Genetic Analysis of the ZNF512B,SLC41A1,and ALDH2 Polymorphisms in Parkinson's Disease in the Iranian Population

Abstract

Aims: Parkinson's disease (PD) is one of the most common neurodegenerative disorders; its etiology includes both genetic and environmental factors and their interactions. The ZNF512B, SLC41A1, and ALDH2 genes have recently been identified as contributing to PD. In this study we investigated the association of alleles of these genes with PD in the Iranian population. Methods: In a case-control study, rs2275294, rs11240569, and rs4767944, three single nucleotide polymorphisms in ZNF512B, SLC41A1, and ALDH2 genes, respectively, were genotyped in 490 PD patients and 490 controls. The genotype and allele frequencies were compared between the two groups using chi-square and logistic regression tests. Results: A significant association between the rs11240569 polymorphism and a reduced risk of PD was found (p = 0.014, OR = 0.76, 95% CI: 0.60-0.94 for allele frequencies). We did not find any associations between PD and the rs2275294 and rs4767944 polymorphisms. Conclusion: The association of rs11240569 polymorphism in SLC41A1 gene with reduced risk of PD was replicated in our population.

Introduction

Parkinson's disease (PD) is the second most common neurodegenerative disorder following Alzheimer's disease affecting 1-2% of people over the age of 65 (de Lau and Breteler, 2006; Darvish et al., 2013). Its main clinical characteristics include tremor, bradykinesia, muscle rigidity, and difficulties in movements (Emamalizadeh et al., 2014; Pagano et al., 2016). These manifestations are supposed to be due to degeneration of dopaminergic neurons in substantia nigra region of the brain (Jamshidi et al., 2014). The patients with PD divide into three groups containing sporadic, familial, and monogenic cases with frequency of ∼85%, 10-15%, and 5% of all cases, respectively (Goudarzian et al., 2015). Etiologically, PD is influenced by both genetic and environmental factors; however, its exact etiology is not still completely clear (Schapira and Jenner, 2011; Haghnejad et al., 2015).

There are a number of genes found to be direct causative factors for PD, including SNCA, PINK1, and PARKIN (Klein and Westenberger, 2012). Several other genes are also indicated to be associated with PD in an indirect manner according to studies performed on their polymorphisms and associations found between them in different populations. ZNF512B, SLC41A1, and ALDH2 are three genes shown to be involved in PD etiology and their polymorphisms have been studied in PD and other similar diseases such as amyotrophic lateral sclerosis (ALS) due to overlaps in features and involved pathways of two disorders (Iida et al., 2011; Wang et al., 2015; Yang et al., 2015; Zhang et al., 2015).

ZNF512B is an activating factor for TGF-β signaling pathway, which has been proved to be an important survival promotion factor of dopaminergic neurons and thus is a protective agent against neurodegeneration (Schober et al., 2007). SLC41A1 is one of the several genes located in PARK16 locus, a well-established susceptibility locus for PD (Satake et al., 2009; Simon-Sanchez et al., 2009). SLC41A1 encodes a cytoplasmic integral protein involved in regulation of intracellular magnesium (Kolisek et al., 2008; Mandt et al., 2011; Kolisek et al., 2012). Finally, ALDH2 is a member of ALDH super family and encodes the aldehyde dehydrogenase 2 protein, an important enzyme for oxidation of aldehyde in brain, which its metabolites have been found to be involved in PD pathogenesis (Marchitti et al., 2008; Nasstrom et al., 2011). Three polymorphisms, rs2275294, an intronic polymorphism in ZNF512B gene, rs11240569, a synonymous coding variant in SLC41A1, and rs4767944, an intronic polymorphism in ALDH2, have been previously shown to be associated with PD (Wang et al., 2015; Yang et al., 2015; Zhang et al., 2015), and on this study, we performed a replication study on association of these polymorphisms with PD in Iranian population.

Subjects and Methods

Study population and single nucleotide polymorphism genotyping

We designed a case-control study, including 490 PD patients and 490 unrelated healthy sex- and age-matched controls (Table 1). The inclusion criteria were the presence of late onset PD in sporadic form and absence of any other neurologic disease in cases. There were also no familial relationships between the cases. Both case and controls were ethnically Iranian. DNA was extracted from peripheral blood of all participants using a standard salting out method. Rs2275294 in ZNF512B, rs11240569 in SLC41A1, and rs4767944 in ALDH2 gene were genotyped in all subjects using polymerase chain reaction (PCR)-RFLP method with BseYI, BtgI, and PsiI restriction enzymes, respectively. The details of primer sequences, PCR conditions, and restriction enzymes are presented in Table 2. All PCR reactions were performed in 25 μL of reaction mixture and PCR programs also contained an initial 95°C and a final step of 72°C for 5 min. The digested fragments were observed on 2-3% agarose gels using ethidium bromide staining under UV light.

