (Palma et al., 2010). Thus, it is necessary to develop a simple and reliable method to simultaneously detect these three polymorphisms.

Because of its simplicity and reliability, T-ARMS-PCR has been widely used to genotype SNPs and mutations (Etlik et al., 2011; Lajin et al., 2012a; Lajin et al., 2012b). We previously genotyped two SNPs in the CYP19A1 gene using the T-ARMS-PCR method (data not shown). In our experience, to achieve optimal results with T-ARMS-PCR in a short period, the following three steps should be taken. The first step is to find a heterozygous sample. By using an annealing temperature of 56°C, two allele-specific fragments, together with the control fragment, are amplified in 10 samples (the primer concentrations of specific fragments are twice those of control fragments). The sample will be heterozygous if the products for both of the allele-specific fragments are observed, whereas a product for only one specific fragment should emerge in other samples. The second step is determination of an optimal annealing temperature. For the determined heterozygous sample, the annealing temperature is altered from 56°C to 65°C, and the two specific fragments are amplified together with the control fragment. The temperature at which the three fragments are brightest is the optimal annealing temperature. The final step is to determine the optimal primer concentrations. T-ARMS-PCR is performed at the previously determined optimal annealing temperature with different primer concentrations. The primer concentrations at which the two specific fragments are evenly bright are considered optimal concentrations for T-ARMS-PCR. Consistent with the results of Lajin et al., we also found that introducing mismatches at the third nucleotide from the 3′ terminus of the primers played a crucial role in the specificity of T-ARMS-PCR, with allele-specific primers losing their specificity upon removal of these mismatches (Lajin et al., 2012b). Moreover, Taq master mix may be an important factor that affects band intensities and the absence or presence of the common band. To get uniform results, Taq master mix should be of the same production lot.

On the basis of T-ARMS-PCR of the GSTP1 Ile105Val polymorphism, we developed a multiplex PCR method for the simultaneous detection of GSTM1, GSTT1, and GSTP1 Ile105Val polymorphisms. For 10 samples, this method can be completed within 4 h after specimen receipt (60 min for DNA extraction, 100 min for PCR amplification, and 40 min for agarose gel electrophoresis). The results of this method are in accordance with the results of the multiplex PCR method for GSTM1 and GSTT1 and DNA sequencing of GSTP1. This confirmed the reliability of this method for the simultaneous detection of GSTM1, GSTT1, and GSTP1 polymorphisms. This method is more convenient and economical than the traditional PCR restriction fragment-length polymorphism because it does not require incubation with costly restriction enzymes for several hours. Other methods, such as denaturing high-performance liquid chromatography, real-time PCR, capillary electrophoresis, matrix-assisted laser desorption/ionization time-of-flight mass spectrometry, and direct DNA sequencing, can also be used to detect these polymorphisms, but they require expensive equipment that might not be routinely available in most laboratories (Etlik et al., 2011). At present, we are using this method to investigate the relationships between diabetic retinopathy and GSTM1, GSTT1, and GSTP1 polymorphisms.

Conclusion

In summary, novel multiplex PCR is an accurate, simple, fast, low-cost method for the simultaneous detection of GSTM1, GSTT1, and GSTP1 Ile105Val polymorphisms that can be used in most molecular biology laboratories.

Footnotes

Acknowledgments

The authors thank volunteers who donated blood samples for this study. This work was supported by the National Natural Science Foundation of China (no. 30860319, 81160105, 81160248) and the Project Foundation of Jiangxi Education Department (no. GJJ13165).

Author Disclosure Statement

No competing financial interests exist.

References

Ali-Osman

, Akande

, Antoun

, et al. (1997) Molecular cloning, characterization, and expression in Escherichia coli of full-length cDNAs of three human glutathione S-transferase Pi gene variants. Evidence for differential catalytic activity of the encoded proteins. J Biol Chem, 272:10004-10012.