Table 1.

Age and Sex Distribution in Study Groups

			Gender
Age (mean ± SD)			Case		Control
Case	Control	p	Male	Female	Male	Female	p
59.32 ± 12.52	58.72 ± 12.22	0.44	262	228	258	232	0.84

SD, standard deviation.

Table 2.

The Primer Sequences and PCR and Digestion Conditions for Studied Polymorphisms

		PCR conditions (°C/s)
Polymorphisms	Primer sequences (5→3)	Denature	Annealing	Extension	Restriction enzyme digestion	Alleles	DNA fragment size (bp)
rs2275294	F: AGGCATGGAGGCTAGAGTG	95/30	58.7/30	72/30	BseYI at 37°C for 1 hour	A	250
	R: GTGTTCCGTGTGCCTTGG					G	154 + 96
rs11240569	F: ACAGTATTCTAGGAAGCAGCAG	95/30	59.4/30	72/30	BtgI at 37°C for 1 hour	A	242 + 50
	R: GGAGAACGGGAGCCAGAG					G	150 + 92 + 50
rs4767944	F: AGGCACCATACAGAAATGTTCA	95/30	56.7/30	72/30	PsiI at 37°C for 1 hour	C	225
	R: TGGTGTAGAGTGCTGGACAT					T	143 + 82

PCR, polymerase chain reaction.

Statistical analyses

Deviation from the Hardy-Weinberg equilibrium was tested using Fisher's exact test in all three studied single nucleotide polymorphisms (SNPs) in the subject population. Pearson's χ²-tests were applied to test for significance in differences of genotype and allele frequencies between groups. A p-value less than 0.05 (two tailed) was considered to be statistically significant. The distribution of genotype frequencies was also analyzed under three different genetic models (log-additive, recessive, and dominant) using SNPassoc package of R version 3.2.0 (Gonzalez et al., 2007). All other statistical analyses were also performed using R version 3.2.0.

Results

The population was in Hardy-Weinberg equilibrium for all studied polymorphisms. Analysis of genotype and allele frequency distribution revealed significant differences between case and control groups for rs11240569 in SLC41A1 gene (p = 0.015, OR [95% CI] = 0.76 [0.60-0.65]), so that the minor allele G was associated with reduced risk of the disease. However, the difference was not significant for any of rs2275294 and rs4767944 polymorphisms (Table 3). There was also no association between PD and rs2275294 and rs4767944 under any of the genetic models. The association was significant for rs11240569 under log-additive and recessive models (Table 4).

Table 3.

Genotype Distribution and Allele Frequencies in Case and Control Groups

		Genotype frequencies (%)				Allele frequencies (%)
Gene (SNP)	Subjects	A/A	A/G	G/G	p	A	G	OR (95% CI)	p
ZNF512B (rs2275294)	Case (N = 490)	11 (2)	137 (28)	342 (70)	0.89	159 (16)	821 (84)	0.97 (0.76-1.24)	0.81
	Control (N = 490)	10 (42)	143 (46)	337 (12)		163 (17)	817 (83)
SLC41A1 (rs11240569)	Case (N = 490)	345 (70)	133 (27)	12 (3)	0.023^a	823 (84)	157 (16)	0.76 (0.60-0.94)	0.014^a
	Control (N = 490)	318 (65)	145 (30)	27 (5)		781 (80)	199 (20)

		C/C	C/T	T/T		C	T
ALDH2 (rs4767944)	Case (N = 490)	344 (70)	133 (27)	13 (3)	0.58	160 (16)	820 (84)	1.01 (0.79-1.29)	0.95
	Control (N = 490)	339 (41)	143 (46)	9 (13)		159 (16)	821 (84)

Considered as significant.

SNP, single nucleotide polymorphism.

Table 4.

Analysis of Genotype Distributions Under Three Genetic Models

	log-Additive (G/G = 0, A/G = 1, A/A = 2)		Recessive (A/A vs. A/G + G/G)		Dominant (G/G vs. A/G + AA)
SNP	p	OR (95% CI)	p	OR (95% CI)	p	OR (95% CI)
rs2275294	0.80	0.97 (0.77-1.24)	0.82	1.10 (0.46-2.62)	0.72	0.95 (0.73-01.25)
rs11240569	0.02^a	0.77 (0.60-0.95)	0.013^a	0.43 (0.22-0.86)	0.06	0.78 (0.59-1.02)

	log-Additive (A/A = 0, A/C = 1, C/C = 2)		Recessive (C/C vs. A/C + A/A)		Dominant (A/A vs. A/C + C/C)
rs4767944	0.95	1.01 (0.78-1.29)	0.38	0.69 (0.29-1.62)	0.72	1.05 (0.80-1.38)

Considered as significant.