Ambrosone

, Sweeney

, Coles

, et al. (2001) Polymorphisms in glutathione S-transferases (GSTM1 and GSTT1) and survival after treatment for breast cancer. Cancer Res, 61:7130--7135.

Board

, Menon

(2013) Glutathione transferases, regulators of cellular metabolism and physiology. Biochim Biophys Acta, 1830:3267-3288.

Bruhn

, Brockmoller

, Kerb

, et al. (1998) Concordance between enzyme activity and genotype of glutathione S-transferase theta (GSTT1). Biochem Pharmacol, 56: 1189-1193.

Chen

, Liu

, Relling

(1996) Simultaneous characterization of glutathione S-transferase M1 and T1 polymorphisms by polymerase chain reaction in American whites and blacks. Pharmacogenetics, 6:187-191.

Cotignola

, Leonardi

, Shahabi

, et al. (2013) Glutathione-S-transferase (GST) polymorphisms are associated with relapse after radical prostatectomy. Prostate Cancer Prostatic Dis, 16:28-34.

Etlik

, Koksal

, Arican-Baris

, et al. (2011) Development and validation of a cost-effective in-house method, tetra-primer ARMS PCR assay, in genotyping of seven clinically important point mutations. Mol Cell Probes, 25:177-181.

Gong

, Dong

, Shi

, et al. (2012) Genetic polymorphisms of GSTM1, GSTT1, and GSTP1 with prostate cancer risk: a meta-analysis of 57 studies. PLoS One, 7: e50587.

Hashemi

, Eskandari-Nasab

, Fazaeli

, et al. (2012) Association between polymorphisms of glutathione S-transferase genes (GSTM1, GSTP1 and GSTT1) and breast cancer risk in a sample Iranian population. Biomark Med, 6:797-803.

10.

Johansson

, Stenberg

, Widersten

, et al. (1998) Structure-activity relationships and thermal stability of human glutathione transferase P1-1 governed by the H-site residue 105. J Mol Biol, 278:687-698.

11.

Lajin

, Alachkar

, Alhaj Sakur

(2012a) A quadruplex tetra-primer ARMS-PCR method for the simultaneous detection of TP53 Arg72Pro, IVS3 16bp Del/Ins and IVS6+62A>G, and NQO1 C609T polymorphisms. Gene, 504:268-273.

12.

Lajin

, Alachkar

, Sakur

(2012b) Triplex tetra-primer ARMS-PCR method for the simultaneous detection of MTHFR c.677C>T and c.1298A>C, and MTRR c.66A>G polymorphisms of the folate-homocysteine metabolic pathway. Mol Cell Probes, 26:16-20.

13.

, Li

, Chang

, et al. (2013) Quantitative assessment of the association between the GSTM1-null genotype and the risk of childhood asthma. Genet Test Mol Biomarkers, 17:656-661.

14.

Liu

, Zhang

, Lin

, et al. (2013) Association of GST genetic polymorphisms with the susceptibility to hepatocellular carcinoma (HCC) in Chinese population evaluated by an updated systematic meta-analysis. PLoS One, 8:e57043

15.

, Wang

, Cui

, et al. (2011) Glutathione S-transferase P1 Ile105Val polymorphism and breast cancer risk: a meta-analysis involving 34,658 subjects. Breast Cancer Res Treat, 125:253-259.

16.

Moasser

, Kazemi-Nezhad

, Saadat

, et al. (2012) Study of the association between glutathione S-transferase (GSTM1, GSTT1, GSTP1) polymorphisms with type II diabetes mellitus in southern of Iran. Mol Biol Rep, 39:10187-10192.

17.

Oliveira

, Lourenco

, Sagarra

, et al. (2012) Polymorphisms of glutathione S-transferase Mu 1 (GSTM1), Theta 1 (GSTT1), and Pi 1 (GSTP1) genes and epithelial ovarian cancer risk. Dis Markers, 33:155-159.