Discussion

Three polymorphisms, rs11240569, rs2275294, and rs4767944, were studied here in a case-control study, including 490 PD patients and 490 healthy controls, to investigate possible associations with PD. The C allele and CC genotype of the rs11240569 polymorphism were found to be significantly associated with decreased risk of PD, but neither of the other polymorphisms showed any significant differences in distributions of alleles and genotypes between cases and controls. The rs11240569 polymorphism was reported to be associated with PD in Chinese population and similar to our study, they found the association of the minor allele C and the CC genotype with reduced risk of PD (Wang et al., 2015). However, two previous studies in European and Chinese populations had inconsistent results and found no associations (Tucci et al., 2010; Yan et al., 2011).

For the other two polymorphisms rs2275294 and rs4767944, our results were in contrast to previous studies, so that we observed no associations between these SNPs and PD, but in previous studies, the rs4767944 was investigated in one study in Han Chinese population and reported to be associated with PD (Zhang et al., 2015), and rs2275294 polymorphism was also showed to be associated with the risk of ALS and PD in Han Chinese population (Yang et al., 2015). rs2275294 SNP was also showed to be associated with ALS in two other studies both in Japanese population (Iida et al., 2011; Tetsuka et al., 2013). However, one large cohort study exists that shows the rs2275294 polymorphism is not associated with ALS in Chinese population (Ju et al., 2015). These evident discrepant observations in different populations may be due to several factors, including different genetic contexts of populations, founder effects, and different sample sizes and methodologies, which cause different distributions of alleles and other markers in populations.

SLC41A1 functions as a regulator of magnesium homeostasis in cells, which is required for several cellular processes, including signal transduction, growth and proliferation, enzyme activities, and several metabolic pathways (Saris et al., 2000). Cellular magnesium is found to be an important factor in preventing the pathology of neuron cells (Hashimoto et al., 2008), so that deficiencies in magnesium have been found to lead to loss of dopaminergic neurons (Oyanagi et al., 2006), and this may explain how this gene is related to PD etiology. Genetic polymorphisms exert their effects through several mechanisms. The rs11240569 polymorphism is a synonymous-coding variant, which causes p.Thr113Thr. This kind of polymorphisms, which does not cause any alterations in protein structure or sequence, may affect gene expression or function by the DNA sequence changes, by means of altering DNA binding factors or changing local chromatin structure, both affecting gene expression levels (Wang et al., 2005). So, the rs11240569 synonymous polymorphism may affect gene expression or function by alteration of local chromatin structure or by influencing the promoter function by means of changing protein bindings in the region.

In conclusion, we found that the rs11240569 polymorphism of the SLC41A1 gene is significantly associated with PD in Iranian population, but no significant relationships were observed between rs4767944 and rs2275294 polymorphism and PD. More studies in different populations and with larger sample sizes are required to confirm these findings and functional studies may also be helpful in finding the effect of these polymorphisms on gene function and PD pathology.

Footnotes

Acknowledgments

The authors thank the patients and their families for their participation.

Author Disclosure Statement

No competing financial interests exist.

References

Darvish

, Movafagh

, Omrani

, et al. (2013) Detection of copy number changes in genes associated with Parkinson's disease in Iranian patients. Neurosci Lett, 551:75-78.

de Lau

, Breteler

(2006) Epidemiology of Parkinson's disease. Lancet Neurol, 5:525-535.

Emamalizadeh

, Movafagh

, Akbari

, et al. (2014) RIT2, a susceptibility gene for Parkinson's disease in Iranian population. Neurobiol Aging, 35:E27-E28.

Gonzalez

, Armengol

, Sole

, et al. (2007) SNPassoc: an R package to perform whole genome association studies. Bioinformatics, 23:644-645.

Goudarzian

, Khaligh

, Fourozan

, et al. (2015) The rs1572931 polymorphism of the RAB7L1 gene promoter is associated with reduced risk of Parkinson's disease. Neurol Res, 37:1029-1031.

Haghnejad

, Emamalizadeh

, Jamshidi

, et al. (2015) Variation in the miRNA-433 binding site of FGF20 is a risk factor for Parkinson's disease in Iranian population. J Neurol Sci, 355:72-74.

Hashimoto

, Nishi

, Nagasao

, et al. (2008) Magnesium exerts both preventive and ameliorating effects in an in vitro rat Parkinson disease model involving 1-methyl-4-phenylpyridinium (MPP+) toxicity in dopaminergic neurons. Brain Res, 1197:143-151.

Iida

, Takahashi

, Kubo

, et al. (2011) A functional variant in ZNF512B is associated with susceptibility to amyotrophic lateral sclerosis in Japanese. Hum Mol Genet, 20:3684-3692.