18.

Palma

, Novelli

, Padua

, et al. (2010) Interaction between glutathione-S-transferase polymorphisms, smoking habit, and HPV infection in cervical cancer risk. J Cancer Res Clin Oncol, 136:1101-1109.

19.

Ramprasath

, Senthil Murugan

, Prabakaran

, et al. (2011) Potential risk modifications of GSTT1, GSTM1 and GSTP1 (glutathione-S-transferases) variants and their association to CAD in patients with type-2 diabetes. Biochem Biophys Res Commun, 407:49-53.

20.

Rebbeck

(1997) Molecular epidemiology of the human glutathione S-transferase genotypes GSTM1 and GSTT1 in cancer susceptibility. Cancer Epidemiol Biomarkers Prev, 6:733-743.

21.

Romero

, Martin

, Oliva

, et al. (2012) Glutathione S-transferase P1 c.313A>G polymorphism could be useful in the prediction of doxorubicin response in breast cancer patients. Ann Oncol, 23:1750-1756.

22.

Russo

, Francelin

, Galbiatti

, et al. (2013) Association between GSTP1, GSTM1 and GSTT1 polymorphisms involved in xenobiotic metabolism and head and neck cancer development. Mol Biol Rep, 40:4181-4188.

23.

Safarinejad

, Shafiei

, Safarinejad

(2010) The association of glutathione-S-transferase gene polymorphisms (GSTM1, GSTT1, GSTP1) with idiopathic male infertility. J Hum Genet, 55:565-570.

24.

Sohail

, Kanwal

, Ali

, et al. (2013) Effects of glutathione-S-transferase polymorphisms on the risk of breast cancer: a population-based case-control study in Pakistan. Environ Toxicol Pharmacol, 35:143-153.

25.

Wang

, Xue

, Chong

, et al. (2013) Quantitative assessment of the association between glutathione S-transferase P1 Ile105Val polymorphism and bladder cancer risk. Tumour Biol, 34:1651-1657.

26.

, Dong

(2012) Human cytosolic glutathione transferases: structure, function, and drug discovery. Trends Pharmacol Sci, 33:656-668.

27.

Yadav

, Devi

, Ihsan

, et al. (2010) Polymorphisms of glutathione-S-transferase genes and the risk of aerodigestive tract cancers in the Northeast Indian population. Genet Test Mol Biomarkers, 14:715-723.

28.

, Dhillon

, Ke

, et al. (2001) An efficient procedure for genotyping single nucleotide polymorphisms. Nucleic Acids Res, 29:E88-88.

29.

Ying

, Qi

, Pu

, et al. (2013) Association of GSTM1 and GSTT1 genes with the susceptibility to male infertility: result from a meta-analysis. Genet Test Mol Biomarkers, 17:535-542.

30.

, Weng

, Guo

, et al. (2013) Association of glutathione S transferases polymorphisms with glaucoma: a meta-analysis. PLoS One, 8:e54037

31.

Zhang

, Liu

, Yan

, et al. (2013) Null genotypes of GSTM1 and GSTT1 contribute to increased risk of diabetes mellitus: a meta-analysis. Gene, 518:405-411.

32.

Zhang

, Hao

, Shi

, et al. (2011) Glutathione S-transferase M1 (GSTM1) and glutathione S-transferase T1 (GSTT1) null polymorphisms, smoking, and their interaction in oral cancer: a HuGE review and meta-analysis. Am J Epidemiol, 173:847-857.

33.

Zhong

, Howie

, Ketterer

, et al. (1991) Glutathione S-transferase mu locus: use of genotyping and phenotyping assays to assess association with lung cancer susceptibility. Carcinogenesis, 12:1533-1537.

34.

Zintzaras

(2009) Glutathione S-transferase M1 and T1 genes and susceptibility to chronic myeloid leukemia: a meta-analysis. Genet Test Mol Biomarkers, 13:791-797.