Jamshidi

, Movafagh

, Emamalizadeh

, et al. (2014) HLA-DRA is associated with Parkinson's disease in Iranian population. Int J Immunogenet, 41:508-511.

10.

, Liu

, Chen

, et al. (2015) Single-nucleotide polymorphism rs2275294 in is not associated with susceptibility to amyotrophic lateral sclerosis in a large Chinese cohort. Chin Med J (Engl), 128:3305-3309.

11.

Klein

, Westenberger

(2012) Genetics of Parkinson's disease. Cold Spring Harb Perspect Med, 2:a008888.

12.

Kolisek

, Launay

, Beck

, et al. (2008) SLC41A1 is a novel mammalian Mg2+ carrier. J Biol Chem, 283:16235-16247.

13.

Kolisek

, Nestler

, Vormann

, Schweigel-Rontgen

(2012) Human gene SLC41A1 encodes for the Na+/Mg(2)+ exchanger. Am J Physiol Cell Physiol, 302:C318-C326.

14.

Mandt

, Song

, Scharenberg

, Sahni

(2011) SLC41A1 Mg(2+) transport is regulated via Mg(2+)-dependent endosomal recycling through its N-terminal cytoplasmic domain. Biochem J, 439:129-139.

15.

Marchitti

, Brocker

, Stagos

, Vasiliou

(2008) Non-P450 aldehyde oxidizing enzymes: the aldehyde dehydrogenase superfamily. Expert Opin Drug Metab Toxicol, 4:697-720.

16.

Nasstrom

, Fagerqvist

, Barbu

, et al. (2011) The lipid peroxidation products 4-oxo-2-nonenal and 4-hydroxy-2-nonenal promote the formation of alpha-synuclein oligomers with distinct biochemical, morphological, and functional properties. Free Radic Biol Med, 50:428-437.

17.

Oyanagi

, Kawakami

, Kikuchi-Horie

, Ohara

, Ogata

, Takahama

, Wada

, Kihira

, Yasui

(2006) Magnesium deficiency over generations in rats with special references to the pathogenesis of the Parkinsonism-dementia complex and amyotrophic lateral sclerosis of Guam. Neuropathology, 26:115-128.

18.

Pagano

, Ferrara

, Brooks

, Pavese

(2016) Age at onset and Parkinson disease phenotype. Neurology, 86:1400-1407.

19.

Saris

, Mervaala

, Karppanen

, et al. (2000) Magnesium. An update on physiological, clinical and analytical aspects. Clin Chim Acta, 294:1-26.

20.

Satake

, Nakabayashi

, Mizuta

, et al. (2009) Genome-wide association study identifies common variants at four loci as genetic risk factors for Parkinson's disease. Nat Genet, 41:1303-1307.

21.

Schapira

, Jenner

(2011) Etiology and pathogenesis of Parkinson's disease. Mov Disord, 26:1049-1055.

22.

Schober

, Peterziel

, von Bartheld

, et al. (2007) GDNF applied to the MPTP-lesioned nigrostriatal system requires TGF-beta for its neuroprotective action. Neurobiol Dis, 25:378-391.

23.

Simon-Sanchez

, Schulte

, Bras

, et al. (2009) Genome-wide association study reveals genetic risk underlying Parkinson's disease. Nat Genet, 41:1308-1312.

24.

Tetsuka

, Morita

, Iida

, et al. (2013) ZNF512B gene is a prognostic factor in patients with amyotrophic lateral sclerosis. J Neurol Sci, 324:163-166.

25.

Tucci

, Nalls

, Houlden

, et al. (2010) Genetic variability at the PARK16 locus. Eur J Hum Genet, 18:1356-1359.

26.

Wang

, Cheng

, Li

, et al. (2015) Genetic analysis of SLC41A1 in Chinese Parkinson's disease patients. Am J Med Genet B Neuropsychiatr Genet, 168:706-711.

27.

Wang

, Tomso

, Liu

, Bell

(2005) Single nucleotide polymorphism in transcriptional regulatory regions and expression of environmentally responsive genes. Toxicol Appl Pharmacol, 207(2 Suppl):84-90.

28.

Yan

, Tian

, Mo

, et al. (2011) Genetic variants in the RAB7L1 and SLC41A1 genes of the PARK16 locus in Chinese Parkinson's disease patients. Int J Neurosci, 121:632-636.

29.

Yang

, Zhao

, An

, et al. (2015) Association of the functional SNP rs2275294 in ZNF512B with risk of amyotrophic lateral sclerosis and Parkinson's disease in Han Chinese. Amyotroph Lateral Scler Frontotemporal Degener, 17:142-147.

30.

Zhang

, Ye

, Wang

, et al. (2015) Aldehyde dehydrogenase 2 genetic variations may increase susceptibility to Parkinson's disease in Han Chinese population. Neurobiol Aging, 36:2660.e9-2660.e13.